CN114854729A

CN114854729A - Directional chemical coupling asparaginase mutant and preparation method and application thereof

Info

Publication number: CN114854729A
Application number: CN202110148829.6A
Authority: CN
Inventors: 范开; 唐光辉; 何云凤; 张琦; 刘日勇; 文海燕; 聂堂伟; 丁琼; 朱云祯; 吴其谦
Original assignee: Peg Bio Biopharm Co ltd Chongqing
Current assignee: Peg Bio Biopharm Co ltd Chongqing
Priority date: 2021-02-03
Filing date: 2021-02-03
Publication date: 2022-08-05

Abstract

The invention relates to the field of biotechnology and pharmacy, in particular to a directional chemical coupling asparaginase mutant and a preparation method and application thereof. The invention provides an asparaginase mutant conjugate or pharmaceutically acceptable salt thereof, wherein at least one amino acid on the surface of asparaginase is mutated into lysine, and the newly formed lysine is subjected to directed chemical coupling after mutation to form a novel asparaginase mutant conjugate; the novel asparaginase mutant conjugate has lower immunogenicity and longer half-life in vivo. The invention also provides a pharmaceutical composition containing the mutant chemical conjugate, a product and application of the mutant chemical conjugate and the product in treating acute lymphocytic leukemia, Hodgkin lymphoma, chronic leukemia, lymphosarcoma cells and hepatocellular carcinoma.

Description

Directional chemical coupling asparaginase mutant and preparation method and application thereof

Technical Field

The invention relates to the field of biotechnology and pharmacy, in particular to a directional chemical coupling asparaginase mutant and a preparation method and application thereof.

Background

Asparaginase is a protein capable of catalyzing the hydrolysis of L-asparagine to aspartic acid and ammonia and is present in a variety of organisms, such as bacteria, actinomycetes, fungi, yeasts, algae, plants, etc. (Verma, clinical Reviews in Biotechnology 27.1(2007):45-62), of which asparaginase from escherichia coli and erwinia has been successfully used for many years for the treatment of childhood Acute Lymphoblastic Leukemia (ALL).

In recent years, asparaginase has also been used in the treatment of hodgkin's disease (Godgkin disease), acute myeloid leukemia (acute myelocytic leukemia), acute myelomonocytic leukemia (acute myelomonocytic leukemia), chronic lymphocytic leukemia (chronic lymphocytic leukemia), lymphosarcoma (lymphosarcoma), reticulosarcoma (reticulum cell sarcoma), pancreatic cancer (pancreatic cancer), melanoma (melaoma), etc. (arch, 3Biotech 8.6(2018):278), which are believed to be unable to synthesize the amino acid asparagine essential for growth, must be supplied by the host, and it hydrolyzes the asparagine, rendering the tumor cells deficient in asparagine, thereby acting to inhibit growth. Normal human cells contain asparagine synthetase, can synthesize asparagine by itself, and are less affected.

Escherichia coli-derived asparaginase (e.coli ASNase) was approved by the U.S. Food and Drug Administration (FDA) for the treatment of Acute Lymphoblastic Leukemia (ALL) in children in 1978, and for more than 40 years, asparaginase and a combination chemotherapy regimen containing asparaginase have achieved good results in the treatment of acute lymphoblastic leukemia; however, the gene is derived from exogenous organisms and has stronger immunogenicity, the enzyme antibody positive rate in a patient body in the clinical use process reaches 45% -75%, adverse reactions such as clinically common progressive immune reaction, systemic anaphylactic reaction and the like occur, in addition, the half-life period of escherichia coli-derived asparaginase molecules with natural structures in a human body is only 1.24 +/-0.17 days, the Drug administration frequency of patients is high, and the characteristics limit the clinical use of the asparaginase (Asselin, Drug resistance in leucomia and lymphoma III. Springer, Boston, MA, 1999.621-629).

In response to these problems, researchers have mainly divided the modification of asparaginase into the following aspects: screening new source asparaginase. In recent years, asparaginases derived from various microorganisms have been widely studied, such as Erwinia chrysanthemi (Erwinia chrysogenmi), Erwinia carotovora (Erwinia chrysogenmi), Bacillus solani (Bacillus mesentericus), Marine Actinomycetes (Marine actinomycetes), Aspergillus niger (Aspergillus niger), Saccharomyces cerevisiae (Saccharomyces cerevisiae), and the like. In 2011, Erwinia chrysogenum (Erwinia chrysanthemi) derived asparaginase (Erwinaze) was marketed in the us as a second-line drug approved by the FDA for the treatment of ALL patients with hypersensitivity to e.coli ASNase, as it did not cross-react with the antibodies produced in the patients by e.coli derived asparaginase (Keating, BioDrugs 27.4(2013): 413-418.). ② nano-encapsulation technology, such as encapsulating asparaginase in liposome or erythrocyte. Erytech Pharma, a French biopharmaceutical company, extends the in vivo half-life of drugs for the treatment of acute lymphoblastic leukemia and pancreatic cancer by encapsulating E.coli ASNase into erythrocytes (GRASPA), which are currently in three-phase clinical trials (Thomas, NCT0151851(2015): 2492-. And thirdly, the genetic engineering modification of the asparaginase with the structure modified through genetic engineering mainly relates to enzyme activity, glutamine hydrolysis capacity, immunogenicity, stability and protease hydrolysis resistance, and no related product enters clinical tests so far. The research of Marc N.Offman et al (Offman, Blood 117.5(2011):1614-1621) finds that the mutations of N24A and R195S can improve the proteolytic cleavage resistance of E.coli-ASP and simultaneously improve the activity of the E.coli-ASP. Mehta R.K et al (Mehta, Journal of Biological Chemistry 289.6(2014):3555-3570) mutated K288S and Y176F in the asparaginase sequence, significantly reducing the immunogenicity and glutamine hydrolysis capacity of E.coli-ASP. The combination of genetic engineering and other asparaginase modification techniques may further promote the development process of asparaginase drugs. The chemical modification compounds used for drug modification comprise polyethylene glycol, polypeptide and derivatives thereof, fatty acid, carbohydrate compounds and the like, wherein the polyethylene glycol modification technology is usually used for prolonging the clinical half-life period of the drug and improving the immunogenicity of the drug, and two pegylated asparaginase drugs (Oncapar and Aspalas) are sold on the market abroad. In patent US10174302B1, asparaginase is covalently coupled with polypeptides consisting of repeating amino acids (proline and alanine) and derivatives thereof to improve the immunogenicity and in vivo half-life of the asparaginase.

Polyethylene glycol (PEG) is a straight-chain or branched polyether, and is polymerized from ethylene oxide, and is widely used for modifying protein drugs due to its excellent characteristics of hydrophilicity, biocompatibility, biological inertness, and the like, and can effectively reduce the immunogenicity of protein drugs and prolong the half-life in vivo. Clinical studies of pegylated drugs (pegylated drugs) have shown that clinical side effects seen with many drugs are related to the immune response elicited by PEG in humans. In the clinical study of Palynziq, 93% of patients develop adverse events of hypersensitivity reactions (HAEs) at the early treatment stage, when patients have high levels of anti-protein and anti-PEG antibodies in their bodies, and the development of anaphylaxis may be associated with circulating immune complexes formed by these antibodies in vivo (Gupta, EBioMedicine 37(2018): 366-. In the clinical study of pegloticase, anti-PEG antibodies were produced in 32% of patients, 78% of whom produced both anti-PEG IgG and IgM, 20% of whom produced only IgM antibodies, and 2% of whom produced only IgG antibodies, which were shown to be associated with drug clearance in vivo (Ganson, Arthritis research & therapy,2005,8(1): R12). Mima et al demonstrated that anti-PEG IgM is a major cause of clearance of PEGylated drugs in the body in 2015 by using PEGylated egg albumin as a study model for PEGylated protein drugs (Mima, Molecular pharmaceuticals, 2015,12(7): 2429-2435). Armstrong et al reported that 32% of pediatric patients with acute lymphoblastic leukemia who received pegylated asparaginase (Oncasar) developed anti-PEG specific antibodies by serological testing and 46% of pediatric patients developed anti-PEG specific antibodies by flow cytometry, the anti-PEG antibody type being primarily IgM, associated with rapid clearance of subsequently injected drugs (Artromng, Cancer,2007,110(1): 103-. In another study, 3/4 patients developed allergic reactions after receiving PEGylated asparaginase and all of these patients produced anti-PEG IgG antibodies (Rau, Pediatric blood & cancer,2018,65(3): e 26873).

The generation of an immune response against pegylated drugs in vivo is related to the immunogenicity of the carrier protein, the size of the PEG, the branching of the PEG, and the degree of pegylation of the carrier protein. Xue Wan et al studied the influencing factors of pegylated proteins to generate immune responses in vivo by coupling different types of polyethylene glycols with tetanus toxoid TT, bovine serum albumin BSA, chicken ovalbumin OVA as model proteins, and showed that the degree of pegylation helped to attenuate the immune responses of the body to PEG and proteins (Wan X, Process Biochemistry,2017,52: 183-191).

For years, the polyethylene glycol modification technology is successfully applied in the research and development of asparaginase from escherichia coli. The earliest pegylated asparaginase drugs (Oncapars) were approved by the FDA for marketing in 1994, and approved as first-line therapy for ALL in children and adults since 2006 (Dinndorf, Oncoloist 12.8(2007): 991). Oncapar randomly modifies lysine and N-terminal amino group in asparaginase by polyethylene glycol succinimidyl succinate (SS-PEG), the half-life of the drug in human body is 5.73 +/-3.24 days, and the administration frequency of the drug can reach once a week or once every two weeks under the existing clinical administration dosage, but because of the unstable ester bond in the structure of the drug, polyethylene glycol is easy to drop in the blood of the human body, the in vivo stability is poor, and the protein and the succinic acid terminal remained on the protein are easy to cause immune response and systemic anaphylactic response after PEG is dropped, so that the clinical effect is limited (Asselin, Springer, Boston, MA,1999: 621-629; Heo, Drugs,2019,79(7): 767-777; Wurthwein, European pharmaceutical of metabolic and biochemical, 2017,42(6): 955-963). The Calaspagase PEG listed in the market in 2019 adopts polyethylene glycol succinimidyl carbonate (SC-PEG) to replace SS-PEG to modify asparaginase, so that the stability of the medicine is improved to a certain extent, the half life can reach 13.4 +/-1.4 days, and the administration frequency of once every three weeks is basically realized clinically (Angiolillo, Journal of Clinical Oncology of the American Society of Clinical 32.34(2014): 3874-82). Calaspragase peg and Oncapar are polyethylene glycol saturation modified drugs, i.e., one asparaginase protein molecule is covalently coupled with 7-9 polyethylene glycols, so that the immunogenic region on the asparaginase surface is shielded as much as possible, and the half-life of the drug is prolonged. However, clinical studies found that these two marketed drugs still produced some degree of anti-drug antibodies in humans, indicating that conjugated PEG may not completely cover the immune epitopes on the asparaginase surface. In 2016, Schore, Reuven J et al reported that 166 newly diagnosed patients with acute lymphoblastic leukemia developed antibodies against asparaginase in 3.6% (Calaspargase pegol Group) and 10.0% (Onccaspar Group) and PEG in 13% (Calaspargase pegol Group) and 19.2% (Onccaspar Group), respectively, during the course of Calaspargase pegol and Oncpar treatment (Schore, Children's Oncology Group (AAG) study LL07P4(2016)), which accelerated clearance of the drugs in vivo.

Researchers have used bioinformatics software and bioanalytical means to study and identify potential immunodominant regions of asparaginase, and reduced immunogenicity by amino acid mutations within these regions, but single or multiple amino acid mutations often do not significantly improve protein immunogenicity because immunodominant regions often involve large numbers of amino acids and protein structural conformations (Bellen, Biologicals 59(2019): 47-55; U.S. Pat. No.: US20120148559A 1).

Therefore, there is a need to develop a compound that reduces immunogenicity in vivo and can prolong half-life.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, one purpose of the invention is to provide an asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof, at least one amino acid on the surface of asparaginase is mutated into lysine, and the newly formed lysine is subjected to directed chemical coupling after mutation to form a novel asparaginase mutant conjugate; the novel asparaginase mutant conjugate has lower immunogenicity and longer half-life in vivo. The invention also provides a pharmaceutical composition containing the mutant chemical conjugate, a product and application of the mutant chemical conjugate and the product in treating acute lymphocytic leukemia, Hodgkin lymphoma, chronic leukemia, lymphosarcoma cells and hepatocellular carcinoma.

To this end, in one aspect, the present invention provides an asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof. According to an embodiment of the present invention, the asparaginase mutant conjugate comprises an asparaginase mutant and a group chemically conjugated thereto which reduces the immunogenicity in vivo and increases the half-life in vivo,

the asparaginase mutant is a mutant in which at least one site of amino acid in the non-mutated asparaginase is mutated into lysine, and the group capable of reducing in vivo immunogenicity and prolonging in vivo half-life is chemically coupled with the asparaginase mutant through the lysine in the asparaginase mutant.

The inventor utilizes a bioinformatics tool to selectively mutate at least one amino acid accessible on the surface of a protein into lysine in an immunodominant region far away from the active center of asparaginase, and simultaneously ensures that the modified asparaginase at least keeps more than 85% of the activity of the enzyme before modification. The asparaginase mutant conjugate still keeps the activity of catalyzing and hydrolyzing the asparagine while reducing the immunogenicity in vivo and prolonging the half-life, and the enzyme activity is not less than 50 percent of that before modification. The asparaginase mutant conjugate can continuously reduce asparagine in vivo and maintain the level of asparagine in serum to be lower than 2 mu mol/L for more than 21 days.

According to an embodiment of the present invention, the asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof has one of the following additional technical features:

according to an embodiment of the invention, the non-mutated asparaginase is derived from Erwinia or E.coli.

According to an embodiment of the invention, the amino acid sequence of the non-mutated asparaginase has at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO. 1.

According to an embodiment of the invention, the non-mutated asparaginase has an activity of hydrolysing asparagine, can be derived from escherichia coli or erwinia, but is not limited to escherichia coli and erwinia, can be extracted from natural strains or expressed recombinantly, and in a particular embodiment of the invention the pre-asparaginase is engineered to have at least about 80% sequence identity with a protein comprising the sequence of SEQ ID NO o 1, more particularly at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 100% sequence identity with a protein comprising SEQ ID No.: l.

Fragments of the protein of SEQ ID no o 1 are also included in the definition of protein used in the conjugates of the invention. By "fragment of a protein of SEQ ID NO: l" is meant that the sequence of the polypeptide may comprise fewer amino acids than SEQ ID NO: l.

SEQ ID NO 1 the sequence is as follows:

LPNITILATGGTIAGGGDSATKSNYTAGKVGVENLVNAVPQLKDIANVKGEQVVNIGSQDMNDDVWLTLAKKINTDCDKTDGFVITHGTDTMEETAYFLDLTVKCDKPVVMVGAMRPSTSMSADGPFNLYNAVVTAADKASANRGVLVVMNDTVLDGRDVTKTNTTDVATFKSVNYGPLGYIHNGKIDYQRTPARKHTSDTPFDVSKLNELPKVGIVYNYANASDLPAKALVDAGYDGIVSAGVGNGNLYKTVFDTLATAAKNGTAVVRSSRVPTGATTQDAEVDDAKYGFVASGTLNPQKARVLLQLALTQTKDPQQIQQIFNQY

the "multiple amino acids accessible on the surface of asparaginase" refers to solvent-accessible amino acids in a tetrameric model of asparaginase as assessed by bioinformatics tools. The asparaginase tetramer model can be derived from an existing database (e.g., Protein Data Bank) published model or a Protein model can be constructed by homology modeling. The solubility refers to the accessible area of amino acid solvent calculated by one or more bioinformatics tools is greater than or equal to

According to an embodiment of the invention, the asparaginase mutant has at least 80% sequence identity with the amino acid sequence of the non-mutated asparaginase, the asparaginase mutant having at least 85% retention of enzyme activity compared to the non-mutated asparaginase.

According to an embodiment of the present invention, the positions at which the amino acid mutations occur in the asparaginase mutant include at least 1 of N37K, D64K, N143K, D233K, T252K, Q317K.

According to the embodiment of the invention, the positions of the amino acid mutation in the asparaginase mutant comprise D64K, N143K, D233K and Q317K, and the amino acid sequence of the asparaginase mutant is shown as SEQ ID NO. 2.

The SEQ ID NO 2 sequence is as follows:

LPNITILATGGTIAGGGDSATKSNYTAGKVGVENLVNAVPQLKDIANVKGEQVVNIGSQDMNDKVWLTLAKKINTDCDKTDGFVITHGTDTMEETAYFLDLTVKCDKPVVMVGAMRPSTSMSADGPFNLYNAVVTAADKASAKRGVLVVMNDTVLDGRDVTKTNTTDVATFKSVNYGPLGYIHNGKIDYQRTPARKHTSDTPFDVSKLNELPKVGIVYNYANASDLPAKALVKAGYDGIVSAGVGNGNLYKTVFDTLATAAKNGTAVVRSSRVPTGATTQDAEVDDAKYGFVASGTLNPQKARVLLQLALTQTKDPKQIQQIFNQY

according to the embodiment of the invention, the positions of the amino acid mutation in the asparaginase mutant comprise D64K, D233K and Q317K, and the amino acid sequence of the asparaginase mutant is shown as SEQ ID NO. 3.

SEQ ID NO 3 the sequence is as follows:

LPNITILATGGTIAGGGDSATKSNYTAGKVGVENLVNAVPQLKDIANVKGEQVVNIGSQDMNDKVWLTLAKKINTDCDKTDGFVITHGTDTMEETAYFLDLTVKCDKPVVMVGAMRPSTSMSADGPFNLYNAVVTAADKASANRGVLVVMNDTVLDGRDVTKTNTTDVATFKSVNYGPLGYIHNGKIDYQRTPARKHTSDTPFDVSKLNELPKVGIVYNYANASDLPAKALVKAGYDGIVSAGVGNGNLYKTVFDTLATAAKNGTAVVRSSRVPTGATTQDAEVDDAKYGFVASGTLNPQKARVLLQLALTQTKDPKQIQQIFNQY

according to an embodiment of the present invention, the group capable of reducing in vivo immunogenicity and increasing in vivo half-life is directionally coupled through amide bond formation with an amino group of lysine in the asparaginase mutant, and the group is methoxypolyethylene glycol having an activating group.

According to an embodiment of the invention, the activating group is selected from the group consisting of succinimide carbonate, succinimide propionate, succinimide acetate, succinimide succinate.

According to an embodiment of the invention, the polyethylene glycol has a molecular weight of 2kDa to 20kDa, preferably 5 kDa.

According to the embodiment of the invention, the directional coupling rate of the group in the mutant asparaginase through the newly formed lysine by mutation is not less than 50%.

According to the embodiment of the invention, the number of the groups coupled in the asparaginase mutant conjugate is A + 75% N, wherein A and N are integers, and A is more than or equal to 30 and less than or equal to 40; n is the number of lysine increase in the asparaginase mutant compared to the non-mutated asparaginase.

Lysine-directed coupling of the groups in the asparaginase mutants may be heterogeneous, and therefore the asparaginase mutant conjugates are essentially mixtures, and the number of groups coupled in the asparaginase mutant conjugates may or may not be an integer.

According to some embodiments of the invention, the non-mutated asparaginase is an asparaginase derived from Escherichia coli having the sequence SEQ ID NO; the mutation sites of the asparaginase mutant include, but are not limited to, any combination of N37K, D64K, N143K, D233K, T252K, Q317K; more specifically, the mutant comprises D64K, N143K, D233K and Q317K mutant points, and the amino acid sequence is shown as SEQ ID NO. 2; more particularly, the mutant comprises D64K, D233K and Q317K mutant points, and the amino acid sequence is shown as SEQ ID NO. 3. Here N37K refers to the mutation of asparagine at position 37 in the sequence SEQ ID NO. 1 to lysine, D64K refers to the mutation of aspartic acid at position 64 in the sequence SEQ ID NO. 1 to lysine, N143K refers to the mutation of asparagine at position 143 in the sequence SEQ ID NO. 1 to lysine, D233K refers to the mutation of aspartic acid at position 233 in the sequence SEQ ID NO. 1 to lysine, T252K refers to the mutation of threonine at position 252 in the sequence SEQ ID NO. 1 to lysine, Q317K refers to the mutation of glutamine at position 317 in the sequence SEQ ID NO. 1 to lysine.

It is also within the scope of this patent to mutate amino acids to lysine at the same positions in the asparaginase sequence by sequence alignment (e.g., Blast sequence alignment).

A polypeptide can be engineered by substitution, insertion, deletion and/or addition of one or more amino acids while retaining its enzymatic activity. For example, it is common to replace an amino acid at a given position with a chemically equivalent amino acid without affecting the functional properties of the protein.

The mutant conjugate is formed by forming an amido bond between a compound and an amino group of lysine in the mutant asparaginase, wherein the compound comprises but is not limited to polyethylene glycol.

The polyethylene glycol molecule may be any molecule having a molecular weight of 2kDa to 20kDa, preferably 5kDa, depending on the degree of polymerization.

Polyethylene glycol forms an amide bond by chemical reaction of its activating group with the amino group of lysine in the asparaginase mutant, the activating group of polyethylene glycol includes but is not limited to succinimide carbonate, succinimide propionate, succinimide acetate, succinimide succinate, and in preferred embodiments, the activating group of polyethylene glycol is succinimide carbonate and succinimide propionate.

In a second aspect, the invention provides a method for preparing the asparaginase mutant conjugate or the pharmaceutically acceptable salt thereof. According to an embodiment of the invention, the method comprises mixing the asparaginase mutant with polyethylene glycol in a buffer to perform a coupling reaction, so as to obtain the asparaginase mutant conjugate.

By utilizing the method, the prepared asparaginase mutant conjugate or the pharmaceutically acceptable salt thereof can reduce the in vivo immunogenicity and prolong the half life, and meanwhile, the asparaginase mutant conjugate still keeps the activity of catalyzing and hydrolyzing the asparagine, and the enzyme activity is not less than 50% of that before modification. The asparaginase mutant conjugate can continuously reduce asparagine in vivo and maintain the level of asparagine in serum to be lower than 2 mu mol/L for more than 21 days.

According to an embodiment of the invention, the preparation method further has one of the following additional technical features:

according to the embodiment of the invention, when the coupling reaction occurs, the pH value of the buffer solution is 7.5-10.5.

According to an embodiment of the invention, the coupling reaction takes place for a time of 1 to 2 hours.

According to the embodiment of the invention, the ionic strength of the buffer solution is 10-200 mmol/L.

According to an embodiment of the invention, the buffer is selected from at least one of phosphate, carbonate, borate.

According to the embodiment of the invention, the weight ratio of the asparaginase mutant to the polyethylene glycol is not less than 1: 5. .

According to an embodiment of the present invention, the asparaginase mutant is a mutant in which at least one amino acid in the site of the non-mutated asparaginase is mutated to lysine.

According to an embodiment of the invention, the polyethylene glycol has a molecular weight of 2kDa to 20 kDa.

According to an embodiment of the present invention, the polyethylene glycol is selected from at least one of succinimidyl carbonate polyethylene glycol (SC-PEG), succinimidyl propionate polyethylene glycol (SPA-PEG), succinimidyl acetate polyethylene glycol (SCM-PEG), succinimidyl succinate polyethylene glycol (SS-PEG).

In a third aspect, the invention provides a pharmaceutical composition. According to an embodiment of the present invention, the pharmaceutical composition comprises the asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to the first aspect or the asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof prepared by the preparation method according to the second aspect.

The fourth aspect of the invention provides the use of the asparaginase mutant conjugate or the pharmaceutically acceptable salt thereof described in the first aspect or the asparaginase mutant conjugate or the pharmaceutically acceptable salt thereof prepared by the preparation method described in the second aspect in the preparation of a medicament for killing tumors.

According to an embodiment of the present invention, the tumor killing drug includes a drug that inhibits and kills a tumor by consuming asparagine in serum.

According to an embodiment of the invention, the tumor is selected from acute lymphocytic leukemia, melanoma cells, hodgkin's lymphoma, chronic leukemia, lymphosarcoma cells, hepatocellular carcinoma.

The asparaginase mutant conjugate can continuously reduce asparagine in vivo and maintain the level of asparagine in serum to be lower than 2 mu mol/L for more than 21 days. The asparaginase mutant conjugates can be used alone or in combination in drugs that inhibit and kill tumors by depleting asparagine in the serum. Such tumors include, but are not limited to, acute lymphocytic leukemia, hodgkin's lymphoma, chronic leukemia, lymphosarcoma cells, hepatocellular carcinoma, and the like.

The asparaginase mutant conjugate is used as a medicament for treating tumors, and the combined medicament can be selected from anti-tumor medicaments and medicaments for treating and/or preventing complications caused by or related to tumors, and examples of the medicaments include: vincristine, cyclophosphamide, cytarabine, daunorubicin, etoposide, steroids (prednisone or dexamethasone), thioguanine, mercaptopurine, and the like.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 shows the in vivo inhibitory effect of A0, M0, and M4 on tumor cells;

FIG. 2 shows the drug concentration in the serum of rats after a single intravenous administration of M0 and M4;

FIG. 3 shows drug concentrations in rat serum after multiple intravenous administrations of M0 and M4;

FIG. 4 shows the effect of anti-asparaginase antibodies on the pharmacokinetics of pemetrase (Henry) and M4 in rats;

FIG. 5 shows the effect of anti-polyethylene glycol antibodies on the pharmacokinetics of pemetrexed (Henry) and M4 in rats.

Detailed Description

Definition of terms:

the asparaginase mutant is prepared by mutating at least one amino acid accessible to the asparaginase surface into lysine by means of genetic engineering.

The terms "mutation", "alteration" and "mutation" are used interchangeably herein.

As used herein, the terms "compound", "modifier", "moiety", and the like are used interchangeably and refer to polymers, such as polyethylene glycol, and the like, used for drug modification of proteins and polypeptides.

It is well known that common polyethylene glycols have a hydroxyl group at each end, and methoxy polyethylene glycol (mPEG) is obtained if one end is blocked with a methyl group. The activated polyethylene glycol refers to a polyethylene glycol derivative with a functional group (or an activating group), and is mainly used for protein and polypeptide drug modification at present.

The polyethylene glycol used for modifying or chemically coupling the asparaginase mutant is methoxy polyethylene glycol with an activating group. Activating groups for polyethylene glycol include, but are not limited to, succinimide carbonate, succinimide propionate, succinimide acetate, succinimide succinate. In a particular embodiment, the polyethylene glycol is 5K-SC-PEG and 5K-SPA-PEG, wherein 5K-SC-PEG refers to methoxy polyethylene glycol-succinimide carbonate with a molecular weight of 5KDa and 5K-SPA-PEG refers to methoxy polyethylene glycol-succinimide propionate with a molecular weight of 5 KDa.

As used herein, the terms "modification", "coupling", "chemical coupling", "covalent coupling" are used interchangeably and refer to the covalent attachment of a compound by chemical reaction with asparaginase and mutants thereof under certain conditions.

The terms "asparaginase mutant conjugate" and "asparaginase mutant chemical conjugate" used in the invention are used interchangeably and are modified products obtained by modifying asparaginase multi-subunit proteins with polyethylene glycol; the modification product of polyethylene glycol-modified asparaginase may be referred to herein as "SC-PEG-ASP, SPA-PEG-ASP," collectively as PEG-ASP or asparaginase pegylated conjugates. "ASP" is a shorthand for asparaginase.

According to the invention, the asparaginase and the mutant thereof are tetrameric proteins, and the number of covalent coupling groups is the total number of the tetrameric protein coupling groups.

The average modification degree of the asparaginase mutant conjugate refers to the number of asparaginase mutant conjugate compounds, and the number of asparaginase and mutant covalent coupling groups thereof can be determined by a person skilled in the art through conventional technical means, for example, in example 3, the average modification degree of the pegylated asparaginase is determined by utilizing different UV and RI absorption characteristics of protein and polyethylene glycol.

The "coupling ratio of not less than 50%" in the present invention means that the number of newly formed lysines directionally coupled by the compound after mutation is not less than 50% of the total number of newly formed lysines. It will be understood by those skilled in the art that the skilled in the art can determine whether a specific amino acid site is modified by a compound molecule by conventional techniques, for example, non-pegylated and pegylated asparaginases are cleaved with one or more enzymes, the cleaved fragments are separated and determined by a liquid chromatography-mass spectrometry (LC-MS) method, a chromatogram, i.e. a peptide map, of the non-pegylated and pegylated asparaginases is generated, the peptide maps of the asparaginases before and after the modification with polyethylene glycol are compared, and the relative proportion of the peak of the peptide fragment where the specific amino acid site is located in the pegylated asparaginase is determined, in the present invention, if the proportion of the peptide fragment which is cleaved is reduced or disappeared is more than 80%, the specific amino acid site on the peptide fragment is determined to be modified by the compound.

According to some specific embodiments of the present invention, the method for preparing the asparaginase mutant conjugate comprises:

in phosphate or carbonate buffer, the buffer ionic strength is 10-200 mmol/L, the modification pH range is 7.5-10.5, the concentration of the asparaginase mutant is 2-20mg/ml, sufficient 5K-SC-PEG and/or 5K-SPA-PEG is added, stirring reaction is carried out for 1-2h at room temperature, free PEG in the reaction solution is removed through ultrafiltration by an ultrafiltration column, and the asparaginase mutant conjugate is obtained.

The following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention.

The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1: recombinant expression and preparation of asparaginase and mutants thereof

(1) The nucleic acid sequences SEQ ID NO. 4, 5 and 6 are used for constructing expression vector plasmids (the SEQ ID NO. 4 codes the amino acid shown in SEQ ID NO. 1, the SEQ ID NO. 5 codes the amino acid shown in SEQ ID NO. 2 and the SEQ ID NO. 6 codes the amino acid shown in SEQ ID NO. 3), the constructed correct expression plasmids are transformed into escherichia coli expression host bacteria, recombinant expression strains are obtained by screening, the recombinant strains are inoculated into YT culture solution, fermentation culture is carried out after IPTG induction, the fermentation broth is centrifuged, and the bacteria are collected and stored at the temperature of minus 20 ℃ for later use.

(2) After the fermented thalli are cracked, asparaginase is separated and concentrated by utilizing a series of purification chromatographic columns and methods, in short, the asparaginase is adsorbed on an ion exchange resin chromatographic column, eluted by different salt concentrations, an eluted sample is collected, the eluted sample is further purified by a Phenyl column, a salt solution with different concentrations is eluted, a sample containing the asparaginase is collected, and finally, the sample is refined and purified by using molecular exclusion chromatography. The purity of the asparaginase preparation evaluated by SDS-PAGE is more than 98%, and the recombinase amino acid sequence is verified to be complete by LC-MS.

SEQ ID NO 4 the sequence is as follows:

atggagttctttaagaaaaccgcgctggcggcgctggtgatgggtttcagcggtgcggcgctggcgctgccgaacatcaccattctggcgaccggtggcaccattgcgggtggcggtgacagcgcgaccaagagcaactacaccgcgggtaaagtgggcgttgagaacctggtgaacgcggttccgcagctgaaggatatcgcgaacgtgaaaggtgaacaggtggttaacattggcagccaagacatgaacgacgatgtttggctgaccctggcgaagaaaatcaacaccgactgcgataaaaccgacggtttcgtgattacccacggcaccgataccatggaggaaaccgcgtactttctggacctgaccgtgaagtgcgataaaccggtggttatggttggtgcgatgcgtccgagcaccagcatgagcgcggatggtccgttcaacctgtataacgcggtggttaccgcggcggataaggcgagcgcgaaccgtggtgttctggtggttatgaacgacaccgtgctggacggccgtgatgttaccaagaccaacaccaccgatgtggcgaccttcaaaagcgttaactacggtccgctgggctatatccacaacggcaagattgactatcagcgtaccccggcgcgtaaacacaccagcgacaccccgtttgatgtgagcaagctgaacgagctgccgaaagtgggtatcgtttacaactatgcgaacgcgagcgatctgccggcgaaagcgctggttgacgcgggttacgatggcattgtgagcgcgggcgttggtaacggcaacctgtataagaccgtgtttgataccctggcgaccgcggcgaaaaacggtaccgcggtggttcgtagcagccgtgttccgaccggtgcgaccacccaggacgcggaagtggacgatgcgaagtacggtttcgttgcgagcggcaccctgaacccgcaaaaagcgcgtgttctgctgcagctggcgctgacccaaaccaaggacccgcagcaaatccagcaaatttttaaccaatattaa

SEQ ID NO 5 the sequence is as follows:

atggagttctttaagaaaaccgcgctggcggcgctggtgatgggtttcagcggtgcggcgctggcgctgccgaacatcaccattctggcgaccggtggcaccattgcgggtggcggtgacagcgcgaccaagagcaactacaccgcgggtaaagtgggcgttgagaacctggtgaacgcggttccgcagctgaaggatatcgcgaacgtgaaaggtgaacaggtggttaacattggcagccaagacatgaacgacaaggtttggctgaccctggcgaagaaaatcaacaccgactgcgataaaaccgacggtttcgtgattacccacggcaccgataccatggaggaaaccgcgtactttctggacctgaccgtgaagtgcgataaaccggtggttatggttggtgcgatgcgtccgagcaccagcatgagcgcggatggtccgttcaacctgtataacgcggtggttaccgcggcggataaggcgagcgcgaaacgtggtgttctggtggttatgaacgacaccgtgctggacggccgtgatgttaccaagaccaacaccaccgatgtggcgaccttcaaaagcgttaactacggtccgctgggctatatccacaacggcaagattgactatcagcgtaccccggcgcgtaaacacaccagcgacaccccgtttgatgtgagcaagctgaacgagctgccgaaagtgggtatcgtttacaactatgcgaacgcgagcgatctgccggcgaaagcgctggttaaggcgggttacgatggcattgtgagcgcgggcgttggtaacggcaacctgtataagaccgtgtttgataccctggcgaccgcggcgaaaaacggtaccgcggtggttcgtagcagccgtgttccgaccggtgcgaccacccaggacgcggaagtggacgatgcgaagtacggtttcgttgcgagcggcaccctgaacccgcaaaaagcgcgtgttctgctgcagctggcgctgacccaaaccaaggacccgaagcaaatccagcaaatttttaaccaatattaa

the SEQ ID NO 6 sequence is as follows:

atggagttctttaagaaaaccgcgctggcggcgctggtgatgggtttcagcggtgcggcgctggcgctgccgaacatcaccattctggcgaccggtggcaccattgcgggtggcggtgacagcgcgaccaagagcaactacaccgcgggtaaagtgggcgttgagaacctggtgaacgcggttccgcagctgaaggatatcgcgaacgtgaaaggtgaacaggtggttaacattggcagccaagacatgaacgacaaggtttggctgaccctggcgaagaaaatcaacaccgactgcgataaaaccgacggtttcgtgattacccacggcaccgataccatggaggaaaccgcgtactttctggacctgaccgtgaagtgcgataaaccggtggttatggttggtgcgatgcgtccgagcaccagcatgagcgcggatggtccgttcaacctgtataacgcggtggttaccgcggcggataaggcgagcgcgaaccgtggtgttctggtggttatgaacgacaccgtgctggacggccgtgatgttaccaagaccaacaccaccgatgtggcgaccttcaaaagcgttaactacggtccgctgggctatatccacaacggcaagattgactatcagcgtaccccggcgcgtaaacacaccagcgacaccccgtttgatgtgagcaagctgaacgagctgccgaaagtgggtatcgtttacaactatgcgaacgcgagcgatctgccggcgaaagcgctggttaaggcgggttacgatggcattgtgagcgcgggcgttggtaacggcaacctgtataagaccgtgtttgataccctggcgaccgcggcgaaaaacggtaccgcggtggttcgtagcagccgtgttccgaccggtgcgaccacccaggacgcggaagtggacgatgcgaagtacggtttcgttgcgagcggcaccctgaacccgcaaaaagcgcgtgttctgctgcagctggcgctgacccaaaccaaggacccgaagcaaatccagcaaatttttaaccaatattaa

example 2: preparation of pegylated conjugates of asparaginase and mutants thereof

In carbonate buffer, the buffer ionic strength is 100mmol/L, the modification pH is 9.0, the protein concentration is 20mg/ml, a certain amount of 5K-SC-PEG or 5K-SPA-PEG (the mass ratio of the protein to the 5K-SC-PEG or 5K-SPA-PEG is 1:10) is added, and the mixture is stirred and reacted for 2 hours at room temperature. And removing free PEG in the reaction solution by molecular exclusion chromatography, performing aseptic treatment, and packaging.

TABLE 1 asparaginase Pegylated conjugates Table of reference

Example 3: average modification degree of asparaginase and mutant pegylation conjugate thereof

Kunitani et al (Journal of Chromatography A,1991,588(1-2):125-137) found that both RI and UV absorbance of proteins are linear with protein concentration; the RI absorption value of PEG is in linear relation with the concentration of PEG, and the protein PEG part and the protein part after PEG modification do not interfere with the absorption values in RI or/and UV, by utilizing the mechanism, the average modification degree of the PEG modified protein is determined by SEC-HPLC refractive index and ultraviolet combination, the respective contents of the protein part and the PEG part in the PEG-protein are calculated by the standard curves of the protein with known contents and PEG, and the average modification degree is obtained by the molar content ratio of the protein to the PEG molecules.

TABLE 2 average modification of asparaginase mutant conjugates

Sample (I)	M0	M1	M2	M3	M4	M5
							Average degree of modification	34.0	34.4	50.0	48.4	48.8	49.6

Example 4: identification of modification sites for M0, M2, and M4

Since PEGylated asparaginase is formed by covalently bonding PEG to the amino group of lysine in asparaginase, and Lys-C cannot recognize the PEG-modified lysine, the modification site can be deduced by comparing the peptide fragment reduction before and after modification of asparaginase. And (4) digesting samples before and after modification by utilizing Lys-C enzyme, and analyzing by HPLC-MS so as to obtain the modification site.

TABLE 3-1M 0 molecular weights of cleaved peptides before and after modification

TABLE 3-2M 2 molecular weights of cleaved peptides before and after modification

TABLE 3 molecular weights of cleaved peptides before and after modification of 3M 4

Example 5: in vitro enzyme activity assays for A0, A1, A2, M0, M2 and M4

Asparaginase hydrolyzes L-asparagine releasing ammonia and the a0, a1, a2, M0, M2 and M4 enzyme activities described in the previous examples were determined by the color development of ammonia with nesler's reagent. Briefly, 50uL of the enzyme solution was diluted in 100mM PB buffer (pH 8.0) at a certain ratio, mixed with 100mM PB,20mM asparagine solution, incubated at 37 ℃ for 10min, the reaction was stopped by adding trichloroacetic acid, 100. mu.l of Neusler reagent was added for color development, and the absorbance of the reaction solution was measured at a wavelength of 450 nm. The activity was calculated from a calibration curve obtained with ammonium sulfate as a reference. Definition of enzyme activity units (U): the optimum reaction temperature was 37 ℃ and the amount of enzyme required to produce 1. mu. mol of ammonia in 1 minute was one unit (U) under the condition of pH 8.0. Table 4 shows the in vitro enzymatic activities of a0, a1, a2, M0, M2, and M4.

TABLE 4

Sample (I)

A0

A1

A2

M0

M2

M4

Enzyme activity

190.1U/mg

179.0U/mg

189.3U/mg

110.4U/mg

115.7U/mg

106.2U/mg

The results in Table 4 show that the asparaginase mutant conjugate still retains the activity of catalyzing the hydrolysis of asparagine.

Example 6: in vitro inhibition of different tumor cells by M0, M2 and M4

HL-60 (human acute promyelocytic leukemia cells), THP-1 (human mononuclear macrophages), Raji (human lymphoma cells) and L1210 (mouse lymphocyte leukemia cells) are selected, and the toxicity of M0, M2 and M4 to the tumor cells is respectively determined by a CCK-8 method. 90ul of cell suspension was added to a 96-well plate at 37 ℃ with 5% CO ₂ Adding drugs with different concentrations when culturing for 12 hours under saturated humidity, placing in an incubator, culturing for 10 hours, taking out, adding 10ul of CCK-8, culturing for 2 hours under the same conditions, measuring absorbance at the wavelength of 450nm, investigating the inhibition rates of different administration concentrations, and calculating IC ₅₀ 。

TABLE 5 in vitro inhibition of different tumor cells by A0, M0, M2 and M4

The results in Table 5 show that the asparaginase mutant conjugate can inhibit the growth of HL-60, THP-1, Raji and L1210 tumor cells in vitro.

Example 7: in vivo inhibition of tumor cells by A0, M0 and M4

Collecting L1210 cells (mouse lymphocyte leukemia cells) in logarithmic growth phase, counting and preparing cell suspension, injecting subcutaneously into right upper limb axilla of DBA/2 mouse, 2 × 10 ⁶ cells/mouse, after 24 hours, were randomly divided into four groups of 10 mice each, including PBS group, A0 group, M0 group and M4 group, and were administered by bolus intravenous injection at a dose of 50U/kg once a week for 50 days, as shown in FIG. 1.

As a result: as can be seen from fig. 1, the control mice died starting on day 30 and all mice died on day 39; mice in group a0 began to die at day 33, with a 1/5 survival rate at day 50; mice in the M0 group began to die at day 34, with a 7/10 survival rate at day 50; mice in the M4 group began to die at day 41, and the survival rate of mice at day 50 was 4/5.

Example 8: single pharmacokinetic Studies of A0, M0, and M4 in rats

Evaluation of pharmacokinetics in rats a0, M0 and M4, 24 male rats were randomly divided into 4 groups of 6 rats, i.e., PBS group (control group), a0, M0 group and M4 group, administered by bolus injection in a single dose of 200U/kg at 1h before administration, 3 days, 7 days, 11 days, 17 days and 21 days after the first administration, respectively. The level of asparaginase in serum was determined by the enzyme activity method (alpha-KG method) (Fernandez, International journal of clinical and experimental media, 2013,6(7): 478).

As a result: as can be seen from FIG. 2, the levels of asparaginase in the sera of the two groups of rats after a single intravenous administration tended to decrease, and the level of asparaginase in the sera of the M4 group rats was consistently higher than that of the M0 group.

Example 9: multiple drug substitution and immunogenicity studies of A0, M0 and M4 in rats

Multiple pharmacokinetic and immunogenicity evaluations of a0, M0 and M4 were performed in vivo in rats, 18 male rats, randomly divided into 4 groups of 6 animals, i.e., PBS group (control group), a0, M0 and M4, administered by intravenous bolus injection at a dose of 70U/kg once a week four times each 3 days and 7 days after each administration. The content of asparaginase in the serum is detected by an enzyme activity method (alpha-KG method) (High-throughput asparaginase activity assay in serum of children with leukamia). The serum was tested for anti-asparaginase protein antibodies and anti-PEG antibodies by the Elisa method.

As a result: FIG. 3 shows that in the M4 group rats, the asparaginase content in the serum of each administration tends to increase compared with the last administration in the 4 times of intravenous administration, and the asparaginase content in the serum of the 4 th (last) administration is significantly increased compared with the first administration; in the M0 group, after each administration, the content of asparaginase in the serum of rats has no significant difference compared with the last administration. The levels of asparaginase in the serum of rats in group M4 were consistently higher than in group M0 throughout the dosing period. By LC-MS, no asparagine was detected in the serum of both groups of rats.

At a 1:10 serum dilution, 1 animal anti-PEG positive antibody (1/6) appeared 7 days after the 2 nd dose in the M0 group, 6/6 3 days after the 3 rd dose, 5/6 days after the 7 th dose, 5/6 days after the 4 th dose, 5/6 days; group M4 presented 1 (1/6) 3 days after

dose

1, 1/6 7 days after

dose

3, 1/6 3 days after

dose

4, and 2/6 days after dose 7. It can be seen that M4 is superior to M0 in immunogenicity, which may be due to increased PEGylation of asparaginase and reduced immunogenicity of the protein (Effect of protein immunogenicity and PEG size and fermentation on the anti-PEG immune response to PEGylated proteins); in addition, because the surface charge of the protein is reduced after the protein is modified by polyethylene glycol, and the surface of cells (such as immune cells such as macrophages and B cells) has negative charge, the affinity of M4 and the immune cells is reduced, and the immune response in vivo is weakened. At a serum dilution of 1:50, the anti-PEG antibody detection in the sera of both groups of rats was negative, indicating that the anti-PEG antibody titers in both groups of rats were low.

The serum antibody titers of rats in group A0 reached 1:100 after two weeks, and rats in groups M0 and M4 did not produce antibodies against asparaginase protein in vivo after multiple intravenous administrations.

Example 10: effect of anti-asparaginase antibody on drug delivery of Pemendonase (Henry drug) and M4 in rats

12 male SD rats are subcutaneously administered with asparaginase (Qianhong pharmaceutical), 1 time per day, 100U/kg each time, 3 days of administration, after a week of rest, Elisa detects the anti-ASP antibody titer in the serum of the rats, after 1:100, the asparaginase enzyme activity in the serum disappears, the rats are randomly divided into 2 groups, 6 rats in each group (the asparaginase group and the M4 group), intravenous injection is adopted, the administration dose is 200U/kg, and blood is collected 1 day, 3 days, 5 days and 7 days after administration. The level of asparaginase in serum was determined by the enzyme activity method (α -KG method) (Fernandez, International journal of clinical and experimental media, 2013,6(7): 478).

As a result: FIG. 4 shows that after intravenous injection of peyronase (Henry) and M4, the levels of asparaginase in the sera of both groups of rats were decreasing, and that in the M4 group of rats, the level of asparaginase in the sera of M4 group of rats was consistently higher than that in the peyronase group, wherein 1 day after administration, the level of asparaginase in the sera of M4 group of rats was 2501.7 + -435.7 mU/ml, and the level of asparaginase in the sera of peyronase group of rats was 1473.8 + -139.9 mU/ml.

Example 11: binding of Pemendornase and M4 to anti-asparaginase antibodies in vitro

4 rats were injected subcutaneously with asparaginase (Qianhong pharmaceutical) and Freund's adjuvant once a week at 2mg/kg each time, sacrificed after one month of administration, sera were taken, anti-asparaginase antibodies were prepared by affinity chromatography, and binding of asparaginase (Henry pharmaceutical) and M4 to the anti-asparaginase antibodies was examined by Elisa assay.

TABLE 6

Table 6 the results show: after the same amount of the substances of the pellucid and the M4 are respectively coated in an Elisa experiment and incubated with an anti-asparaginase antibody, the binding force of the pellucid and the mouse anti-asparaginase antibody is shown to be stronger than that of M4.

Example 12: effect of anti-PEG antibodies on drug delivery of Pemendonase (Henry pharmaceutical) and M4 in rats

12 male SD rats were administered with pegylated phenylalanine lyase subcutaneously 1 time at a dose of 1.5mg/kg, and after blood collection on day 7 after administration, the PEG antibodies were detected, and after confirming that the PEG antibodies in the serum were all positive, they were randomly divided into two groups, and then separately injected with Pemendorn (Henry pharmaceutical) and M4 intravenously at a dose of 100U/kg, and blood was collected on

days

1, 3, 5, and 7 after administration, and after blood collection on day 7, the administration was repeated once, and blood was collected on

days

1, 3, 5, and 7 after administration. The level of asparaginase in serum was determined by the enzyme activity method (alpha-KG method) (Fernandez, International journal of clinical and experimental media, 2013,6(7): 478).

As a result: the pegylated phenylalanine lyase is a high-immunogenicity metabolic enzyme, a large amount of anti-PEG antibodies are generated in rats after subcutaneous injection, the experiment is randomly divided into two groups, the pegylation (Henry pharmacy) and the M4 are respectively injected intravenously, after administration for 1 day, 3 days, 5 days and 7 days, no asparaginase is detected in the serum of the two groups of rats, the administration is repeated once, the content of the asparaginase in the serum of the two groups of rats is shown in figure 5, and thus, the content of the asparaginase in the serum of the M4 group of rats is obviously higher than that of the pegylation group.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Sequence listing

<110> Chongqing Paijin Biotechnology Co., Ltd

<120> directed chemical coupling asparaginase mutant and preparation method and application thereof

<130> PIDC3204372

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 326

<212> PRT

<213> Escherichia coli

<400> 1

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Asp

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Asp Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Thr Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Gln Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 2

<211> 326

<212> PRT

<213> Artificial Sequence

<220>

<223> D64K, N143K, D233K and Q317K site mutated asparaginase

<400> 2

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Lys

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Lys Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Lys Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Thr Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Lys Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 3

<211> 326

<212> PRT

<213> Artificial Sequence

<220>

<223> D64K, D233K, Q317K site mutated asparaginase

<400> 3

Leu Pro Asn Ile Thr Ile Leu Ala Thr Gly Gly Thr Ile Ala Gly Gly

1 5 10 15

Gly Asp Ser Ala Thr Lys Ser Asn Tyr Thr Ala Gly Lys Val Gly Val

20 25 30

Glu Asn Leu Val Asn Ala Val Pro Gln Leu Lys Asp Ile Ala Asn Val

35 40 45

Lys Gly Glu Gln Val Val Asn Ile Gly Ser Gln Asp Met Asn Asp Lys

50 55 60

Val Trp Leu Thr Leu Ala Lys Lys Ile Asn Thr Asp Cys Asp Lys Thr

65 70 75 80

Asp Gly Phe Val Ile Thr His Gly Thr Asp Thr Met Glu Glu Thr Ala

85 90 95

Tyr Phe Leu Asp Leu Thr Val Lys Cys Asp Lys Pro Val Val Met Val

100 105 110

Gly Ala Met Arg Pro Ser Thr Ser Met Ser Ala Asp Gly Pro Phe Asn

115 120 125

Leu Tyr Asn Ala Val Val Thr Ala Ala Asp Lys Ala Ser Ala Asn Arg

130 135 140

Gly Val Leu Val Val Met Asn Asp Thr Val Leu Asp Gly Arg Asp Val

145 150 155 160

Thr Lys Thr Asn Thr Thr Asp Val Ala Thr Phe Lys Ser Val Asn Tyr

165 170 175

Gly Pro Leu Gly Tyr Ile His Asn Gly Lys Ile Asp Tyr Gln Arg Thr

180 185 190

Pro Ala Arg Lys His Thr Ser Asp Thr Pro Phe Asp Val Ser Lys Leu

195 200 205

Asn Glu Leu Pro Lys Val Gly Ile Val Tyr Asn Tyr Ala Asn Ala Ser

210 215 220

Asp Leu Pro Ala Lys Ala Leu Val Lys Ala Gly Tyr Asp Gly Ile Val

225 230 235 240

Ser Ala Gly Val Gly Asn Gly Asn Leu Tyr Lys Thr Val Phe Asp Thr

245 250 255

Leu Ala Thr Ala Ala Lys Asn Gly Thr Ala Val Val Arg Ser Ser Arg

260 265 270

Val Pro Thr Gly Ala Thr Thr Gln Asp Ala Glu Val Asp Asp Ala Lys

275 280 285

Tyr Gly Phe Val Ala Ser Gly Thr Leu Asn Pro Gln Lys Ala Arg Val

290 295 300

Leu Leu Gln Leu Ala Leu Thr Gln Thr Lys Asp Pro Lys Gln Ile Gln

305 310 315 320

Gln Ile Phe Asn Gln Tyr

325

<210> 4

<211> 1047

<212> DNA

<213> Escherichia coli

<400> 4

atggagttct ttaagaaaac cgcgctggcg gcgctggtga tgggtttcag cggtgcggcg 60

ctggcgctgc cgaacatcac cattctggcg accggtggca ccattgcggg tggcggtgac 120

agcgcgacca agagcaacta caccgcgggt aaagtgggcg ttgagaacct ggtgaacgcg 180

gttccgcagc tgaaggatat cgcgaacgtg aaaggtgaac aggtggttaa cattggcagc 240

caagacatga acgacgatgt ttggctgacc ctggcgaaga aaatcaacac cgactgcgat 300

aaaaccgacg gtttcgtgat tacccacggc accgatacca tggaggaaac cgcgtacttt 360

ctggacctga ccgtgaagtg cgataaaccg gtggttatgg ttggtgcgat gcgtccgagc 420

accagcatga gcgcggatgg tccgttcaac ctgtataacg cggtggttac cgcggcggat 480

aaggcgagcg cgaaccgtgg tgttctggtg gttatgaacg acaccgtgct ggacggccgt 540

gatgttacca agaccaacac caccgatgtg gcgaccttca aaagcgttaa ctacggtccg 600

ctgggctata tccacaacgg caagattgac tatcagcgta ccccggcgcg taaacacacc 660

agcgacaccc cgtttgatgt gagcaagctg aacgagctgc cgaaagtggg tatcgtttac 720

aactatgcga acgcgagcga tctgccggcg aaagcgctgg ttgacgcggg ttacgatggc 780

attgtgagcg cgggcgttgg taacggcaac ctgtataaga ccgtgtttga taccctggcg 840

accgcggcga aaaacggtac cgcggtggtt cgtagcagcc gtgttccgac cggtgcgacc 900

acccaggacg cggaagtgga cgatgcgaag tacggtttcg ttgcgagcgg caccctgaac 960

ccgcaaaaag cgcgtgttct gctgcagctg gcgctgaccc aaaccaagga cccgcagcaa 1020

atccagcaaa tttttaacca atattaa 1047

<210> 5

<211> 1047

<212> DNA

<213> Artificial Sequence

<220>

<223> nucleic acid sequence encoding asparaginase with mutations at positions D64K, N143K, D233K and Q317K

<400> 5

atggagttct ttaagaaaac cgcgctggcg gcgctggtga tgggtttcag cggtgcggcg 60

ctggcgctgc cgaacatcac cattctggcg accggtggca ccattgcggg tggcggtgac 120

agcgcgacca agagcaacta caccgcgggt aaagtgggcg ttgagaacct ggtgaacgcg 180

gttccgcagc tgaaggatat cgcgaacgtg aaaggtgaac aggtggttaa cattggcagc 240

caagacatga acgacaaggt ttggctgacc ctggcgaaga aaatcaacac cgactgcgat 300

aaaaccgacg gtttcgtgat tacccacggc accgatacca tggaggaaac cgcgtacttt 360

ctggacctga ccgtgaagtg cgataaaccg gtggttatgg ttggtgcgat gcgtccgagc 420

accagcatga gcgcggatgg tccgttcaac ctgtataacg cggtggttac cgcggcggat 480

aaggcgagcg cgaaacgtgg tgttctggtg gttatgaacg acaccgtgct ggacggccgt 540

gatgttacca agaccaacac caccgatgtg gcgaccttca aaagcgttaa ctacggtccg 600

ctgggctata tccacaacgg caagattgac tatcagcgta ccccggcgcg taaacacacc 660

agcgacaccc cgtttgatgt gagcaagctg aacgagctgc cgaaagtggg tatcgtttac 720

aactatgcga acgcgagcga tctgccggcg aaagcgctgg ttaaggcggg ttacgatggc 780

attgtgagcg cgggcgttgg taacggcaac ctgtataaga ccgtgtttga taccctggcg 840

accgcggcga aaaacggtac cgcggtggtt cgtagcagcc gtgttccgac cggtgcgacc 900

acccaggacg cggaagtgga cgatgcgaag tacggtttcg ttgcgagcgg caccctgaac 960

ccgcaaaaag cgcgtgttct gctgcagctg gcgctgaccc aaaccaagga cccgaagcaa 1020

atccagcaaa tttttaacca atattaa 1047

<210> 6

<211> 1047

<212> DNA

<213> Artificial Sequence

<220>

<223> asparaginase nucleic acid sequence encoding mutations at positions D64K, D233K, Q317K

<400> 6

atggagttct ttaagaaaac cgcgctggcg gcgctggtga tgggtttcag cggtgcggcg 60

ctggcgctgc cgaacatcac cattctggcg accggtggca ccattgcggg tggcggtgac 120

agcgcgacca agagcaacta caccgcgggt aaagtgggcg ttgagaacct ggtgaacgcg 180

gttccgcagc tgaaggatat cgcgaacgtg aaaggtgaac aggtggttaa cattggcagc 240

caagacatga acgacaaggt ttggctgacc ctggcgaaga aaatcaacac cgactgcgat 300

aaaaccgacg gtttcgtgat tacccacggc accgatacca tggaggaaac cgcgtacttt 360

ctggacctga ccgtgaagtg cgataaaccg gtggttatgg ttggtgcgat gcgtccgagc 420

accagcatga gcgcggatgg tccgttcaac ctgtataacg cggtggttac cgcggcggat 480

aaggcgagcg cgaaccgtgg tgttctggtg gttatgaacg acaccgtgct ggacggccgt 540

gatgttacca agaccaacac caccgatgtg gcgaccttca aaagcgttaa ctacggtccg 600

ctgggctata tccacaacgg caagattgac tatcagcgta ccccggcgcg taaacacacc 660

agcgacaccc cgtttgatgt gagcaagctg aacgagctgc cgaaagtggg tatcgtttac 720

aactatgcga acgcgagcga tctgccggcg aaagcgctgg ttaaggcggg ttacgatggc 780

attgtgagcg cgggcgttgg taacggcaac ctgtataaga ccgtgtttga taccctggcg 840

accgcggcga aaaacggtac cgcggtggtt cgtagcagcc gtgttccgac cggtgcgacc 900

acccaggacg cggaagtgga cgatgcgaag tacggtttcg ttgcgagcgg caccctgaac 960

ccgcaaaaag cgcgtgttct gctgcagctg gcgctgaccc aaaccaagga cccgaagcaa 1020

atccagcaaa tttttaacca atattaa 1047

Claims

1. An asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof, wherein the asparaginase mutant conjugate comprises an asparaginase mutant chemically conjugated to a group which reduces immunogenicity and increases half-life in vivo,

2. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 1, wherein the non-mutated asparaginase is derived from erwinia or e.coli;

optionally, the amino acid sequence of the non-mutated asparaginase has at least 80% sequence identity with the amino acid sequence shown in SEQ ID NO. 1.

3. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 2, wherein the asparaginase mutant has at least 80% sequence identity to the amino acid sequence of the non-mutated asparaginase and retains at least 85% of the enzymatic activity compared to the non-mutated asparaginase.

4. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 1, wherein the asparaginase mutant has amino acid mutations at least 1 of N37K, D64K, N143K, D233K, T252K, Q317K.

5. The asparaginase mutant conjugate or pharmaceutically acceptable salt thereof according to claim 1, wherein the asparaginase mutant has amino acid mutations at positions comprising D64K, N143K, D233K and Q317K, and has the amino acid sequence shown in SEQ ID NO 2.

6. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 1, wherein the asparaginase mutant has amino acid mutations at positions comprising D64K, D233K and Q317K, and has the amino acid sequence shown in SEQ ID NO. 3.

7. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 6, wherein the group capable of reducing immunogenicity and increasing half-life in vivo is directionally coupled by amide bond formation with the amino group of lysine in the asparaginase mutant, said group being methoxypolyethylene glycol with an activating group;

optionally, the activating group is selected from succinimide carbonate, succinimide propionate, succinimide acetate, succinimide succinate;

optionally, the polyethylene glycol has a molecular weight of 2kDa to 20kDa, preferably 5 kDa.

8. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 7, wherein the directional coupling rate of the newly formed mutated lysine in the asparaginase mutant to the group is not less than 50%.

9. The asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof according to claim 7, wherein the number of groups conjugated in the asparaginase mutant conjugate is A + 75% N, wherein A and N are integers, and 30. ltoreq. A.ltoreq.40; n is the number of lysine increase in the asparaginase mutant compared to the non-mutated asparaginase.

10. A process for the preparation of an asparaginase mutant conjugate or a pharmaceutically acceptable salt thereof as claimed in any one of claims 1 to 9, which comprises mixing the asparaginase mutant with polyethylene glycol in a buffer to effect a conjugation reaction to obtain the asparaginase mutant conjugate.

11. The method according to claim 10, wherein the buffer solution has a pH of 7.5 to 10.5 when the coupling reaction is performed;

optionally, the reaction time is 1-2 h;

optionally, the ionic strength of the buffer solution is 10-200 mmol/L;

optionally, the buffer is selected from at least one of phosphate, carbonate, borate;

optionally, the weight ratio of the asparaginase mutant to the polyethylene glycol is not less than 1: 5.

12. The method according to claim 10, wherein the mutant aspartase is a mutant in which an amino acid at least one site in the non-mutated aspartase is mutated to lysine;

optionally, the non-mutated asparaginase is derived from erwinia or escherichia coli;

13. The method of claim 10, wherein the asparaginase mutant has at least 80% sequence identity with the amino acid sequence of the non-mutated asparaginase, and the enzyme activity of the asparaginase mutant is at least 85% retained compared to the non-mutated asparaginase.

14. The method of claim 10, wherein the positions of amino acid mutations in the asparaginase mutant include at least 1 of N37K, D64K, N143K, D233K, T252K, Q317K.

15. The preparation method of claim 10, wherein the positions of amino acid mutations in the asparaginase mutant comprise D64K, N143K, D233K and Q317K, and the amino acid sequence of the asparaginase mutant is shown as SEQ ID NO. 2.

16. The preparation method of claim 10, wherein the positions of amino acid mutations in the asparaginase mutant comprise D64K, D233K and Q317K, and the amino acid sequence of the asparaginase mutant is shown as SEQ ID NO. 3.

17. The process according to claim 10, wherein the polyethylene glycol has a molecular weight of 2KDa to 20KDa, preferably 5 KDa;

optionally, the polyethylene glycol is selected from at least one of succinimidyl carbonate polyethylene glycol (SC-PEG), succinimidyl propionate polyethylene glycol (SPA-PEG), succinimidyl acetate polyethylene glycol (SCM-PEG), succinimidyl succinate polyethylene glycol (SS-PEG).

18. A pharmaceutical composition comprising an asparaginase mutant conjugate according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof or prepared by the preparation process according to any one of claims 10 to 17 or a pharmaceutically acceptable salt thereof.

19. Use of an asparaginase mutant conjugate according to any one of claims 1 to 9 or a pharmaceutically acceptable salt thereof or a asparaginase mutant conjugate prepared by the preparation method according to any one of claims 10 to 17 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for killing tumors.

20. The use of claim 19, wherein the tumor killing drug comprises a drug that inhibits and kills tumors by depleting asparagine in serum.

Optionally, the tumor is selected from acute lymphocytic leukemia, melanoma cells, hodgkin's lymphoma, chronic leukemia, lymphosarcoma cells, hepatocellular carcinoma.