CN114854777A

CN114854777A - Broad-spectrum influenza vaccine based on optimized NA sequence and application thereof

Info

Publication number: CN114854777A
Application number: CN202210393105.2A
Authority: CN
Inventors: 孙彩军; 韩子蓉; 刘星来; 李瑞婷
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2022-04-15
Filing date: 2022-04-15
Publication date: 2022-08-05
Anticipated expiration: 2042-04-15
Also published as: CN114854777B

Abstract

The invention discloses a broad-spectrum influenza vaccine based on an optimized NA sequence and application thereof, wherein the nucleotide sequence of the optimized NA sequence is shown as SEQ ID NO:1 is shown. The inventor mediates enhancement of CD4 by fusing autophagy key gene LC3b with optimized NA sequence ⁺ T cell response, and NA tetramer and VSV vector are constructed by adding elements, so that a broad-spectrum influenza vaccine capable of inducing more cross protection is obtained. The inventor verifies the immunogenicity of the broad-spectrum influenza vaccine in mice through experiments, and evaluates the protection effect of the broad-spectrum influenza vaccine through challenge experiments to research and develop high-efficiency influenzaBroad-spectrum influenza vaccine lays the foundation.

Description

Broad-spectrum influenza vaccine based on optimized NA sequence and application thereof

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to a broad-spectrum influenza vaccine based on an optimized NA sequence and application thereof.

Background

Seasonal influenza viruses pose a great threat to global public health safety, and can cause significant morbidity and mortality especially in high-risk groups such as infants and the elderly. It is estimated that influenza epidemics cause about 300 to 500 ten thousand severe cases per year, about 29 to 65 ten thousand deaths associated with respiratory illness, worldwide. Currently, there are several antiviral drugs used to treat seasonal influenza in humans, but drug resistance is becoming more and more severe. Vaccination is currently considered to be the most effective method of preventing influenza infection, pathogenesis, and transmission. The influenza vaccine can effectively reduce the infection chance of the vaccinee and alleviate the influenza symptoms, and is an important means for preventing the occurrence and the spread of the influenza. To date, influenza vaccines have been vaccinated for over 60 years. Influenza vaccines that are now approved for marketing include trivalent inactivated influenza vaccines, tetravalent inactivated influenza vaccines, and a nasal spray of trivalent attenuated live influenza vaccine. However, according to the research of the world health organization on the protective effect of the influenza vaccine, the average protective rate is only 39.9%, and is even lower than 20% in part of years, which indicates that the overall protective effect of the current influenza vaccine is poor. Therefore, the development of novel broad-spectrum influenza vaccines has important public health significance.

The major surface antigens of influenza virus include trimeric Hemagglutinin (HA) protein and tetrameric Neuraminidase (NA) protein, both of which cause the body to generate strong humoral immune response. The high variability of influenza virus sequences makes universal influenza vaccine development extremely challenging. For example, influenza a viruses have been found to have 18 HA subtypes and 11 NA subtypes. HA glycoproteins are the primary targets of neutralizing antibodies, which mediate attachment and fusion of host cell membranes, and are often used as targets for developing influenza vaccines. However, during antigenic drift variation, epitopes to the HA receptor binding domain are often mutated, so that the effectiveness of existing influenza vaccines varies from year to year. In addition to HA, the efficacy of influenza vaccines may also be affected by other antigens of the influenza virus. Therefore, the development of new influenza vaccines with cross-protection against different viral strains is a major scientific problem that needs to be solved urgently.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides a broad-spectrum influenza vaccine based on an optimized NA sequence and application thereof. Invention of the inventionHuman takes optimized influenza virus NA sequence as core, and mediates and enhances CD4 by fusing autophagy key gene LC3b with the core ⁺ T cell response, further adding elements to construct an NA tetramer, and constructing to obtain a recombinant vesicular stomatitis virus (rVSV) vector NA vaccine, thereby providing a new idea for research and development of novel broad-spectrum influenza vaccines and providing a reference for research of novel strategies for prevention and control of influenza viruses.

In a first aspect of the invention, there is provided an optimized nucleic acid molecule for influenza virus neuraminidase.

According to a first aspect of the invention, in some embodiments of the invention, the nucleotide sequence of the optimized nucleic acid molecule is:

(1) as shown in SEQ ID NO: 3; or

(2) Converting SEQ ID NO: 3 is obtained by substitution and/or deletion and/or addition of one or more modified base sequences, and the obtained nucleotide sequence is consistent with the amino acid sequence obtained by translation of the nucleotide sequence in (1).

In some preferred embodiments of the invention, the amino acid sequence of SEQ ID NO: 3, the nucleotide sequence is obtained by taking NA protein genes of influenza A virus H1N1 and influenza A virus H3N2 as research objects and optimizing the gene sequence according to the codon usage bias of mammalian cells and the codon optimization experience of the inventor, and the C-terminal stop codon (-TAA) in the sequence is removed.

Another major surface glycoprotein of influenza viruses is NA, a homotetramer of 470 amino acid monomers with sialidase and neuraminidase activity that cleaves sialic acid from N-terminally linked polysaccharides that act as receptors. The anti-NA antibody can block the interaction between NA and a substrate thereof, further inhibit the release of newly synthesized progeny virus particles from the inside of infected cells, reduce virus proliferation and play a role in immune protection. Furthermore, antigenic drift changes of HA and NA occur independently, and NA exhibits a slower drift rate than HA. Thus, when HA undergoes antigenic drift, the NA-specific immune response may still provide a degree of cross-protection. The inventors believe that the NA protein HAs great potential as a protective or even cross-protective vaccine antigen, e.g. more conserved NA antigens can induce cross-protective immune responses independent of the relevant HA or the emergence of HA subtype viruses that humans have not yet been exposed to.

The NA antibody has a protective effect in vivo, and the single NA antibody can effectively reduce the severity of diseases caused by influenza virus infection. Furthermore, NA antibody titers are inversely correlated with the incidence of seasonal human influenza infection and have been shown to effectively inhibit the elution of nascent virions from infected cells. Therefore, NA antigens are likely to be ideal antigen targets for a broad-spectrum influenza vaccine. However, a big problem of using NA as a target antigen of influenza vaccine is that it has poor self-immunogenicity, and naturally induces a low level of NA immune response. Therefore, optimizing immunization strategies to improve the immunogenicity of NA, and thus to protect different influenza strains permanently and extensively, is an important direction in the development of universal influenza vaccines.

In some preferred embodiments of the invention, the influenza a virus H1N1 is specifically a/California/04/2009; the influenza A virus H3N2 is specifically A/Switzerland/9715293/2013.

In a second aspect of the invention, there is provided a product comprising an optimised nucleic acid molecule according to the first aspect of the invention, the product comprising:

(1) an expression cassette comprising an optimized nucleic acid molecule according to the first aspect of the invention; or

(2) A recombinant vector comprising the optimized nucleic acid molecule of the first aspect of the present invention or the expression cassette of (1); or

(3) A recombinant microorganism comprising an optimized nucleic acid molecule according to the first aspect of the present invention or an expression cassette according to (1) or a recombinant vector according to (2).

According to a second aspect of the invention, in some embodiments of the invention, the microorganism comprises a virus and a bacterium.

In some embodiments of the invention, the virus is a vesicular stomatitis virus. Of course, other viruses, including but not limited to the vesicular stomatitis virus described above, can be used as recombinant vectors by those skilled in the art according to the actual use requirements.

In a third aspect of the invention, there is provided a set of combinations of nucleic acid molecules comprising an optimized nucleic acid molecule according to the first aspect of the invention and a tetramerization domain sequence.

Tetramerization domain sequence (Tetramerization motif) is 15 repeating residues in human vasodilator-stimulated phosphoprotein (VASP) for promoting Tetramerization between monomeric NA.

In some embodiments of the invention, the nucleotide sequence of the tetramerization domain sequence is set forth in SEQ ID NO: 5, respectively.

According to a third aspect of the invention, in some embodiments of the invention, the LC3b gene sequence is further included in the combination of nucleic acid molecules.

The LC3b gene is a key gene for autophagy, and in the present invention, the inventors enhanced the level of cellular immune response induced by the target antigen by using the autophagy mechanism. Autophagy is the mechanism by which cells can survive by degrading some components within the cells to obtain nutrients in the absence of nutrients or in response to an external stress. It also plays an important role in innate immunity and adaptive immunity. While microtubule-associated protein light chain 3beta (LC3b) is a soluble protein with a molecular weight of about 17kDa that is widely distributed in all cell types of mammals. During autophagy, autophagy can phagocytose cytoplasmic proteins and components in cytoplasm such as organelles, meanwhile cytoplasmic LC3 protein (LC 3-I) is covalently coupled with phosphatidylethanolamine under the catalysis of enzymes such as Atg7 and Atg3 to form LC 3-II protein, then autophagosome carrying LC 3-II protein is fused with lysosome to form autophagosomes, and the inner solution of the autophagosome is degraded by hydrolase in the lysosome and carries out antigen presentation. Since the LC3B protein plays a key role in autophagy, the fusion expression of the target antigen protein (optimized NA protein in the present invention) and the autophagy-related protein LC3b by the inventors will enhance the antigen presentation of MHC class ii molecules mediated by autophagosomes, thereby more effectively inducing an anti-viral CD4+ T cell immune response and further enhancing the antibody response. The inventors believe that this antigen presentation by MHC class ii molecules that enhance endogenous proteins (including viral antigens) by autophagy mechanisms would be of significant implication for the development of antiviral vaccines.

In some embodiments of the invention, the LC3b gene sequence is as set forth in SEQ ID NO: 4, respectively.

In a fourth aspect of the invention, there is provided a product containing a combination of nucleic acid molecules according to

claim

3 or 4, said product comprising:

(1) an expression cassette comprising a combination of nucleic acid molecules comprising the optimized nucleic acid molecule of the first aspect of the invention, a tetramerization domain sequence; or (2) an expression cassette comprising a combination of an optimized nucleic acid molecule according to the first aspect of the invention, a tetramerization domain sequence and a nucleic acid molecule according to the LC3b gene sequence; or

(3) A recombinant vector comprising the optimized nucleic acid molecule of the first aspect of the invention, the nucleic acid molecule combination of the tetramerization domain sequence or the expression cassette of (1); or (4) a combination of nucleic acid molecules comprising the optimized nucleic acid molecule of the first aspect of the invention, the tetramerization domain sequence and the LC3b gene sequence or (2); or

(5) A recombinant microorganism comprising the optimized nucleic acid molecule of the first aspect of the present invention, a combination of nucleic acid molecules comprising the tetramerization domain sequence of the first aspect of the present invention, or the expression cassette of (1) or the recombinant vector of (3); or a recombinant microorganism comprising the combination of the optimized nucleic acid molecule of the first aspect of the present invention, the tetramerization domain sequence and the LC3b gene sequence, or the expression cassette of (2) or the recombinant vector of (4).

According to a fourth aspect of the invention, in some embodiments of the invention, the microorganism comprises a virus and a bacterium.

Suitable delivery systems are also one of the key to the success of the development of new vaccines. Compared with other vaccine types, the live virus vector vaccine has the advantages of economy, high efficiency, easy industrial production and the like. There are many types of previously used live viral vectors, including adenovirus vectors, vaccinia virus vectors, and the like. Vesicular stomatitis virus belongs to a member of the Rhabdoviridae (Rhabdoviridae), Vesiculovirus (Vesiculovirus) genus. VSV is an unfragmented, single-stranded, negative-strand RNA virus with a membrane structure. In the present invention, VSV has many unique advantages as a live virus vaccine vector: the VSV genome has simple structure and is easy to operate; the seropositive rate is low in common people, and the safety to human bodies is high; wide immunization routes and the like.

In a fifth aspect of the invention, there is provided the use of a product according to the second aspect of the invention or a product according to the fourth aspect of the invention in the manufacture of a product for the prophylaxis, treatment or co-treatment of influenza; the product comprises vaccine, antibody and medicine.

In the invention, the prepared vaccine belongs to a new generation of influenza vaccine, namely a universal influenza vaccine, and can achieve broad-spectrum and high-efficiency protection effect and protection range. Even if the universal influenza vaccine cannot ensure the effect of lifetime immunity, the universal influenza vaccine should provide enough immune protection barriers for the vaccinated people within at least several years, and avoid the phenomenon of annual replacement of the current influenza vaccine.

Antigen design is a key prerequisite for the development of novel vaccines, and in the invention, the inventors use NA protein as an important target for the development of novel influenza vaccines. In view of the poor autoimmunity of the NA protein, the inventor further explores a series of novel vaccine strategies for enhancing the immunogenicity of the NA protein, including fusion of autophagy key gene LC3b and the NA gene so as to mediate and enhance CD4+ T cell response, construction of NA tetramers by adding elements, construction of recombinant vesicular stomatitis virus (rVSV) vector NA vaccines and the like.

The broad-spectrum influenza vaccine obtained based on the application can effectively overcome the problem that the effectiveness of the influenza vaccine is greatly differentiated due to frequent mutation of the epitope of the binding domain of the surface glycoprotein HA receptor of the influenza virus in the drifting and conversion processes of the influenza virus antigen. Therefore, compared with the traditional HA-targeted influenza vaccine, the vaccine provided by the invention HAs more conservation and stability, and a novel broad-spectrum influenza vaccine which can induce more cross-protection is developed from multiple aspects such as selection of a delivery carrier, antigen design and antigen modification.

Moreover, in the traditional influenza vaccine research, the work is focused on mainly searching for the immune response of the stimulated neutralizing antibody or the killer CD8+ T cell, the invention firstly proposes to utilize an autophagy mechanism of an organism to research and develop the influenza vaccine, and improves the immune response of the functional CD4+ T cell by fusing NA and autophagy-related protein LC3b to research and develop the high-efficiency broad-spectrum influenza vaccine.

In a sixth aspect of the invention, there is provided use of a product according to the second aspect of the invention or a product according to the fourth aspect of the invention in the manufacture of a product for detecting influenza virus; the product comprises a detection reagent and a detection kit.

The invention has the beneficial effects that:

1. compared with the traditional HA-targeted influenza vaccine, the broad-spectrum influenza vaccine selects the NA antigen of the influenza virus with more conservation as a target, and combines multiple aspects such as an NA gene optimized based on the antigen, an LC3b gene, a VSV delivery vector and the like to obtain the broad-spectrum influenza vaccine with more cross protection.

2. The broad-spectrum influenza vaccine provided by the invention abandons the design idea of searching for the immune response of the stimulated neutralizing antibody or the killer CD8+ T cell in the traditional vaccine, improves the immune response of the functional CD4+ T cell by fusing NA and autophagy-related protein LC3b, verifies the immunogenicity of the broad-spectrum influenza vaccine in a mouse through an experiment, evaluates the excellent protection effect of the broad-spectrum influenza vaccine through a challenge experiment, and lays a foundation for researching and developing the high-efficiency broad-spectrum influenza vaccine.

Drawings

FIG. 1 is a plasmid map of pVAX-Tetram-NA1-LC3b in this example.

FIG. 2 is a plasmid map of the recombinant viral vector VSV-Teram-NA1-LC3b in this example.

FIG. 3 is a plasmid map of pVAX-Tetram-NA1 in this example.

FIG. 4 is a plasmid map of pVAX-NA1-LC3b in this example.

FIG. 5 is a plasmid map of the recombinant viral vector VSV-NA1 in this example.

FIG. 6 is a plasmid map of the recombinant viral vector VSV-Tetram-NA1 in this example.

FIG. 7 is a plasmid map of the recombinant viral vector VSV-NA1-LC3b in this example.

Fig. 8 shows the results of the expression verification of the anti-flag, anti-LC 3B and anti-NA 1 monoclonal antibodies of the recombinant vaccine in this embodiment, wherein a is anti-flag, and B is anti-LC 3B and anti-NA 1.

FIG. 9 shows the level of mouse anti-NA 1 antibody induced by the recombinant vaccine of this example, where A is the recombinant DNA vaccine and B is the recombinant VSV vaccine.

FIG. 10 shows the ELISPOT assay results of the recombinant DNA vaccine and the recombinant VSV vaccine of this example with mouse lymphocytes.

FIG. 11 shows the results of detecting the cytokine secretion by mouse CD3+ cells in the recombinant DNA vaccine and recombinant VSV vaccine groups of this example.

FIG. 12 shows the results of detecting cytokine secretion by mouse CD4+ and CD8+ cells in the recombinant VSV vaccine group of this example.

Fig. 13 is a graph showing survival rates of mice in each group after challenge, in which Ca04 represents a positive control group.

FIG. 14 is a graph showing the change in body weight of mice in each group after challenge, in which Ca04 represents a positive control group.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Broad-spectrum influenza vaccine

In the embodiment of the invention, the inventor fuses the autophagy-related protein LC3b with the NA antigen of influenza virus, then adds elements to construct a NA tetramer, and constructs a recombinant VSV vector vaccine by the NA tetramer, wherein the specific preparation method is as follows:

in this example, the inventors have studied the NA protein genes of influenza A virus H1N1(A/California/04/2009) and influenza A virus H3N2(A/Switzerland/9715293/2013), and optimized the gene sequences according to the codon usage bias of mammalian cells and the inventors' codon optimization experience. The C-terminal stop codon (-NA of TAA) of the NA gene was removed by PCR amplification to obtain a codon-optimized NA sequence (NA 1). Wherein, the primers used for PCR amplification of the target gene are as follows:

a forward primer: 5'-ATGAACCCCAACCAGAAGATCA-3' (SEQ ID NO: 1);

reverse primer: 5'-CTTGTCAATGGTGAATGGCAGCTCAG-3' (SEQ ID NO: 2).

The NA gene cDNA was used as a template, and the PCR amplification reaction system is shown in Table 1:

TABLE 1PCR amplification reaction System

Components	Content (wt.)
		10 xrtaq polymerase buffer	2.5μL
2.5mmol L ^-1 dNTP	2.0. mu.L each
		25mmol L ^-1 MgCl ₂	1.5μL
10mmol L ^-1 Forward primer	1.0μL
		10mmol L ^-1 Reverse primer	1.0μL
NA gene cDNA template	1.0μL
		rTaq polymerase	0.2μL
RNase-free water	Make up to 25.0 mu L

Pre-denaturation at 95 ℃ for 5min for 1 cycle; denaturation at 95 ℃ for 30 seconds, annealing at 58 ℃ for 30 seconds, extension at 72 ℃ for 30 seconds, and 30 cycles; final extension at 72 ℃ for 10min and incubation at 16 ℃.

Wherein the nucleotide sequence of the NA sequence (NA1) after codon optimization is shown as SEQ ID NO: 3, respectively.

The LC3b gene was synthesized. In the embodiment of the invention, the LC3b gene selects the murine LC3b gene, and the murine LC3b gene is obtained from NCBI database by a whole gene synthesis method.

The nucleotide sequence of the synthesized LC3b gene is as follows: 5'-ATGCCGTCCGAGAAGACCTTCAAGCAGCGCCGGAGCTTTGAACAAAGAGTGGAAGATGTCCGGCTCATCCGGGAGCAGCACCCCACCAAGATCCCAGTGATTATAGAGCGATACAAGGGGGAGAAGCAGCTGCCCGTCCTGGACAAGACCAAGTTCCTGGTGCCTGACCACGTGAACATGAGCGAGCTCATCAAGATAATCAGACGGCGCTTGCAGCTCAATGCTAACCAAGCCTTCTTCCTCCTGGTGAATGGGCACAGCATGGTGAGTGTGTCCACTCCCATCTCCGAAGTGTACGAGAGTGAGAGAGATGAAGACGGCTTCCTGTACATGGTTTATGCCTCGCAGGAGACATTCGGGACAGCAATGGCTGTG-3' (SEQ ID NO: 4).

The LC3b gene synthesized as described above was constructed into a DNA vector pVAX (commercially available from Invitrogen, USA) according to a conventional molecular biology technique to obtain pVAX-LC3 b. And then constructing an LC3b gene, a NA sequence (NA1) after codon optimization and a Tetramerization domain sequence (Tetramerization motif) in pVAX-LC3b in a blank pVAX vector by an enzyme digestion ligation method to obtain pVAX-Tetram-NA1-LC3 b.

Among them, Tetramerization domain sequence (Tetramerization motif) is 15 repeated residues of human vasodilator-stimulated phosphoprotein (VASP) for promoting Tetramerization between monomeric NAs.

The nucleotide sequence of the tetramerization domain sequence is as follows:

5’-TCCTCCTCTGACTACTCTGACCTGCAGAGGGTGAAGCAGGAGCTGCTGGAGGAGGTGAAGAAGGAGCTGCAGAAGGTGAAGGAGGAGATCATTGAGGCCTTTGTGCAGGAGCTGAGGAAGAGGGGCTCCCTGGTGCCCAGGGGCTCCCCATCCAGGTCC-3’(SEQ ID NO：5)。

the plasmid map of pVAX-Tetram-NA1-LC3b finally obtained in the example is shown in figure 1, and the specific nucleotide sequence is shown in SEQ ID NO: and 6.

Wherein, the underlined part represents Tetram-N1-LC3b expression fragment. The pVAX-Tetram-NA1-LC3b is the DNA vaccine.

A purified Tetram-N1-LC3b expression fragment was obtained by using pVAX-Tetram-NA1-LC3b, and packaged with Vesicular Stomatitis Virus (VSV) based on a homologous recombination strategy to obtain a recombinant viral vector VSV-Tetram-NA1-LC3b (accession number: VB201105-1813 gvu).

The plasmid map of the recombinant virus vector VSV-Teram-NA1-LC3b is shown in FIG. 2, and the specific nucleotide sequence is shown in SEQ ID NO: shown at 7.

The recombinant virus vector VSV-Teram-NA1-LC3b is the broad-spectrum influenza vaccine.

Actual immunization effect of the broad-spectrum influenza vaccine

In order to effectively demonstrate the effectiveness of the broad-spectrum influenza vaccine, the inventors constructed plasmid vectors such as pVAX-NA 1(a blank pVAX vector having only the NA1 sequence inserted therein), pVAX-NA1-LC3b (a blank pVAX vector having only the NA1 sequence and the LC3b gene inserted therein), pVAX-Tetram-NA 1(a blank pVAX vector having only the NA1 sequence and the tetramerization domain sequence inserted therein), and pVAX-LC3b (a blank pVAX vector having only the LC3b gene inserted therein) as controls, respectively, based on the above method, and compared the difference in immune effect between different plasmid vectors.

Wherein the plasmid map of pVAX-Tetram-NA1 is shown in figure 3, and the plasmid map of pVAX-NA1 is shown in figure 4. The nucleotide sequence of the NA1-LC3b expression fragment in the pVAX-NA1-LC3b plasmid is shown as SEQ ID NO: shown in fig. 8.

The nucleotide sequence of the Tetram-NA1 expression fragment in the pVAX-Tetram-NA1 plasmid is shown as SEQ ID NO: shown at 9.

According to the above method, plasmid vectors such as pVAX-NA1, pVAX-NA1-LC3b, pVAX-Tetram-NA1 and pVAX-LC3b obtained by construction are used to obtain purified NA1, NA1-LC3b, Tetram-N1 and LC3b expression fragments, and then VSV is packaged based on a homologous recombination strategy to obtain a recombinant virus vector VSV-NA1 (numbered VB201105-1805prf), a recombinant virus vector VSV-NA1-LC3b (numbered VB201105-1812rrz), a recombinant virus vector VSV-Tetram-N1 (numbered VB201105-1806bue) and a recombinant virus vector VSV-LC3 b. Wherein, blank recombinant virus vector VSV-eGFP inserted with eGFP gene is used as blank control.

Wherein, the plasmid maps of the recombinant virus vector VSV-NA1, the recombinant virus vector VSV-Tetram-N1 and the recombinant virus vector VSV-NA1-LC3b are respectively shown in figure 5, figure 6 and figure 7.

(1) Detecting the expression condition of the DNA vaccine:

detecting the expression conditions of pVAX-NA1, pVAX-NA1-LC3b, pVAX-Tetram-NA1, pVAX-LC3b and pVAX-Tetram-NA1-LC3 b:

1) plasmid transfection: use of

The expression plasmid was transfected with 2000 CD Transfection Reagent (Invitrogen) (refer to the manufacturer's standard manual for details of the procedure). The method comprises the following steps: cell plating is carried out according to the number of 50-60 ten thousand per hole, and transfection is carried out after the cultured cells grow to 80% fusion; solution A (100. mu.L of Opti-MEM and 3. mu.L of lipo2000) and solution B (100. mu.L of Opti-MEM and 2. mu.g of plasmid to be transfected) were prepared according to the instructions; adding the solution A into the solution B, and standing for 15 min; discard cultureMedium, Opti-MEM medium was added at 1 mL/well, the A/B complex was added and incubated for 4-6 hours, the medium was replaced with DMEM containing 1% penicillin-streptomycin and 5% FBS, and the medium was incubated for 24 hours or 48 hours to express the specific gene.

2) Extraction of Total cell protein-discard the medium and add 250. mu.L of lysate per well (according to RIPA: PMSF: protease inhibitors: phosphatase inhibitors: protease inhibitor prepared at a ratio of 100:1:1:1: 1) and placed on ice for 3-5 min. The mixture was subjected to shaking lysis in a refrigerator at 4 ℃ for 15min (gently patted and mixed every 5 min). The mixture was transferred to a precooled EP tube and centrifuged at 15000rpm for 15min at 4 ℃. The supernatant (250. mu.L) was pipetted into a new EP tube, 62.5. mu.L of 5 XSDS loading buffer was added, and the tube was heated in a metal bath at 100 ℃ for 10 min.

3) SDS-PAGE was performed.

The results are shown in FIG. 8.

Anti-flag monoclonal antibodies (purchased from Runtibin) can be found: pVSV-NA1, pVSV-Tetram-NA1 and pVSV-Tetram-NA 1-LC3b all show bands at about 150 KDa; anti-NA 1 monoclonal antibody (purchased from abcam): pVSV-NA1, pVSV-Tetram-NA1, pVSV-NA1-LC3b and pVSV-Tetram-NA 1-LC3b all show bands at about 150 KDa; anti-LC 3b monoclonal antibody (purchased from Sigma): pVSV-NA1-LC3b and pVSV-Teram-NA1-LC3b all showed bands at around 150 kDa.

The above results demonstrate that pVAX-NA1, pVAX-NA1-LC3b, pVAX-Tetram-NA1, pVAX-LC3b and pVAX-Tetram-NA1-LC3b, which were constructed in the above examples, can successfully express their corresponding target genes, and thus can be used as DNA vaccines.

(2) And (3) detecting the immune effect of the animal:

in this example, BALB/c mice were used as immunized animals to test the actual immunization effect of the vaccines, and the mice were purchased from Beijing Wintonlifa laboratory animals technology Co., Ltd, and were bred in the negative pressure laboratory of the animal experiment center of the Yuexiu school of Guangzhou medical university under the conditions of negative pressure barrier environment at constant temperature (18-22 ℃) and constant humidity (50-70%).

Female BALB/c mice 6-8 weeks old were selected, randomized into 8 groups of 10 mice each, and immunized three times in total (first two DNA vaccine immunizations, third VSV vector vaccine immunization).

The specific grouping situation is as follows: VSV-Tetram-NA1-LC3b group (two mice injected with 100uL of DNA vaccine in the hind leg quadriceps muscle of 50 ug/mouse, and 10 injections for the third time ⁶ PFU/VSV-Tetram-NA 1-LC3B recombinant VSV vaccine); LC3b control group (first two mice injected 100uL of pVAX-LC3b DNA vaccine into hind leg quadriceps muscle at 50 ug/mouse, and third injection 10 ⁶ PFU/VSV-eGFP recombinant VSV vaccine); VSV-NA1 group (first two mice injected 100uL of pVAX-NA1 DNA vaccine into hind leg quadriceps muscle, 50 ug/mouse, and third injection 10 ⁶ PFU/VSV-NA 1 recombinant VSV vaccine); VSV-NA1-LC3b group (two previous mice injected with 100uL of pVAX-NA1-LC3b DNA vaccine in the hind leg quadriceps muscle of 50 ug/mouse, and 10 in the third injection ⁶ PFU/VSV- -NA1-LC3b recombinant VSV vaccine); VSV-Tetram-NA1 group (100 uL of pVAX-Tetram-NA1 DNA vaccine injected into hind leg quadriceps muscle of the first two mice, 50 ug/mouse, and 10 injections for the third time ⁶ PFU/VSV-Tetram-NA 1 recombinant VSV vaccine); negative vector control group (the first two mice injected with 100uL of blank pVAX vector (pVAX-empty) DNA vaccine into hind leg quadriceps muscle, 50 ug/mouse, and the third injection of 10 ug ⁶ PFU/VSV-eGFP (VSV-empty) recombinant VSV vaccine); negative PBS control group (three injections of 100uL PBS into quadriceps muscle of hind leg of mouse); positive control group (three immunization 100ul commercial trivalent inactivated influenza vaccine).

The second immunization was performed 14 days after the first immunization, and the third immunization was performed 28 days after the first immunization. On day 49, the mice were challenged with 50. mu.L of a virus diluted with PBS, and the challenged strain was A/California/04/2009(H1N1), and then the mice were observed daily for weight change, survival rate, and the like. During the experiment 5 mice were sacrificed each group (orbital bleeds, corresponding tissues and euthanized mice) at day 21, day 42 and day 91 after the first immunization for relevant immune index testing.

The level of the NA1 antibody induced by immunity is determined by adopting an enzyme-linked immunosorbent assay, and the specific detection method comprises the following steps: inactivated influenza NA protein was coated onto microtiter plates at 1. mu.g/mL and 100. mu.L/well, sealed and coated overnight at 4 ℃. The next day, the well solutions were discarded, and the microplate was washed 3 times, 300. mu.L/well, 3 minutes/time with washing solution (PBST). Adding blocking liquid (containing 5)% of dry powder in PBST), 200. mu.L/well, left at 37 ℃ for 1 hour. The blocking solution was discarded and the microplate was washed 3 times, 300. mu.l/well, 3 minutes/time with washing solution (PBST). The serum samples of the mice to be tested obtained in the above examples were diluted 2-fold in sequence with PBS solution, 100. mu.L of the diluted samples were added to a 96-well plate, PBS alone was added to the negative control wells, murine anti-NA monoclonal antibody (purchased from abcam, 1:5000 dilution) was added to the positive control wells, and the plates were incubated in an incubator at 37 ℃ for 1 hour. After washing, the horseradish peroxidase-labeled goat-anti-mouse secondary antibody is diluted with a sealing solution 1:1000, an enzyme label plate is added into 100 mu L/hole, and the mixture is placed for 1 hour at 37 ℃. The plate was washed as above, and 50. mu.L/well of TMB substrate was added, followed by development in the dark at room temperature for 15 minutes. Adding stop solution (2M H) ₂ SO ₄ ) The color development was stopped at 50. mu.L/well. Absorbance (OD) values per well were measured at a wavelength of 450nm using a microplate reader.

The results are shown in FIG. 9.

By detecting the levels of antibodies specific to H1N1 NA proteins in mouse sera using ELISA, it was found that both the vaccine group and the positive control group induced the production of specific antibodies in mice, as compared to the negative control group (PBS and pVAX/VSV-empty).

The Enzyme Linked immunosorbent Assay (Enzyme Linked Immuno SPOT Assay) detects the number of mouse lymphocytes secreting IFN-Y by NA antigen specificity, and the specific detection method comprises the following steps:

A. isolation of mouse spleen lymphocytes: after the test mice were bled from the eyeballs, the mice were sacrificed by dislocation and soaked in 75% alcohol for several minutes. The mice were placed on a clean bench and the spleen was removed. 5-8mL of mouse lymphocyte separation medium was added to a sterile petri dish, the spleen of a mouse was placed on a 200 mesh sieve, the spleen was gently ground using a syringe plunger, and the ground single cells were dropped through the sieve into the sterile petri dish under the sieve. The cells in the dish were pipetted well into a 15mL centrifuge tube and then 1mL in 1640 medium was added gently along the tube wall. Centrifuging at room temperature for 20-30min at low speed of 800g, taking out the middle white cell layer, adding 1640 culture medium for resuspension, and centrifuging at 400g for 10 min. The supernatant was discarded, resuspended in 1640 medium and centrifuged at 300g for 10 min. The supernatant was discarded, and RPMI complete medium (R10) was added to resuspend the cells (typically 1mL in one mouse), which were then addedThe concentration is adjusted to 3 × 10 ⁶ cell/mL of cell suspension.

Wherein, the preparation method of R10 comprises the following steps: 50mL of inactivated FBS, 0.5mL of 55mM 2-mercaptoethanol, 5mL of 1M HEPES, 5mL of 200mM L-glutamine, 5mL of 100mM pyruvate (GibcoBRL), 5mL of 100 Xqing-streptomycin and 500mL of RPMI medium were mixed to obtain.

B. Enzyme-linked immunosorbent spot detection: an ELISPOT plate was taken and 30 μ L of ethanol dilution (75% ethanol: PBS 1:1, v/v) was added to each well for 30s of activation, the liquid was quickly spun off, and then washed 6 times with 200 μ LPBS (or sterile water). 0.5mg/mL anti-mouse IFN-. gamma.monoclonal antibody (purchased from BD Pharmingen) was diluted to 5. mu.g/mL with sterile PBS (i.e., 100-fold dilution), and then loaded at 50. mu.L/well, coated overnight at 4 ℃ and sealed with a sealing film. The coated antibody was spun off, washed 6 times with sterile PBS, 200. mu. L R10 complete medium was added to each well, and blocked at 37 ℃ for 2-4 h. The blocking solution was discarded, and 100. mu.L of mouse spleen lymphocytes (10) isolated in the above procedure were added to each well ⁵ cell/well). 2 replicates were made for each sample. A positive control (equivalent 10. mu.g/mL concanavalin A, ConA) was set. Specific antigenic peptides (4ug/mL, designed and synthesized using PeptGen software (http:// www.hiv.lanl.gov/content/sequence/PeptGen. html) (purchase:>85%, GeneScript)), negative control wells were added with DMSO at the corresponding concentrations. 37 ℃ and 5% CO ₂ Incubate in incubator for 24 h. The cell suspension was discarded and the plates were washed 6 times with PBST. The wash solution was spun off and dried on sterile dry paper. mu.L/well of biotin-labeled rat anti-mouse IFN-. gamma.secondary antibody (purchased from U-cytech, 100-fold diluted with 5% inactivated FBS/PBST) was added and incubated at 4 ℃ for 16 h. The liquid was discarded, washed 6 times with 200. mu.L/well PBST, the washings were discarded and dried on sterile dry paper. mu.L/well of streptomycin-conjugated alkaline phosphatase (purchased from BD Pharmingen, diluted 1:2500 in PBST with 5% FBS) was added and left at 37 ℃ for 2 h. Washed 5 times with 200. mu.L/well PBST, the washings were decanted and dried on sterile dry paper. BCIP/NBT substrate solution (purchased from Invitrogen, according to kit instructions) was incubated at 37 ℃ for 30 min. 100 mu.L/hole BCIP/NBT substrate solution is added and the reaction is carried out for 10min in the dark. The substrate was discarded and washed 2 times with water (1 min per wash). And reading the plate after air drying.

The results are shown in FIG. 10.

The number of mouse lymphocytes which secrete IFN-Y specifically through NA antigen is detected through Elispot, and the DNA vaccine and the VSV vector vaccine are found to induce strong T cell response. In the DNA vaccine, the pVAX-Tetram-NA1 group was able to induce a stronger cellular immune response than the other vaccine groups. In the VSV vector vaccine group, the VSV-Tetram-NA1-LC3b group can induce stronger cellular immune response compared with other vaccine groups.

Detecting the secretion condition of the cell factor by intracellular cell factor staining (ICS), wherein the specific detection method comprises the following steps:

spleen lymphocytes from mice were isolated as described above, and adjusted to 2X 10 after cell counting ⁶ 200 μ L. An amount of 200. mu.L per well was added to a 96-well cell culture plate. Then, specific antigen peptide was added thereto, a Dimethyl Sulfoxide (DMSO) solution of a corresponding concentration was added to the negative control well, and PMA (40ng/mL) + ionomycin (1000ng/mL) was added to the positive control. 37 ℃ and 5% CO ₂ Culturing for 1-2 h. Add 10. mu.L of diluted brefeldin (BFA, final concentration 10. mu.g/mL) and mix. 37 ℃ and 5% CO ₂ Culturing for 5-6 h. The homogenized cells were blown up and transferred to a flow tube. 1mL of PBS was added. Centrifuge at 300g for 10min at room temperature. The supernatant was discarded. Then add flow surface antibody: anti-mouse anti-CD3, anti-CD4, anti-CD 8. Shaking for 2-3 seconds. And dyeing for 20-30 minutes at room temperature in dark. Adding 1mL PBS, shaking, mixing, and centrifuging at 300g room temperature for 10 min. The washing was repeated once. The cells were homogenized by shaking and then mixed by adding 200. mu.L of cell-permeable membrane lysate cytofix/cytoperm (from BD Biosciences). The reaction was carried out at 4 ℃ for 20 min. 1mL of a membrane-rupturing wash solution (purchased from BD Biosciences, stock solution 10X, diluted with sterile distilled water to 1X before use) was added thereto, 400g was centrifuged for 10min, and the supernatant was discarded. This was repeated once, the supernatant was discarded, and intracellular antibodies (anti-IFN-. gamma., anti-IL 2 and anti-TNF) were added and mixed well. Dyeing at 4 ℃ in dark for 30-60 min. 1mL of membrane-rupturing wash solution 1 Xperm/wash was added and centrifuged at 400g for 10 min. The supernatant was discarded and 1mL of PBS was added. After mixing, 400g of the mixture is centrifuged for 10min at room temperature. The supernatant was discarded and an appropriate amount of PBS was added to each tube. And (5) oscillating and mixing uniformly. Detection on a C6 or BD FACSFortessa flow cytometer, howeverThen analyzed by FlowJo software.

The results are shown in FIGS. 11 and 12.

The secretion of cytokines (TNF, IL-2, IFN. gamma.) was examined in different experimental groups by ICS. The VSV vaccine group was found to induce a more comprehensive cellular immune response and secrete more cytokines than the DNA vaccine group, while the VSV-Tetram-NA1-LC3b group induced a stronger cellular immune response than the other vaccine groups.

Furthermore, ICS detection also shows that the VSV-NA1-LC3b and the VSV-Tetram-NA1 both simultaneously show better effects of inducing stronger CD4+ and CD8+ cellular immune responses besides the VSV-Tetram-NA1-LC3b group, which indicates that the optimized NA1 sequence has substantial effects.

Protective effect of vaccine on challenge mice:

mice survival and weight changes were monitored according to the above groups, statistically analyzed and plotted using GraphPad Prism 5.01, and differences between groups were compared using t-test.

The results are shown in FIGS. 13 and 14.

From fig. 13 and 14, it can be found that the vaccine constructed based on the optimized NA sequence can effectively ensure survival and stable physical signs of the challenge mouse, while other groups have death after challenge in days 6-7, and the body weight imbalance of the challenge mouse is significant, indicating that the challenge mouse has no immune effect.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Zhongshan university

<120> broad-spectrum influenza vaccine based on optimized NA sequence and application thereof

<130>

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence

<400> 1

atgaacccca accagaagat ca 22

<210> 2

<211> 26

<212> DNA

<213> Artificial sequence

<400> 2

cttgtcaatg gtgaatggca gctcag 26

<210> 3

<211> 1407

<212> DNA

<213> Artificial sequence

<400> 3

atgaacccca accagaagat catcaccatt ggctctgtct gcatgaccat tggcatggcc 60

aacctgatcc tgcagattgg caacatcatc tccatctgga tctcccactc catccagctg 120

ggcaaccaga accagattga gacctgcaac cagtctgtga tcacctatga gaacaacacc 180

tgggtgaacc agacctatgt gaacatctcc aacaccaact ttgctgctgg ccagtctgtg 240

gtctctgtga agctggctgg caactcctcc ctgtgccctg tctctggctg ggccatctac 300

tccaaggaca actctgtgag gattggctcc aagggcgatg tctttgtgat cagggagcca 360

ttcatctcct gctcccccct ggagtgcagg accttcttcc tgacccaggg cgccctgctg 420

aatgacaagc actccaatgg caccatcaag gacaggtccc catacaggac cctgatgtcc 480

tgccccattg gcgaggtgcc atccccatac aactccaggt ttgagtctgt ggcctggtct 540

gcctctgcct gccatgatgg catcaactgg ctgaccattg gcatctccgg ccctgacaat 600

ggcgctgtgg ctgtgctgaa gtacaatggc atcatcacag acaccatcaa gtcctggagg 660

aacaacatcc tgaggaccca ggagtctgag tgtgcctgtg tgaatggctc ctgcttcaca 720

gtgatgacag atggcccatc caatggccag gcctcctaca agatcttcag gattgagaag 780

ggcaagattg tgaagtctgt ggagatgaat gcccccaact accactatga ggagtgctcc 840

tgctaccctg actcctctga gatcacctgt gtctgcaggg acaactggca tggctccaac 900

aggccatggg tctccttcaa ccagaacctg gagtaccaga ttggctacat ctgctctggc 960

atctttggcg acaaccccag gcccaatgac aagacaggct cctgtggccc tgtctcctcc 1020

aatggcgcca atggcgtgaa gggcttctcc ttcaagtatg gcaatggcgt ctggattggc 1080

aggaccaagt ccatctcctc caggaatggc tttgagatga tctgggaccc caatggctgg 1140

acaggcacag acaacaactt ctccatcaag caggacattg tgggcatcaa tgagtggtct 1200

ggctactctg gctcctttgt gcagcatcct gagctgacag gcctggactg catcaggccc 1260

tgcttctggg tggagctgat caggggcagg cccaaggaga acaccatctg gacctctggc 1320

tcctccatct ccttctgtgg cgtgaactct gacacagtgg gctggtcctg gcctgatggc 1380

gctgagctgc cattcaccat tgacaag 1407

<210> 4

<211> 375

<212> DNA

<213> Artificial sequence

<400> 4

atgccgtccg agaagacctt caagcagcgc cggagctttg aacaaagagt ggaagatgtc 60

cggctcatcc gggagcagca ccccaccaag atcccagtga ttatagagcg atacaagggg 120

gagaagcagc tgcccgtcct ggacaagacc aagttcctgg tgcctgacca cgtgaacatg 180

agcgagctca tcaagataat cagacggcgc ttgcagctca atgctaacca agccttcttc 240

ctcctggtga atgggcacag catggtgagt gtgtccactc ccatctccga agtgtacgag 300

agtgagagag atgaagacgg cttcctgtac atggtttatg cctcgcagga gacattcggg 360

acagcaatgg ctgtg 375

<210> 5

<211> 159

<212> DNA

<213> Artificial sequence

<400> 5

tcctcctctg actactctga cctgcagagg gtgaagcagg agctgctgga ggaggtgaag 60

aaggagctgc agaaggtgaa ggaggagatc attgaggcct ttgtgcagga gctgaggaag 120

aggggctccc tggtgcccag gggctcccca tccaggtcc 159

<210> 6

<211> 4909

<212> DNA

<213> Artificial sequence

<400> 6

gactcttcgc gatgtacggg ccagatatac gcgttgacat tgattattga ctagttatta 60

atagtaatca attacggggt cattagttca tagcccatat atggagttcc gcgttacata 120

acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat 180

aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc aatgggtgga 240

ctatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc caagtacgcc 300

ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt acatgacctt 360

atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat 420

gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg gatttccaag 480

tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac gggactttcc 540

aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg tacggtggga 600

ggtctatata agcagagctc tctggctaac tagagaaccc actgcttact ggcttatcga 660

aattaatacg actcactata gggagaccca agctggctag cgtttaaact taagcttacc 720

atggactaca aggacgacga cgacaagtcc tcctctgact actctgacct gcagagggtg 780

aagcaggagc tgctggagga ggtgaagaag gagctgcaga aggtgaagga ggagatcatt 840

gaggcctttg tgcaggagct gaggaagagg ggctccctgg tgcccagggg ctccccatcc 900

aggtccatga accccaacca gaagatcatc accattggct ctgtctgcat gaccattggc 960

atggccaacc tgatcctgca gattggcaac atcatctcca tctggatctc ccactccatc 1020

cagctgggca accagaacca gattgagacc tgcaaccagt ctgtgatcac ctatgagaac 1080

aacacctggg tgaaccagac ctatgtgaac atctccaaca ccaactttgc tgctggccag 1140

tctgtggtct ctgtgaagct ggctggcaac tcctccctgt gccctgtctc tggctgggcc 1200

atctactcca aggacaactc tgtgaggatt ggctccaagg gcgatgtctt tgtgatcagg 1260

gagccattca tctcctgctc ccccctggag tgcaggacct tcttcctgac ccagggcgcc 1320

ctgctgaatg acaagcactc caatggcacc atcaaggaca ggtccccata caggaccctg 1380

atgtcctgcc ccattggcga ggtgccatcc ccatacaact ccaggtttga gtctgtggcc 1440

tggtctgcct ctgcctgcca tgatggcatc aactggctga ccattggcat ctccggccct 1500

gacaatggcg ctgtggctgt gctgaagtac aatggcatca tcacagacac catcaagtcc 1560

tggaggaaca acatcctgag gacccaggag tctgagtgtg cctgtgtgaa tggctcctgc 1620

ttcacagtga tgacagatgg cccatccaat ggccaggcct cctacaagat cttcaggatt 1680

gagaagggca agattgtgaa gtctgtggag atgaatgccc ccaactacca ctatgaggag 1740

tgctcctgct accctgactc ctctgagatc acctgtgtct gcagggacaa ctggcatggc 1800

tccaacaggc catgggtctc cttcaaccag aacctggagt accagattgg ctacatctgc 1860

tctggcatct ttggcgacaa ccccaggccc aatgacaaga caggctcctg tggccctgtc 1920

tcctccaatg gcgccaatgg cgtgaagggc ttctccttca agtatggcaa tggcgtctgg 1980

attggcagga ccaagtccat ctcctccagg aatggctttg agatgatctg ggaccccaat 2040

ggctggacag gcacagacaa caacttctcc atcaagcagg acattgtggg catcaatgag 2100

tggtctggct actctggctc ctttgtgcag catcctgagc tgacaggcct ggactgcatc 2160

aggccctgct tctgggtgga gctgatcagg ggcaggccca aggagaacac catctggacc 2220

tctggctcct ccatctcctt ctgtggcgtg aactctgaca cagtgggctg gtcctggcct 2280

gatggcgctg agctgccatt caccattgac aaggtcgaca ccatgccgtc cgagaagacc 2340

ttcaagcagc gccggagctt tgaacaaaga gtggaagatg tccggctcat ccgggagcag 2400

caccccacca agatcccagt gattatagag cgatacaagg gggagaagca gctgcccgtc 2460

ctggacaaga ccaagttcct ggtgcctgac cacgtgaaca tgagcgagct catcaagata 2520

atcagacggc gcttgcagct caatgctaac caagccttct tcctcctggt gaatgggcac 2580

agcatggtga gtgtgtccac tcccatctcc gaagtgtacg agagtgagag agatgaagac 2640

ggcttcctgt acatggttta tgcctcgcag gagacattcg ggacagcaat ggctgtgtaa 2700

atctagaggg cccgtttaaa cccgctgatc agcctcgact gtgccttcta gttgccagcc 2760

atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt 2820

cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct 2880

ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc 2940

tggggatgcg gtgggctcta tggcttctac tgggcggttt tatggacagc aagcgaaccg 3000

gaattgccag ctggggcgcc ctctggtaag gttgggaagc cctgcaaagt aaactggatg 3060

gctttctcgc cgccaaggat ctgatggcgc aggggatcaa gctctgatca agagacagga 3120

tgaggatcgt ttcgcatgat tgaacaagat ggattgcacg caggttctcc ggccgcttgg 3180

gtggagaggc tattcggcta tgactgggca caacagacaa tcggctgctc tgatgccgcc 3240

gtgttccggc tgtcagcgca ggggcgcccg gttctttttg tcaagaccga cctgtccggt 3300

gccctgaatg aactgcaaga cgaggcagcg cggctatcgt ggctggccac gacgggcgtt 3360

ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa gggactggct gctattgggc 3420

gaagtgccgg ggcaggatct cctgtcatct caccttgctc ctgccgagaa agtatccatc 3480

atggctgatg caatgcggcg gctgcatacg cttgatccgg ctacctgccc attcgaccac 3540

caagcgaaac atcgcatcga gcgagcacgt actcggatgg aagccggtct tgtcgatcag 3600

gatgatctgg acgaagagca tcaggggctc gcgccagccg aactgttcgc caggctcaag 3660

gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg gcgatgcctg cttgccgaat 3720

atcatggtgg aaaatggccg cttttctgga ttcatcgact gtggccggct gggtgtggcg 3780

gaccgctatc aggacatagc gttggctacc cgtgatattg ctgaagagct tggcggcgaa 3840

tgggctgacc gcttcctcgt gctttacggt atcgccgctc ccgattcgca gcgcatcgcc 3900

ttctatcgcc ttcttgacga gttcttctga attattaacg cttacaattt cctgatgcgg 3960

tattttctcc ttacgcatct gtgcggtatt tcacaccgca tacaggtggc acttttcggg 4020

gaaatgtgcg cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc 4080

tcatgagaca ataaccctga taaatgcttc aataatagca cgtgctaaaa cttcattttt 4140

aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 4200

gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 4260

atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 4320

tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 4380

gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 4440

actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 4500

gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 4560

agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 4620

ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 4680

aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 4740

cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 4800

gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 4860

cctttttacg gttcctgggc ttttgctggc cttttgctca catgttctt 4909

<210> 7

<211> 14711

<212> DNA

<213> Artificial sequence

<400> 7

tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg 60

cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt 120

gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca 180

atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc 240

aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta 300

catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac 360

catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg 420

atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg 480

ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt 540

acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatct aatacgactc 600

actataggac gaagacaaac aaaccattat tatcattaaa aggctcagga gaaactttaa 660

cagtaatcaa aatgtctgtt acagtcaaga gaatcattga caacacagtc atagttccaa 720

aacttcctgc aaatgaggat ccagtggaat acccggcaga ttacttcaga aaatcaaagg 780

agattcctct ttacatcaat actacaaaaa gtttgtcaga tctaagagga tatgtctacc 840

aaggcctcaa atccggaaat gtatcaatca tacatgtcaa cagctacttg tatggagcat 900

taaaggacat ccggggtaag ttggataaag attggtcaag tttcggaata aacatcggga 960

aagcagggga tacaatcgga atatttgacc ttgtatcctt gaaagccctg gacggcgtac 1020

ttccagatgg agtatcggat gcttccagaa ccagcgcaga tgacaaatgg ttgcctttgt 1080

atctacttgg cttatacaga gtgggcagaa cacaaatgcc tgaatacaga aaaaagctca 1140

tggatgggct gacaaatcaa tgcaaaatga tcaatgaaca gtttgaacct cttgtgccag 1200

aaggtcgtga catttttgat gtgtggggaa atgacagtaa ttacacaaaa attgtcgctg 1260

cagtggacat gttcttccac atgttcaaaa aacatgaatg tgcctcgttc agatacggaa 1320

ctattgtttc cagattcaaa gattgtgctg cattggcaac atttggacac ctctgcaaaa 1380

taaccggaat gtctacagaa gatgtaacga cctggatctt gaaccgagaa gttgcagatg 1440

aaatggtcca aatgatgctt ccaggccaag aaattgacaa ggccgattca tacatgcctt 1500

atttgatcga ctttggattg tcttctaagt ctccatattc ttccgtcaaa aaccctgcct 1560

tccacttctg ggggcaattg acagctcttc tgctcagatc caccagagca aggaatgccc 1620

gacagcctga tgacattgag tatacatctc ttactacagc aggtttgttg tacgcttatg 1680

cagtaggatc ctctgccgac ttggcacaac agttttgtgt tggagataac aaatacactc 1740

cagatgatag taccggagga ttgacgacta atgcaccgcc acaaggcaga gatgtggtcg 1800

aatggctcgg atggtttgaa gatcaaaaca gaaaaccgac tcctgatatg atgcagtatg 1860

cgaaaagagc agtcatgtca ctgcaaggcc taagagagaa gacaattggc aagtatgcta 1920

agtcagaatt tgacaaatga ccctataatt ctcagatcac ctattatata ttatgctaca 1980

tatgaaaaaa actaacagat atcatggata atctcacaaa agttcgtgag tatctcaagt 2040

cctactctcg tctagatcag gcggtaggag agatagatga gatcgaagca caacgagctg 2100

aaaagtccaa ttatgagttg ttccaagagg acggagtgga agagcatact aggccctctt 2160

attttcaggc agcagatgat tctgacacag aatctgaacc agaaattgaa gacaatcaag 2220

gcttgtatgt accagatccg gaagctgagc aagttgaagg ctttatacag gggcctttag 2280

atgactatgc agatgaggac gtggatgttg tattcacttc ggactggaaa cagcctgagc 2340

ttgaatccga cgagcatgga aagaccttac ggttgacatt gccagagggt ttaagtggag 2400

agcagaaatc ccagtggctt ttgacgatta aagcagtcgt tcaaagtgcc aaacactgga 2460

atctggcaga gtgcacattt gaagcatcgg gagaaggggt catcataaaa aagcgccaga 2520

taactccgga tgtatataag gtcactccag tgatgaacac acatccgtac caatcagaag 2580

ccgtatcaga tgtttggtct ctctcaaaga catccatgac tttccaaccc aagaaagcaa 2640

gtcttcagcc tctcaccata tccttggatg aattgttctc atctagagga gaattcatct 2700

ctgtcggagg taacggacga atgtctcata aagaggccat cctgctcggt ctgaggtaca 2760

aaaagttgta caatcaggcg agagtcaaat attctctgta gactatgaaa aaaagtaaca 2820

gatatcacaa tctaagtgtt atcccaatcc attcatcatg agttccttaa agaagattct 2880

cggtctgaag gggaaaggta agaaatctaa gaaattaggg atcgcaccac ccccttatga 2940

agaggacact agcatggagt atgctccgag cgctccaatt gacaaatcct attttggagt 3000

tgacgagatg gacacctatg atccgaatca attaagatat gagaaattct tctttacagt 3060

gaaaatgacg gttagatcta atcgtccgtt cagaacatac tcagatgtgg cagccgctgt 3120

atcccattgg gatcacatgt acatcggaat ggcagggaaa cgtcccttct acaaaatctt 3180

ggcttttttg ggttcttcta atctaaaggc cactccagcg gtattggcag atcaaggtca 3240

accagagtat cacgctcact gcgaaggcag ggcttatttg ccacatagga tggggaagac 3300

ccctcccatg ctcaatgtac cagagcactt cagaagacca ttcaatatag gtctttacaa 3360

gggaacgatt gagctcacaa tgaccatcta cgatgatgag tcactggaag cagctcctat 3420

gatctgggat catttcaatt cttccaaatt ttctgatttc agagagaagg ccttaatgtt 3480

tggcctgatt gtcgagaaaa aggcatctgg agcgtgggtc ctggattcta tcagccactt 3540

caaatgagct agtctagctt ccagcttctg aacaatcccc ggtttactca gtctctccta 3600

attccagcct ttcgaacaac taatatcctg tcttttctat ccctatgaaa aaaactaaca 3660

gagatcgatc tgtttccttg acacccaagt ttgtacaaaa aagcaggctg ccaccatgga 3720

ctacaaggac gacgacgaca agtcctcctc tgactactct gacctgcaga gggtgaagca 3780

ggagctgctg gaggaggtga agaaggagct gcagaaggtg aaggaggaga tcattgaggc 3840

ctttgtgcag gagctgagga agaggggctc cctggtgccc aggggctccc catccaggtc 3900

catgaacccc aaccagaaga tcatcaccat tggctctgtc tgcatgacca ttggcatggc 3960

caacctgatc ctgcagattg gcaacatcat ctccatctgg atctcccact ccatccagct 4020

gggcaaccag aaccagattg agacctgcaa ccagtctgtg atcacctatg agaacaacac 4080

ctgggtgaac cagacctatg tgaacatctc caacaccaac tttgctgctg gccagtctgt 4140

ggtctctgtg aagctggctg gcaactcctc cctgtgccct gtctctggct gggccatcta 4200

ctccaaggac aactctgtga ggattggctc caagggcgat gtctttgtga tcagggagcc 4260

attcatctcc tgctcccccc tggagtgcag gaccttcttc ctgacccagg gcgccctgct 4320

gaatgacaag cactccaatg gcaccatcaa ggacaggtcc ccatacagga ccctgatgtc 4380

ctgccccatt ggcgaggtgc catccccata caactccagg tttgagtctg tggcctggtc 4440

tgcctctgcc tgccatgatg gcatcaactg gctgaccatt ggcatctccg gccctgacaa 4500

tggcgctgtg gctgtgctga agtacaatgg catcatcaca gacaccatca agtcctggag 4560

gaacaacatc ctgaggaccc aggagtctga gtgtgcctgt gtgaatggct cctgcttcac 4620

agtgatgaca gatggcccat ccaatggcca ggcctcctac aagatcttca ggattgagaa 4680

gggcaagatt gtgaagtctg tggagatgaa tgcccccaac taccactatg aggagtgctc 4740

ctgctaccct gactcctctg agatcacctg tgtctgcagg gacaactggc atggctccaa 4800

caggccatgg gtctccttca accagaacct ggagtaccag attggctaca tctgctctgg 4860

catctttggc gacaacccca ggcccaatga caagacaggc tcctgtggcc ctgtctcctc 4920

caatggcgcc aatggcgtga agggcttctc cttcaagtat ggcaatggcg tctggattgg 4980

caggaccaag tccatctcct ccaggaatgg ctttgagatg atctgggacc ccaatggctg 5040

gacaggcaca gacaacaact tctccatcaa gcaggacatt gtgggcatca atgagtggtc 5100

tggctactct ggctcctttg tgcagcatcc tgagctgaca ggcctggact gcatcaggcc 5160

ctgcttctgg gtggagctga tcaggggcag gcccaaggag aacaccatct ggacctctgg 5220

ctcctccatc tccttctgtg gcgtgaactc tgacacagtg ggctggtcct ggcctgatgg 5280

cgctgagctg ccattcacca ttgacaaggt cgacaccatg ccgtccgaga agaccttcaa 5340

gcagcgccgg agctttgaac aaagagtgga agatgtccgg ctcatccggg agcagcaccc 5400

caccaagatc ccagtgatta tagagcgata caagggggag aagcagctgc ccgtcctgga 5460

caagaccaag ttcctggtgc ctgaccacgt gaacatgagc gagctcatca agataatcag 5520

acggcgcttg cagctcaatg ctaaccaagc cttcttcctc ctggtgaatg ggcacagcat 5580

ggtgagtgtg tccactccca tctccgaagt gtacgagagt gagagagatg aagacggctt 5640

cctgtacatg gtttatgcct cgcaggagac attcgggaca gcaatggctg tgtaaaccca 5700

gctttcttgt acaaagtggc tcaaatcctg cacaacagat tcttcatgtt tgaaccaaat 5760

caacttgtga tatcatgctc aaagaggcct taattatatt ttaattttta atttttatga 5820

aaaaaactaa cagcaatcat ggaagtccac gattttgaga ccgacgagtt caatgatttc 5880

aatgaagatg actatgccac aagagaattc ctgaatcccg atgagcgcat gacgtacttg 5940

aatcatgctg attacaattt gaattctcct ctaattagtg atgatattga caatttgatc 6000

aggaaattca attctcttcc gattccctcg atgtgggata gtaagaactg ggatggagtt 6060

cttgagatgt taacatcatg tcaagccaat cccatctcaa catctcagat gcataaatgg 6120

atgggaagtt ggttaatgtc tgataatcat gatgccagtc aagggtatag ttttttacat 6180

gaagtggaca aagaggcaga aataacattt gacgtggtgg agaccttcat ccgcggctgg 6240

ggcaacaaac caattgaata catcaaaaag gaaagatgga ctgactcatt caaaattctc 6300

gcttatttgt gtcaaaagtt tttggactta cacaagttga cattaatctt aaatgctgtc 6360

tctgaggtgg aattgctcaa cttggcgagg actttcaaag gcaaagtcag aagaagttct 6420

catggaacga acatatgcag gattagggtt cccagcttgg gtcctacttt tatttcagaa 6480

ggatgggctt acttcaagaa acttgatatt ctaatggacc gaaactttct gttaatggtc 6540

aaagatgtga ttatagggag gatgcaaacg gtgctatcca tggtatgtag aatagacaac 6600

ctgttctcag agcaagacat cttctccctt ctaaatatct acagaattgg agataaaatt 6660

gtggagaggc agggaaattt ttcttatgac ttgattaaaa tggtggaacc gatatgcaac 6720

ttgaagctga tgaaattagc aagagaatca aggcctttag tcccacaatt ccctcatttt 6780

gaaaatcata tcaagacttc tgttgatgaa ggggcaaaaa ttgaccgagg tataagattc 6840

ctccatgatc agataatgag tgtgaaaaca gtggatctca cactggtgat ttatggatcg 6900

ttcagacatt ggggtcatcc ttttatagat tattacactg gactagaaaa attacattcc 6960

caagtaacca tgaagaaaga tattgatgtg tcatatgcaa aagcacttgc aagtgattta 7020

gctcggattg ttctatttca acagttcaat gatcataaaa agtggttcgt gaatggagac 7080

ttgctccctc atgatcatcc ctttaaaagt catgttaaag aaaatacatg gcccacagct 7140

gctcaagttc aagattttgg agataaatgg catgaacttc cgctgattaa atgttttgaa 7200

atacccgact tactagaccc atcgataata tactctgaca aaagtcattc aatgaatagg 7260

tcagaggtgt tgaaacatgt ccgaatgaat ccgaacactc ctatccctag taaaaaggtg 7320

ttgcagacta tgttggacac aaaggctacc aattggaaag aatttcttaa agagattgat 7380

gagaagggct tagatgatga tgatctaatt attggtctta aaggaaagga gagggaactg 7440

aagttggcag gtagattttt ctccctaatg tcttggaaat tgcgagaata ctttgtaatt 7500

accgaatatt tgataaagac tcatttcgtc cctatgttta aaggcctgac aatggcggac 7560

gatctaactg cagtcattaa aaagatgtta gattcctcat ccggccaagg attgaagtca 7620

tatgaggcaa tttgcatagc caatcacatt gattacgaaa aatggaataa ccaccaaagg 7680

aagttatcaa acggcccagt gttccgagtt atgggccagt tcttaggtta tccatcctta 7740

atcgagagaa ctcatgaatt ttttgagaaa agtcttatat actacaatgg aagaccagac 7800

ttgatgcgtg ttcacaacaa cacactgatc aattcaacct cccaacgagt ttgttggcaa 7860

ggacaagagg gtggactgga aggtctacgg caaaaaggat ggagtatcct caatctactg 7920

gttattcaaa gagaggctaa aatcagaaac actgctgtca aagtcttggc acaaggtgat 7980

aatcaagtta tttgcacaca gtataaaacg aagaaatcga gaaacgttgt agaattacag 8040

ggtgctctca atcaaatggt ttctaataat gagaaaatta tgactgcaat caaaataggg 8100

acagggaagt taggactttt gataaatgac gatgagacta tgcaatctgc agattacttg 8160

aattatggaa aaataccgat tttccgtgga gtgattagag ggttagagac caagagatgg 8220

tcacgagtga cttgtgtcac caatgaccaa atacccactt gtgctaatat aatgagctca 8280

gtttccacaa atgctctcac cgtagctcat tttgctgaga acccaatcaa tgccatgata 8340

cagtacaatt attttgggac atttgctaga ctcttgttga tgatgcatga tcctgctctt 8400

cgtcaatcat tgtatgaagt tcaagataag ataccgggct tgcacagttc tactttcaaa 8460

tacgccatgt tgtatttgga cccttccatt ggaggagtgt cgggcatgtc tttgtccagg 8520

tttttgatta gagccttccc agatcccgta acagaaagtc tctcattctg gagattcatc 8580

catgtacatg ctcgaagtga gcatctgaag gagatgagtg cagtatttgg aaaccccgag 8640

atagccaagt ttcgaataac tcacatagac aagctagtag aagatccaac ctctctgaac 8700

atcgctatgg gaatgagtcc agcgaacttg ttaaagactg aggttaaaaa atgcttaatc 8760

gaatcaagac aaaccatcag gaaccaggtg attaaggatg caaccatata tttgtatcat 8820

gaagaggatc ggctcagaag tttcttatgg tcaataaatc ctctgttccc tagattttta 8880

agtgaattca aatcaggcac ttttttggga gtcgcagacg ggctcatcag tctatttcaa 8940

aattctcgta ctattcggaa ctcctttaag aaaaagtatc atagggaatt ggatgatttg 9000

attgtgagga gtgaggtatc ctctttgaca catttaggga aacttcattt gagaagggga 9060

tcatgtaaaa tgtggacatg ttcagctact catgctgaca cattaagata caaatcctgg 9120

ggccgtacag ttattgggac aactgtaccc catccattag aaatgttggg tccacaacat 9180

cgaaaagaga ctccttgtgc accatgtaac acatcagggt tcaattatgt ttctgtgcat 9240

tgtccagacg ggatccatga cgtctttagt tcacggggac cattgcctgc ttatctaggg 9300

tctaaaacat ctgaatctac atctattttg cagccttggg aaagggaaag caaagtccca 9360

ctgattaaaa gagctacacg tcttagagat gctatctctt ggtttgttga acccgactct 9420

aaactagcaa tgactatact ttctaacatc cactctttaa caggcgaaga atggaccaaa 9480

aggcagcatg ggttcaaaag aacagggtct gcccttcata ggttttcgac atctcggatg 9540

agccatggtg ggttcgcatc tcagagcact gcagcattga ccaggttgat ggcaactaca 9600

gacaccatga gggatctggg agatcagaat ttcgactttt tattccaagc aacgttgctc 9660

tatgctcaaa ttaccaccac tgttgcaaga gacggatgga tcaccagttg tacagatcat 9720

tatcatattg cctgtaagtc ctgtttgaga cccatagaag agatcaccct ggactcaagt 9780

atggactaca cgcccccaga tgtatcccat gtgctgaaga catggaggaa tggggaaggt 9840

tcgtggggac aagagataaa acagatctat cctttagaag ggaattggaa gaatttagca 9900

cctgctgagc aatcctatca agtcggcaga tgtataggtt ttctatatgg agacttggcg 9960

tatagaaaat ctactcatgc cgaggacagt tctctatttc ctctatctat acaaggtcgt 10020

attagaggtc gaggtttctt aaaagggttg ctagacggat taatgagagc aagttgctgc 10080

caagtaatac accggagaag tctggctcat ttgaagaggc cggccaacgc agtgtacgga 10140

ggtttgattt acttgattga taaattgagt gtatcacctc cattcctttc tcttactaga 10200

tcaggaccta ttagagacga attagaaacg attccccaca agatcccaac ctcctatccg 10260

acaagcaacc gtgatatggg ggtgattgtc agaaattact tcaaatacca atgccgtcta 10320

attgaaaagg gaaaatacag atcacattat tcacaattat ggttattctc agatgtctta 10380

tccatagact tcattggacc attctctatt tccaccaccc tcttgcaaat cctatacaag 10440

ccatttttat ctgggaaaga taagaatgag ttgagagagc tggcaaatct ttcttcattg 10500

ctaagatcag gagaggggtg ggaagacata catgtgaaat tcttcaccaa ggacatatta 10560

ttgtgtccag aggaaatcag acatgcttgc aagttcggga ttgctaagga taataataaa 10620

gacatgagct atcccccttg gggaagggaa tccagaggga caattacaac aatccctgtt 10680

tattatacga ccacccctta cccaaagatg ctagagatgc ctccaagaat ccaaaatccc 10740

ctgctgtccg gaatcaggtt gggccaatta ccaactggcg ctcattataa aattcggagt 10800

atattacatg gaatgggaat ccattacagg gacttcttga gttgtggaga cggctccgga 10860

gggatgactg ctgcattact acgagaaaat gtgcatagca gaggaatatt caatagtctg 10920

ttagaattat cagggtcagt catgcgaggc gcctctcctg agccccccag tgccctagaa 10980

actttaggag gagataaatc gagatgtgta aatggtgaaa catgttggga atatccatct 11040

gacttatgtg acccaaggac ttgggactat ttcctccgac tcaaagcagg cttggggctt 11100

caaattgatt taattgtaat ggatatggaa gttcgggatt cttctactag cctgaaaatt 11160

gagacgaatg ttagaaatta tgtgcaccgg attttggatg agcaaggagt tttaatctac 11220

aagacttatg gaacatatat ttgtgagagc gaaaagaatg cagtaacaat ccttggtccc 11280

atgttcaaga cggtcgactt agttcaaaca gaatttagta gttctcaaac gtctgaagta 11340

tatatggtat gtaaaggttt gaagaaatta atcgatgaac ccaatcccga ttggtcttcc 11400

atcaatgaat cctggaaaaa cctgtacgca ttccagtcat cagaacagga atttgccaga 11460

gcaaagaagg ttagtacata ctttaccttg acaggtattc cctcccaatt cattcctgat 11520

ccttttgtaa acattgagac tatgctacaa atattcggag tacccacggg tgtgtctcat 11580

gcggctgcct taaaatcatc tgatagacct gcagatttat tgaccattag ccttttttat 11640

atggcgatta tatcgtatta taacatcaat catatcagag taggaccgat acctccgaac 11700

cccccatcag atggaattgc acaaaatgtg gggatcgcta taactggtat aagcttttgg 11760

ctgagtttga tggagaaaga cattccacta tatcaacagt gtttggcagt tatccagcaa 11820

tcatttccga ttaggtggga ggctatttca gtaaaaggag gatacaagca gaagtggagt 11880

actagaggtg atgggctccc aaaagatacc cgaatttcag actccttggc cccaatcggg 11940

aactggatca gatctttgga attggtccga aaccaagttc gtctaaatcc attcaataag 12000

atcttgttca atcagctatg tcgtacagtg gataatcatt tgaagtggtc aaatttgcga 12060

aaaaacacag gaatgattga atggatcaat gggcgaattt caaaagaaga ccggtctata 12120

ctgatgttga agagtgacct acatgaggaa aactcttgga gagattaaaa aatcaggagg 12180

agactccaaa ctttaagtat gaaaaaaact ttgatcctta agaccctctt gtggttttta 12240

ttttttatct ggttttgtgg tcttcgtggg tcggcatggc atctccacct cctcgcggtc 12300

cgacctgggc atccgaagga ggacgcacgt ccactcggat ggctaaggga gagccctagc 12360

ataacccctt ggggcctcta aacgggtctt gaggggtttt ttgctgaaag gaggaactat 12420

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 12480

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 12540

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 12600

gggaagagaa tagcaggcat gctggggagg tgtcgctacc ttaggaccgt tatagttatt 12660

ctcgtcgacg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 12720

ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 12780

gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag 12840

gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca caaaaatcga 12900

cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct 12960

ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata cctgtccgcc 13020

tttctctctt cgggaagcgt ggcgctttct catagctcac gctgtaggta tctcagttcg 13080

gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca gcccgaccgc 13140

tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga cttatcgcca 13200

ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg tgctacagag 13260

ttcttgaagt ggtggcctaa ctacggctac actagaagaa cagtatttgg tatctgcgct 13320

ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg caaacaaacc 13380

accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga 13440

tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa cgaaaactca 13500

cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat ccttttaaat 13560

taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc tgacagttac 13620

caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc atccatagtt 13680

gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc tggccccagt 13740

gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc aataaaccag 13800

ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc catccagtct 13860

attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt gcgcaacgtt 13920

gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc 13980

tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt 14040

agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg 14100

gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg cttttctgtg 14160

actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc gagttgctct 14220

tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa agtgctcatc 14280

attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt gagatccagt 14340

tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt caccagcgtt 14400

tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag ggcgacacgg 14460

aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta tcagggttat 14520

tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat aggggttccg 14580

cgcacatttc cccgaaaagt gccacctgac gtctaagaaa ccattattat catgacatta 14640

acctataaaa ataggcgtat cacgaggccc tttcgtcgcg gccgcttctt agggataaca 14700

gggtaatgtg t 14711

<210> 8

<211> 1795

<212> DNA

<213> Artificial sequence

<400> 8

atgaacccca accagaagat catcaccatt ggctctgtct gcatgaccat tggcatggcc 60

aacctgatcc tgcagattgg caacatcatc tccatctgga tctcccactc catccagctg 120

ggcaaccaga accagattga gacctgcaac cagtctgtga tcacctatga gaacaacacc 180

tgggtgaacc agacctatgt gaacatctcc aacaccaact ttgctgctgg ccagtctgtg 240

gtctctgtga agctggctgg caactcctcc ctgtgccctg tctctggctg ggccatctac 300

tccaaggaca actctgtgag gattggctcc aagggcgatg tctttgtgat cagggagcca 360

ttcatctcct gctcccccct ggagtgcagg accttcttcc tgacccaggg cgccctgctg 420

aatgacaagc actccaatgg caccatcaag gacaggtccc catacaggac cctgatgtcc 480

tgccccattg gcgaggtgcc atccccatac aactccaggt ttgagtctgt ggcctggtct 540

gcctctgcct gccatgatgg catcaactgg ctgaccattg gcatctccgg ccctgacaat 600

ggcgctgtgg ctgtgctgaa gtacaatggc atcatcacag acaccatcaa gtcctggagg 660

aacaacatcc tgaggaccca ggagtctgag tgtgcctgtg tgaatggctc ctgcttcaca 720

gtgatgacag atggcccatc caatggccag gcctcctaca agatcttcag gattgagaag 780

ggcaagattg tgaagtctgt ggagatgaat gcccccaact accactatga ggagtgctcc 840

tgctaccctg actcctctga gatcacctgt gtctgcaggg acaactggca tggctccaac 900

aggccatggg tctccttcaa ccagaacctg gagtaccaga ttggctacat ctgctctggc 960

atctttggcg acaaccccag gcccaatgac aagacaggct cctgtggccc tgtctcctcc 1020

aatggcgcca atggcgtgaa gggcttctcc ttcaagtatg gcaatggcgt ctggattggc 1080

aggaccaagt ccatctcctc caggaatggc tttgagatga tctgggaccc caatggctgg 1140

acaggcacag acaacaactt ctccatcaag caggacattg tgggcatcaa tgagtggtct 1200

ggctactctg gctcctttgt gcagcatcct gagctgacag gcctggactg catcaggccc 1260

tgcttctggg tggagctgat caggggcagg cccaaggaga acaccatctg gacctctggc 1320

tcctccatct ccttctgtgg cgtgaactct gacacagtgg gctggtcctg gcctgatggc 1380

gctgagctgc cattcaccat tgacaaggtc gacaccatgc cgtccgagaa gaccttcaag 1440

cagcgccgga gctttgaaca aagagtggaa gatgtccggc tcatccggga gcagcacccc 1500

accaagatcc cagtgattat agagcgatac aagggggaga agcagctgcc cgtcctggac 1560

aagaccaagt tcctggtgcc tgaccacgtg aacatgagcg agctcatcaa gataatcaga 1620

cggcgcttgc agctcaatgc taaccaagcc ttcttcctcc tggtgaatgg gcacagcatg 1680

gtgagtgtgt ccactcccat ctccgaagtg tacgagagtg agagagatga agacggcttc 1740

ctgtacatgg tttatgcctc gcaggagaca ttcgggacag caatggctgt gtaaa 1795

<210> 9

<211> 1576

<212> DNA

<213> Artificial sequence

<400> 9

tcctcctctg actactctga cctgcagagg gtgaagcagg agctgctgga ggaggtgaag 60

aaggagctgc agaaggtgaa ggaggagatc attgaggcct ttgtgcagga gctgaggaag 120

aggggctccc tggtgcccag gggctcccca tccaggtcca tgaaccccaa ccagaagatc 180

atcaccattg gctctgtctg catgaccatt ggcatggcca acctgatcct gcagattggc 240

aacatcatct ccatctggat ctcccactcc atccagctgg gcaaccagaa ccagattgag 300

acctgcaacc agtctgtgat cacctatgag aacaacacct gggtgaacca gacctatgtg 360

aacatctcca acaccaactt tgctgctggc cagtctgtgg tctctgtgaa gctggctggc 420

aactcctccc tgtgccctgt ctctggctgg gccatctact ccaaggacaa ctctgtgagg 480

attggctcca agggcgatgt ctttgtgatc agggagccat tcatctcctg ctcccccctg 540

gagtgcagga ccttcttcct gacccagggc gccctgctga atgacaagca ctccaatggc 600

accatcaagg acaggtcccc atacaggacc ctgatgtcct gccccattgg cgaggtgcca 660

tccccataca actccaggtt tgagtctgtg gcctggtctg cctctgcctg ccatgatggc 720

atcaactggc tgaccattgg catctccggc cctgacaatg gcgctgtggc tgtgctgaag 780

tacaatggca tcatcacaga caccatcaag tcctggagga acaacatcct gaggacccag 840

gagtctgagt gtgcctgtgt gaatggctcc tgcttcacag tgatgacaga tggcccatcc 900

aatggccagg cctcctacaa gatcttcagg attgagaagg gcaagattgt gaagtctgtg 960

gagatgaatg cccccaacta ccactatgag gagtgctcct gctaccctga ctcctctgag 1020

atcacctgtg tctgcaggga caactggcat ggctccaaca ggccatgggt ctccttcaac 1080

cagaacctgg agtaccagat tggctacatc tgctctggca tctttggcga caaccccagg 1140

cccaatgaca agacaggctc ctgtggccct gtctcctcca atggcgccaa tggcgtgaag 1200

ggcttctcct tcaagtatgg caatggcgtc tggattggca ggaccaagtc catctcctcc 1260

aggaatggct ttgagatgat ctgggacccc aatggctgga caggcacaga caacaacttc 1320

tccatcaagc aggacattgt gggcatcaat gagtggtctg gctactctgg ctcctttgtg 1380

cagcatcctg agctgacagg cctggactgc atcaggccct gcttctgggt ggagctgatc 1440

aggggcaggc ccaaggagaa caccatctgg acctctggct cctccatctc cttctgtggc 1500

gtgaactctg acacagtggg ctggtcctgg cctgatggcg ctgagctgcc attcaccatt 1560

gacaagtaaa tctaga 1576

Claims

1. An optimized nucleic acid molecule for influenza virus neuraminidase, wherein the nucleotide sequence of the optimized nucleic acid molecule is:

(1) as shown in SEQ ID NO: 3; or

2. A product comprising the optimized nucleic acid molecule of claim 1, wherein the product comprises:

(1) an expression cassette comprising the optimized nucleic acid molecule of claim 1; or

(2) A recombinant vector comprising the optimized nucleic acid molecule of claim 1 or the expression cassette of (1); or

(3) A recombinant microorganism comprising the optimized nucleic acid molecule of claim 1 or the expression cassette of (1) or the recombinant vector of (2).

3. A set of nucleic acid molecule combinations comprising the optimized nucleic acid molecule of claim 1 and a tetramerization domain sequence.

4. The combination of nucleic acid molecules of claim 3, further comprising an LC3b gene sequence.

5. The combination of nucleic acid molecules of claim 3, wherein the nucleotide sequence of the tetramerization domain sequence is set forth in SEQ ID NO: 5, respectively.

6. The nucleic acid molecule combination of claim 4, wherein the nucleotide sequence of the LC3b gene sequence is as set forth in SEQ ID NO:

4, respectively.

7. A product comprising a combination of nucleic acid molecules according to claim 3 or 4, wherein said product comprises:

(1) an expression cassette comprising the combination of nucleic acid molecules of claim 3; or

(2) An expression cassette comprising the combination of nucleic acid molecules of claim 4; or

(3) A recombinant vector comprising the nucleic acid molecule combination of claim 3 or the expression cassette of (1); or

(4) A recombinant vector comprising the combination of nucleic acid molecules of claim 4 or the expression cassette of (2); or

(5) A recombinant microorganism comprising the nucleic acid molecule combination of claim 3 or the expression cassette of (1) or the recombinant vector of (3); or

(6) A recombinant microorganism comprising the combination of nucleic acid molecules of claim 4 or the expression cassette of (2) or the recombinant vector of (4).

8. The product of claim 7, wherein the recombinant microorganism comprises a recombinant vesicular stomatitis virus vector.

9. Use of a product as claimed in claim 2 or any one of claims 7 to 8 in the manufacture of a product for the prophylaxis, treatment or co-treatment of influenza;

the product comprises vaccine, antibody and medicine.

10. Use of a product according to claim 2 or any one of claims 7 to 8 in the manufacture of a product for detecting influenza virus;

the product comprises a detection reagent and a detection kit.