CN114854831A - Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method - Google Patents
Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method Download PDFInfo
- Publication number
- CN114854831A CN114854831A CN202210237676.7A CN202210237676A CN114854831A CN 114854831 A CN114854831 A CN 114854831A CN 202210237676 A CN202210237676 A CN 202210237676A CN 114854831 A CN114854831 A CN 114854831A
- Authority
- CN
- China
- Prior art keywords
- concentration
- amplification
- amplification reagent
- reagent
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of normal-temperature isothermal amplification, and discloses a multienzyme combined normal-temperature isothermal amplification reagent, which comprises: RecA protein, the concentration of which in the amplification reagent is 20-150 mug/mL; the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 20-80 mug/mL; lambda phage Red beta protein, at a concentration of 20-150 μ g/mL in the amplification reagent; single-stranded binding protein (SSB) at a concentration of 200-600. mu.g/mL in the amplification reagent; DNA polymerase, the concentration in the amplification reagent is 50-150 mug/mL. The invention is based on the principle of a phage RedE/T and Escherichia coli RecA homologous recombination system, adopts related proteins from phage and Escherichia coli or similar proteins from other sources, aims to reduce the reaction temperature of nucleic acid amplification, and is suitable for normal temperature conditions; by adding auxiliary protein to improve the specificity of amplification reaction and enhance the reaction rate, the process of nucleic acid amplification can be directly completed without temperature cycle instruments such as a PCR instrument.
Description
Technical Field
The invention relates to the technical field of normal-temperature isothermal amplification, in particular to a multienzyme combined normal-temperature isothermal amplification reagent and an amplification method.
Background
The traditional nucleic acid in vitro amplification technology mainly adopts Polymerase Chain Reaction (PCR), and the PCR technology has been developed for more than 30 years since the invention of the Polymerase Chain Reaction (PCR) technology in 1983, and is widely applied to aspects of scientific research, clinical research and the like. As a traditional nucleic acid in vitro amplification technology, PCR is well received by the wide scientific research and biological medicine workers due to the advantages of the PCR in the aspects of sensitivity and specificity. The principle of the PCR technology is similar to that of a natural DNA replication process, mainly comprises three basic reaction steps of denaturation, annealing and extension, a small amount of nucleic acid molecules of a target sequence can be amplified to a detectable level by continuously repeating 3 steps, and the PCR technology has high sensitivity; the specificity depends on the oligonucleotide primers which are complementary to both ends of the sequence of interest. Denaturation of template DNA is achieved by heating to 90-95 ℃ for a period of time to dissociate the double stranded structure of the DNA into single strands for binding to the oligonucleotide primers. Annealing of the template DNA and the oligonucleotide primer is carried out, after the template DNA is denatured and melted into single strands at high temperature, the temperature is reduced to 52-60 ℃ and maintained for a certain time, and the primer and the complementary sequence of the single strand of the template DNA are spontaneously paired and combined in the process. The primer extension process is that the temperature of the template DNA single-strand-oligonucleotide primer combination is raised to 70-75 ℃ and maintained for a certain time under the action of DNA polymerase, dNTP is used as a reaction raw material, a target sequence is used as a template, a new strand which is complementary with a template DNA sequence is synthesized according to the base pairing and half-retention replication principle, and the synthesized new strand can be used as a template in the next cycle replication process. The PCR technology can achieve the effect of amplifying target genes by millions of times within 3 hours.
Although the application of PCR technology has been developed, there are still some limitations that cannot be overcome. Firstly, PCR needs a precise temperature-controlled PCR instrument to complete 3 basic reaction steps, and because the temperature-controlled PCR instrument has large volume and high price, the popularization and the field detection of the temperature-controlled PCR instrument in a basic layer are greatly limited, and the temperature-controlled PCR instrument is difficult to be applied beside a bed or outdoors; secondly, the PCR technology and the instrument operation are relatively complex, pollution is easily caused in the operation process, and operation is performed after professional training; moreover, the spontaneous annealing of the primers in each PCR cycle depends on base complementary pairing, the annealing time is generally short, the sensitivity is reduced, and the excessive primers are easy to generate mismatching with the template under the condition of low template amount to trigger false positive results.
The isothermal amplification technology is essentially different from the traditional PCR technology, mainly utilizes the activity of recombinase, can simply and quickly complete amplification reaction at a specific temperature, reduces the requirements on instruments and equipment because the temperature does not need to be changed in the process, and simultaneously reduces the requirement quantity of primers in the isothermal reaction process and the possibility of false results caused by mismatching of the primers, so the isothermal amplification technology is increasingly favored.
At present, various isothermal nucleic acid amplification methods, such as Strand Displacement Amplification (SDA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification (HDA), Rolling Circle Amplification (RCA), etc., have been developed, but these methods have the problems of large difference between the amplified products and the PCR amplified products, high temperature maintenance (e.g., 65 ℃), low specificity, etc., and deviate from the application requirements of simplicity, high efficiency, rapidness, etc., and are difficult to be widely popularized and applied.
Disclosure of Invention
The invention aims to provide a multienzyme combined normal-temperature isothermal amplification reagent and an amplification method, which solve the problems in the background technology.
In order to achieve the purpose, the invention provides the following technical scheme: the multi-enzyme combined normal-temperature isothermal amplification reagent comprises:
Tris-HCl in a concentration of 10-500mM in the amplification reagent;
potassium chloride in a concentration of 10-100mM in the amplification reagent;
magnesium chloride at a concentration of 10-50mM in the amplification reagents;
dithiothreitol at a concentration of 0-15mM in said amplification reagents;
polyvinylpyrrolidone, the concentration of which in the amplification reagent is 0-10%;
polyethylene glycol, the concentration in the amplification reagent is 0% -10%;
dATP, at a concentration of 1-10mM in the amplification reagent;
dNTPs at a concentration of 1-10mM in said amplification reagents;
bovine Serum Albumin (BSA) at a concentration of 100-500. mu.g/mL in the amplification reagent;
RecA protein, the concentration of which in the amplification reagent is 20-150 mug/mL;
the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 20-80 mug/mL;
lambda phage Red beta protein at a concentration of 20-150 μ g/mL in the amplification reagent;
single-stranded binding protein (SSB) at a concentration of 200-600. mu.g/mL in the amplification reagent;
DNA polymerase, the concentration of which in the amplification reagent is 50-150 μ g/mL;
oligonucleotide primer sets at concentrations of 0.3-0.6 μ M each in said amplification reagents.
In a preferred embodiment of the present invention, the RecA protein species is derived from escherichia coli, the Ecoli RecFOR protein complex species is derived from escherichia coli, the lambda phage Red beta protein species is derived from lambda phage, the single-stranded binding protein (SSB) is derived from T4 phage or gp32 of escherichia coli, the DNA polymerase is a DNA polymerase having a strand displacement activity at 25 ℃ to 42 ℃, the oligonucleotide primer set is designed based on a DNA or cDNA template sequence and comprises at least two primers, the dNTPs is an equimolar ratio mixture of dTTP, dATP, dGTP and dCTP, and the magnesium chloride is a magnesium ion preparation.
In a preferred embodiment of the present invention, the DNA polymerase is Sau DNA polymerase, Bsu DNA polymerase or Phi29 DNA polymerase.
As a preferred embodiment of the present invention, the magnesium ion preparation is magnesium chloride or magnesium acetate.
As a preferred embodiment of the invention, the molecular weight of the polyvinylpyrrolidone is 40000-1200000, and the molecular weight of the polyethylene glycol is 8000-20000.
The multi-enzyme combined normal-temperature isothermal amplification method adopts a multi-enzyme combined normal-temperature isothermal amplification reagent, and comprises the following steps of:
step 1: providing a DNA or cDNA template;
step 2: adding the multienzyme combined nucleic acid normal temperature isothermal amplification reagent of the invention, reacting for 15-40 minutes at 25-42 ℃ to complete the whole nucleic acid amplification reaction process.
Compared with the prior art, the invention provides a multienzyme combined normal-temperature isothermal amplification reagent and an amplification method, and the reagent has the following beneficial effects:
the invention is based on the principle of a phage RedE/T and Escherichia coli RecA homologous recombination system, adopts related proteins from phage and Escherichia coli or similar proteins from other sources, aims to reduce the reaction temperature of nucleic acid amplification, and is suitable for normal temperature; by adding auxiliary protein to improve the specificity of amplification reaction and enhance the reaction rate, the process of nucleic acid amplification can be directly completed without temperature cycle instruments such as a PCR instrument.
In the amplification system, the RecA protein, the Ecoli RecFOR protein complex and the lambda phage Red beta protein are jointly used, and are mainly positioned on a template nucleic acid molecule homologous target sequence in a chain invasion manner in the reaction and form chain displacement, so that a subsequence can be more copied and amplified from a template DNA sequence, and compared with the traditional nucleic acid amplification technology, the specificity and the sensitivity of subsequent amplification are improved, and the method is suitable for the amplification of a complex template; meanwhile, the Ecoli RecFOR protein complex can remove SSB bound on the oligonucleotide primer, promote primer release and binding with the template, and improve the initial amplification speed.
In the invention, lambda phage Red beta protein and a small amount of RecA protein are used for identifying and positioning the homologous sequence of the oligonucleotide primer and the template, and the specificity is enhanced by virtue of the primer identifying and positioning functions of the two proteins; meanwhile, because the lambda phage Red beta protein does not need to decompose dATP to provide energy, the demand of dATP and the inhibition effect brought by decomposition products are reduced, the requirement of a reaction system can be met only by adding a small amount of dATP, an energy supply system similar to phosphocreatine/creatine kinase does not need to be additionally added, the reagent composition is simplified, and the reaction efficiency and the amplification speed are improved.
The amplification system of the invention adopts the DNA polymerase with strand displacement activity at 25-42 ℃, can be carried out under the conditions of normal temperature and constant temperature, does not need temperature cycling instruments such as a PCR instrument and the like and a high-temperature incubator, is not limited by experimental space, reduces the dependence on temperature control, and is more suitable for the application in the POCT field.
The amplification technology of the invention can complete the whole nucleic acid amplification reaction process within 15 to 40 minutes, which is much faster than PCR technology or other isothermal amplification technology.
The amplification technology can be used for real-time fluorescence quantification, and is combined with detection modes such as gel electrophoresis, flow measurement chromatography reagent strips and the like, so that the application range is wider.
Drawings
FIG. 1 is a schematic diagram of the amplification principle of the multi-enzyme combined isothermal and isothermal amplification reagent of the present invention;
FIG. 2 is a 2% agarose gel electrophoresis of soybean internal reference gene GmEF1B amplified by a conventional PCR method and the amplification method of the present invention.
In FIG. 2: lane M: DL2000 Marker; lanes 1-3: amplifying the result by a multi-enzyme combined normal-temperature isothermal method; lanes 4-6: and (3) amplifying the result by a traditional PCR method.
Detailed Description
In order to make the technical means, the creation characteristics, the achievement purposes and the effects of the invention easy to understand, the invention is further described with the specific embodiments.
Example 1
The invention provides a technical scheme that: the multi-enzyme combined normal-temperature isothermal amplification reagent comprises:
Tris-HCl, the concentration in the amplification reagent is 10mM, is reaction buffer solution and is used for maintaining the pH value in a reaction system and ensuring the activity of various proteins, and the pH value is 7.2-8.6;
potassium chloride, at a concentration of 10mM in the amplification reagent, as an ionic salt, to maintain the stability of the protein in the system;
magnesium chloride at a concentration of 10mM in the amplification reagents;
dithiothreitol at a concentration of 0mM in the amplification reagents;
polyvinylpyrrolidone at a concentration of 0% in the amplification reagent;
polyethylene glycol at a concentration of 0% in the amplification reagent;
dATP, at a concentration of 1mM in the amplification reagent, which provides energy for the RecA protein to perform a strand displacement process between the template nucleic acid molecule and the primer-protein complex, while dATP is not required for other proteins to function;
dNTPs at a concentration of 1mM in said amplification reagents;
bovine Serum Albumin (BSA), the concentration of which in the amplification reagent is 100. mu.g/mL, is a protein protective agent and is used for maintaining the stability of the protein in the system;
RecA protein, at a concentration of 20 μ g/mL in the amplification reagents;
the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 20 μ g/mL;
lambda phage Red beta protein at a concentration of 20 μ g/mL in the amplification reagent;
a single-stranded binding protein (SSB) at a concentration of 200 μ g/mL in the amplification reagents;
DNA polymerase at a concentration of 50. mu.g/mL in the amplification reagents;
oligonucleotide primer sets at concentrations of 0.3 μ M each in the amplification reagents.
In this embodiment, the RecA protein species is derived from escherichia coli, the Ecoli RecFOR protein complex species is derived from escherichia coli, the λ phage Red β protein species is derived from λ phage, the single-stranded binding protein (SSB) is derived from T4 phage or gp32 of escherichia coli, the DNA polymerase is a DNA polymerase having strand displacement activity at 25 ℃ to 42 ℃, the oligonucleotide primer set is designed according to DNA or cDNA template sequence and comprises at least two primers, the length of the single primer is between 25bp to 45bp, no single primer sequence design contains a mixture capable of forming secondary structure and continuous repeat sequence, dNTPs is an equimolar mixture of dTTP, dATP, dGTP and dCTP, provides a raw material for new DNA strand synthesis during amplification, magnesium chloride is a magnesium ion preparation for activating DNA polymerase and maintaining protein activity, the reaction efficiency is improved, and the overall reaction time is reduced.
In this example, the DNA polymerase is Sau DNA polymerase, Bsu DNA polymerase or Phi29 DNA polymerase.
In this embodiment, the magnesium ion preparation is magnesium chloride or magnesium acetate.
In this embodiment, the molecular weight of the polyvinylpyrrolidone is 40000-1200000, the molecular weight of the polyethylene glycol is 8000-20000, and the polyvinylpyrrolidone and the polyethylene glycol are polymeric substances occupying a large portion of the volume of the reaction system and excluding other components, so that the other components in the amplification system are contacted more sufficiently, thereby improving the amplification efficiency.
It should be noted that the magnesium ion preparation, dNTPs and dATP in the amplification reagent are stored separately from other components, and when in use, the magnesium ion preparation, dNTPs and dATP can be fully and uniformly mixed with other components to start the whole amplification reaction, so that the occurrence of non-specific amplification can be avoided.
The embodiment also provides a technical scheme that the multi-enzyme combined normal-temperature isothermal amplification method adopts a multi-enzyme combined normal-temperature isothermal amplification reagent, and comprises the following steps:
step 1: providing a DNA or cDNA template;
step 2: adding the multienzyme-combined nucleic acid normal-temperature isothermal amplification reagent of the invention, reacting for 15-40 minutes at 25-42 ℃ to complete the whole nucleic acid amplification reaction process.
In this embodiment, the step 2 further comprises adding a reverse transcriptase, which is AMV, HIV or MMLV reverse transcriptase, for detecting the RNA sample.
In this embodiment, the step 2 further includes adding a fluorescent dye for quantitative analysis, where the fluorescent dye is SYBR Green or SYTO.
In this example, after the whole nucleic acid amplification reaction process is completed, the product is detected in a manner of gel electrophoresis or a flow-measuring chromatography reagent strip.
Example 2
The invention provides a technical scheme that: the multi-enzyme combined normal-temperature isothermal amplification reagent comprises:
Tris-HCl at a concentration of 500mM in the amplification reagents;
potassium chloride at a concentration of 100mM in the amplification reagents;
magnesium chloride at a concentration of 50mM in the amplification reagents;
dithiothreitol at a concentration of 15mM in said amplification reagents;
polyvinylpyrrolidone at a concentration of 10% in the amplification reagent;
polyethylene glycol at a concentration of 10% in the amplification reagent;
dATP, at a concentration of 10mM in the amplification reagent;
dNTPs at a concentration of 10mM in said amplification reagents;
bovine Serum Albumin (BSA) at a concentration of 500. mu.g/mL in the amplification reagent;
RecA protein, the concentration in the amplification reagent is 150 mug/mL;
the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 80 μ g/mL;
lambda phage Red beta protein at a concentration of 150 μ g/mL in the amplification reagent;
a single-stranded binding protein (SSB) at a concentration of 600 μ g/mL in the amplification reagents;
DNA polymerase at a concentration of 150. mu.g/mL in the amplification reagents;
oligonucleotide primer sets at concentrations of 0.6 μ M each in the amplification reagents.
In this embodiment, the RecA protein species is derived from escherichia coli, the Ecoli RecFOR protein complex species is derived from escherichia coli, the λ phage Red β protein species is derived from λ phage, the single-stranded binding protein (SSB) is derived from T4 phage or gp32 of escherichia coli, the DNA polymerase is a DNA polymerase having strand displacement activity at 25 ℃ to 42 ℃, the oligonucleotide primer set is designed according to DNA or cDNA template sequence and comprises at least two primers, the length of the single primer is between 25bp to 45bp, no single primer sequence design contains a mixture capable of forming secondary structure and continuous repeat sequence, dNTPs is an equimolar mixture of dTTP, dATP, dGTP and dCTP, provides a raw material for new DNA strand synthesis during amplification, magnesium chloride is a magnesium ion preparation for activating DNA polymerase and maintaining protein activity, the reaction efficiency is improved, and the overall reaction time is reduced.
In this example, the DNA polymerase is Sau DNA polymerase, Bsu DNA polymerase or Phi29 DNA polymerase.
In this embodiment, the magnesium ion preparation is magnesium chloride or magnesium acetate.
In this embodiment, the molecular weight of the polyvinylpyrrolidone is 40000-1200000, the molecular weight of the polyethylene glycol is 8000-20000, and the polyvinylpyrrolidone and the polyethylene glycol are polymeric substances occupying a large portion of the volume of the reaction system and excluding other components, so that the other components in the amplification system are contacted more sufficiently, thereby improving the amplification efficiency.
It should be noted that the magnesium ion preparation, dNTPs and dATP in the amplification reagent are stored separately from other components, and when in use, the magnesium ion preparation, dNTPs and dATP can be fully and uniformly mixed with other components to start the whole amplification reaction, so that the occurrence of non-specific amplification can be avoided
The embodiment also provides a technical scheme that the multi-enzyme combined normal-temperature isothermal amplification method adopts a multi-enzyme combined normal-temperature isothermal amplification reagent, and comprises the following steps:
step 1: providing a DNA or cDNA template;
step 2: adding the multienzyme combined nucleic acid normal temperature isothermal amplification reagent of the invention, reacting for 15-40 minutes at 25-42 ℃ to complete the whole nucleic acid amplification reaction process.
In this embodiment, the step 2 further comprises adding a reverse transcriptase, which is AMV, HIV or MMLV reverse transcriptase, for detecting the RNA sample.
In this embodiment, the step 2 further includes adding a fluorescent dye for quantitative analysis, where the fluorescent dye is SYBR Green or SYTO.
In this example, after the whole nucleic acid amplification reaction process is completed, the product is detected in a manner of gel electrophoresis or a flow-measuring chromatography reagent strip.
Example 3
The invention provides a technical scheme that: the multi-enzyme combined normal-temperature isothermal amplification reagent comprises:
Tris-HCl in a concentration of 10-200mM in the amplification reagent;
potassium chloride at a concentration of 80mM in the amplification reagents;
magnesium chloride at a concentration of 25mM in the amplification reagents;
dithiothreitol at a concentration of 10mM in said amplification reagents;
polyvinylpyrrolidone at a concentration of 10% in the amplification reagent;
polyethylene glycol at a concentration of 10% in the amplification reagent;
dATP, at a concentration of 5mM in the amplification reagents;
dNTPs at a concentration of 5mM in said amplification reagents;
bovine Serum Albumin (BSA) at a concentration of 500. mu.g/mL in the amplification reagent;
RecA protein, the concentration in the amplification reagent is 150 mug/mL;
the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 80 μ g/mL;
lambda phage Red beta protein at a concentration of 150 μ g/mL in the amplification reagent;
a single-stranded binding protein (SSB) at a concentration of 600 μ g/mL in the amplification reagents;
DNA polymerase at a concentration of 150. mu.g/mL in the amplification reagents;
oligonucleotide primer sets at concentrations of 0.6 μ M each in the amplification reagents.
In this embodiment, the RecA protein species is derived from escherichia coli, the Ecoli RecFOR protein complex species is derived from escherichia coli, the lambda phage Red β protein species is derived from lambda phage, the single-strand binding protein (SSB) is derived from T4 phage or gp32 of escherichia coli, the DNA polymerase is a DNA polymerase having strand displacement activity at 25 ℃ to 42 ℃, the oligonucleotide primer set is designed according to a DNA or cDNA template sequence and comprises at least two primers, the dNTPs is an equimolar mixture of dTTP, dATP, dGTP and dCTP, and the magnesium chloride is a magnesium ion preparation.
In this example, the DNA polymerase is Sau DNA polymerase, Bsu DNA polymerase or Phi29 DNA polymerase.
In this embodiment, the magnesium ion preparation is magnesium chloride or magnesium acetate.
In this embodiment, the molecular weight of the polyvinylpyrrolidone is 40000-.
The present embodiment further provides a technical solution, which is a multi-enzyme combined isothermal amplification method, using the multi-enzyme combined isothermal amplification reagent according to any one of claims 1 to 6, and includes the following steps:
step 1: providing a DNA or cDNA template;
step 2: adding the multienzyme combined nucleic acid normal temperature isothermal amplification reagent of the invention, reacting for 15-40 minutes at 25-42 ℃ to complete the whole nucleic acid amplification reaction process.
In this embodiment, the step 2 further includes adding reverse transcriptase for detecting the RNA sample.
In this embodiment, the step 2 further includes adding a fluorescent dye for quantitative analysis.
In this example, after the whole nucleic acid amplification reaction process is completed, the product is detected in a manner of gel electrophoresis or a flow-measuring chromatography reagent strip.
The preparation method of the multi-enzyme combined normal-temperature isothermal amplification reagent in the embodiments 1 to 3 is to mix and dissolve the components in the formula.
In order to verify the effect of the invention, the internal reference gene GmEF1B in the soybean cDNA is amplified by adopting the multienzyme combined normal-temperature isothermal amplification reagent and the amplification method, and the amplification steps are as follows:
1. extraction of total RNA from soybean leaf tissue
The Trizol (Invitrogen) method is used for extracting total RNA of plants, and comprises the following detailed steps:
(1) adding liquid nitrogen into 100mg of plant tissues, quickly grinding into powder, adding 1mL of Trizol, vortexing to form homogenate, and standing at room temperature for 5min to fully crack the homogenate;
(2) then adding 200 mu L of chloroform, shaking uniformly, and standing at room temperature for 10 min;
(3)4℃，12000rpm，15min；
(4) carefully pipette about 500-;
(5) adding 500 μ L isopropanol, mixing to obtain white flocculent precipitate, and standing at room temperature for 10 min;
(6)4℃，12000rpm，10min；
(7) discarding the supernatant, adding 75% ethanol solution, and performing vortex shaking to suspend the precipitate;
(8)4℃，12000rpm，3min；
(9) discarding the supernatant, reversely turning the centrifuge tube to remove the residual ethanol solution, and drying at room temperature for 10 min;
(10) then 50. mu.L RNase-free water is added for dissolving, 2. mu.L of the solution is taken for gel electrophoresis detection, and the rest samples are stored at-80 ℃.
2. Synthesis of first Strand cDNA
According to the instruction of the PrimeScript RT reagent Kit reverse transcription Kit of TaKaRa company, the specific operation process is as follows:
(1) RNA (approximately 2. mu.g) stored at-80 ℃ was dissolved on ice. The following reaction system was configured:
(2) reverse transcription program:
37℃ 15min
85℃ 5sec
4℃ min
(3) the product after reverse transcription is stored at-20 ℃ to avoid repeated freeze thawing.
3. The traditional PCR method is compared with the amplification method of the invention for amplifying the soybean internal reference gene GmEF1B
3.1 amplification of internal reference Gene GmEF1B in Soybean cDNA by traditional PCR method
(1) Taking cDNA reverse transcribed at the leaf part as a template, and preparing a PCR reaction system according to the following components:
the sequence of the GmEF1B primer is as follows:
GmEF1B-F:GGAGTTCACAGAGGCAGAG
GmEF1B-R:CACTTACGCATCACATAGCA
(2) after gentle mixing, PCR amplification was performed according to the following procedure:
(3) after the reaction is finished, the PCR product is detected by electrophoresis on 2% agarose gel. 3.2 Multi-enzyme combination Normal temperature isothermal method for amplifying soybean internal reference gene GmEF1B
(1) Preparing multi-enzyme combined normal temperature isothermal amplification reagent
The preparation of the 2 × amplification reagents Mix was carried out according to the following table:
in addition, a 0.5M magnesium chloride solution was prepared as a reaction initiator, and diluted to a working concentration of 25mM in the reaction system at the time of use.
(2) Preparing a reaction system
(2) To the reaction system, 1.25. mu.L of a 0.5M magnesium chloride solution was added and mixed immediately, and then immediately transferred to an incubator at 37 ℃ to start the reaction for 30 min.
(3) After the reaction is finished, the PCR product is detected by electrophoresis on 2% agarose gel.
4. Comparative analysis of test results
The result of a 2% agarose gel electrophoresis image obtained by amplifying soybean internal reference gene GmEF1B by a traditional PCR method and a multi-enzyme combined normal-temperature isothermal method is shown in figure 2, wherein a Lane M is a DL2000 Marker in the figure 2; lanes 1-3 are the amplification results of the amplification method of the present invention; lanes 4-6 show the results of conventional PCR amplification.
The analysis of the results shows that the soybean reference gene GmEF1B amplified by the traditional PCR method and the multi-enzyme combined normal-temperature isothermal method is about 225bp and is consistent with the expected result of experimental design, and meanwhile, the traditional PCR method and the multi-enzyme combined normal-temperature isothermal method both amplify a single specific strip, which fully indicates that the multi-enzyme combined normal-temperature isothermal method has high specificity; in addition, the brightness of the band amplified by the multi-enzyme combined normal-temperature isothermal method is higher than that of the traditional PCR method, which shows that more amplification products are obtained by the multi-enzyme combined normal-temperature isothermal method within 30min, and compared with the traditional PCR method, the time is more than 1.0 hour, and the amplification efficiency of the multi-enzyme combined normal-temperature isothermal method is higher.
While there have been shown and described what are at present considered the fundamental principles and essential features of the invention and its advantages, it will be apparent to those skilled in the art that the invention is not limited to the details of the foregoing exemplary embodiments, but is capable of other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the foregoing description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein. Any reference sign in a claim should not be construed as limiting the claim concerned.
Furthermore, it should be understood that although the present description refers to embodiments, not every embodiment may contain only a single embodiment, and such description is for clarity only, and those skilled in the art should integrate the description, and the embodiments may be combined as appropriate to form other embodiments understood by those skilled in the art.
Claims (10)
1. The multi-enzyme combined normal-temperature isothermal amplification reagent is characterized in that: the method comprises the following steps:
Tris-HCl in a concentration of 10-500mM in the amplification reagents;
potassium chloride in a concentration of 10-100mM in the amplification reagent;
magnesium chloride in a concentration of 10-50mM in the amplification reagent;
dithiothreitol at a concentration of 0-15mM in said amplification reagents;
polyvinylpyrrolidone, the concentration of which in the amplification reagent is 0-10%;
polyethylene glycol, the concentration in the amplification reagent is 0% -10%;
dATP, at a concentration of 1-10mM in the amplification reagent;
dNTPs at a concentration of 1-10mM in said amplification reagents;
bovine Serum Albumin (BSA) at a concentration of 100-500. mu.g/mL in the amplification reagent;
RecA protein, the concentration of which in the amplification reagent is 20-150 mug/mL;
the Ecoli RecFOR protein complex, the concentration in the amplification reagent is 20-80 mug/mL;
lambda phage Red beta protein, at a concentration of 20-150 μ g/mL in the amplification reagent;
single-stranded binding protein (SSB) at a concentration of 200-600. mu.g/mL in the amplification reagent;
DNA polymerase, the concentration of which in the amplification reagent is 50-150 μ g/mL;
oligonucleotide primer sets at concentrations of 0.3-0.6. mu.M each in the amplification reagents.
2. The multi-enzyme combined normal-temperature isothermal amplification reagent according to claim 1, wherein:
the concentration of Tris-HCl in the amplification reagent is 10-200 mM;
the concentration of potassium chloride in the amplification reagent is 25-80 mM;
the concentration of magnesium chloride in the amplification reagent is 10-25 mM;
the concentration of dithiothreitol in the amplification reagent is 5-10 mM;
the concentration of polyvinylpyrrolidone in the amplification reagent is 2% -10%;
the concentration of polyethylene glycol in the amplification reagent is 2% -10%;
the concentration of dATP in the amplification reagent is 1-5 mM;
the concentration of dNTPs in the amplification reagent is 1-5 mM;
the concentration of Bovine Serum Albumin (BSA) in the amplification reagent is 200-;
the concentration of RecA protein in the amplification reagent is 75-150 mug/mL;
the concentration of the Ecoli RecFOR protein complex in the amplification reagent is 40-80 mug/mL;
the concentration of the lambda phage Red beta protein in the amplification reagent is 75-150 mu g/mL;
the concentration of single-stranded binding protein (SSB) in the amplification reagent is 300-600 mu g/mL;
the concentration of the DNA polymerase in the amplification reagent is 75-150 mug/mL;
the concentration of the oligonucleotide primer sets in the amplification reagents was 0.3-0.6. mu.M each.
3. The multi-enzyme combined isothermal amplification reagent of claim 1 or 2, wherein: the RecA protein type is derived from escherichia coli, the Ecoli RecFOR protein complex type is derived from escherichia coli, the lambda phage Red beta protein type is derived from lambda phage, the single-stranded binding protein (SSB) is derived from T4 phage or gp32 of escherichia coli, the DNA polymerase is DNA polymerase with strand displacement activity at 25-42 ℃, the oligonucleotide primer set is designed according to a DNA or cDNA template sequence and at least comprises two primers, the dNTPs are mixed liquid of dTTP, dATP, dGTP and dCTP in equal molar ratio, and the magnesium chloride is a magnesium ion preparation.
4. The multi-enzyme combined normal-temperature isothermal amplification reagent according to claim 3, wherein: the DNA polymerase is Sau DNA polymerase, Bsu DNA polymerase or Phi29 DNA polymerase.
5. The multi-enzyme combined normal-temperature isothermal amplification reagent according to claim 3, wherein: the magnesium ion preparation is magnesium chloride or magnesium acetate.
6. The multi-enzyme combined normal-temperature isothermal amplification reagent according to claim 3, wherein: the molecular weight of the polyvinylpyrrolidone is 40000-1200000, and the molecular weight of the polyethylene glycol is 8000-20000.
7. The multi-enzyme combined normal-temperature isothermal amplification method adopts the multi-enzyme combined normal-temperature isothermal amplification reagent of any one of claims 1 to 6, and is characterized in that: the method comprises the following steps:
step 1: providing a DNA or cDNA template;
step 2: adding the multienzyme combined nucleic acid normal temperature isothermal amplification reagent of the invention, reacting for 15-40 minutes at 25-42 ℃ to complete the whole nucleic acid amplification reaction process.
8. The multi-enzyme combined normal-temperature isothermal amplification method according to claim 7, characterized in that: in the step 2, reverse transcriptase is added for detecting the RNA sample.
9. The multi-enzyme combined normal-temperature isothermal amplification reagent and the amplification method according to claim 7, wherein the reagent comprises: in the step 2, a fluorescent dye is added for quantitative analysis.
10. The multi-enzyme-linked isothermal amplification reagent and the amplification method according to claim 7, 8 or 9, wherein: after the whole nucleic acid amplification reaction process is completed, the product is detected in a mode of combining gel electrophoresis or a flow measuring chromatography reagent strip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210237676.7A CN114854831A (en) | 2022-03-11 | 2022-03-11 | Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210237676.7A CN114854831A (en) | 2022-03-11 | 2022-03-11 | Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114854831A true CN114854831A (en) | 2022-08-05 |
Family
ID=82627874
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210237676.7A Pending CN114854831A (en) | 2022-03-11 | 2022-03-11 | Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114854831A (en) |
-
2022
- 2022-03-11 CN CN202210237676.7A patent/CN114854831A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wickner et al. | DnaJ, DnaK, and GrpE heat shock proteins are required in oriP1 DNA replication solely at the RepA monomerization step. | |
| JP7033602B2 (en) | Barcoded DNA for long range sequencing | |
| EP1954706A4 (en) | Selective terminal tagging of nucleic acids | |
| JP6249947B2 (en) | Compositions and methods for RT-PCR comprising anionic polymers | |
| JP2003532380A (en) | Production of single-stranded circular DNA from linear self-annealing segments | |
| CN106868005B (en) | Anchor primer for efficiently and quickly amplifying cDNA (complementary deoxyribonucleic acid) terminal and amplification method | |
| JP5200302B2 (en) | Identification of RNA targets using helicases | |
| US10017728B2 (en) | Methods for making ribosomes | |
| CN104975013A (en) | Method for accelerating spiral reaction of polymerase and application of method | |
| US20210310048A1 (en) | Method for generating single-stranded circular dna libraries for single molecule sequencing | |
| CN105112399A (en) | Fluorescent constant-temperature amplification technique | |
| Silflow et al. | Sequence complexity of polyadenylated ribonucleic acid from soybean suspension culture cells | |
| CN111154739A (en) | Novel recombinase-dependent amplification method and kit | |
| WO2016135300A1 (en) | Efficiency improving methods for gene library generation | |
| WO2023246032A1 (en) | One-pot single-stranded dna cyclization and amplification and crispr/cas-mediated nucleic acid molecule detection method | |
| CN104789667A (en) | Small RNA (ribonucleic acid) detection kit and quantitative method based on unbiased recognition and isothermal amplification | |
| CN116497093A (en) | Efficient constant-temperature amplification method | |
| CN111808932B (en) | Circular RNA detection method and kit | |
| WO2018014799A1 (en) | Recombinase polymerase amplification reagent kit, amplification method, and amplification reagent | |
| CN105087795A (en) | Isothermal amplification technology | |
| CN114854831A (en) | Multi-enzyme combined normal-temperature isothermal amplification reagent and amplification method | |
| CN114908083B (en) | Method for in-vitro rapid synthesis of double-stranded circular DNA | |
| CN107034211B (en) | PCR reaction system and kit for high GC fragment amplification | |
| CN112080555A (en) | DNA methylation detection kit and detection method | |
| CN116240213A (en) | Light-responsive nucleic acid aptamer, light-activated DNA polymerase and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |