CN114836569B - KASP molecular marker of main effect QTL of heart branching character and application thereof - Google Patents
KASP molecular marker of main effect QTL of heart branching character and application thereof Download PDFInfo
- Publication number
- CN114836569B CN114836569B CN202210580254.XA CN202210580254A CN114836569B CN 114836569 B CN114836569 B CN 114836569B CN 202210580254 A CN202210580254 A CN 202210580254A CN 114836569 B CN114836569 B CN 114836569B
- Authority
- CN
- China
- Prior art keywords
- heart
- kasp
- molecular marker
- qtl
- main effect
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 239000003147 molecular marker Substances 0.000 title claims abstract description 23
- 230000000694 effects Effects 0.000 title claims abstract description 17
- 238000009395 breeding Methods 0.000 claims abstract description 16
- 230000001488 breeding effect Effects 0.000 claims abstract description 15
- 235000003899 Brassica oleracea var acephala Nutrition 0.000 abstract description 26
- 210000000349 chromosome Anatomy 0.000 abstract description 15
- 244000128884 Zier Kohl Species 0.000 abstract description 13
- 230000002068 genetic effect Effects 0.000 abstract description 8
- 235000013311 vegetables Nutrition 0.000 abstract description 7
- 239000003550 marker Substances 0.000 abstract description 6
- 238000000034 method Methods 0.000 abstract description 6
- 230000000996 additive effect Effects 0.000 abstract description 2
- 241000196324 Embryophyta Species 0.000 description 17
- 240000007124 Brassica oleracea Species 0.000 description 13
- 235000011301 Brassica oleracea var capitata Nutrition 0.000 description 13
- 235000001169 Brassica oleracea var oleracea Nutrition 0.000 description 13
- 108090000623 proteins and genes Proteins 0.000 description 9
- 238000003205 genotyping method Methods 0.000 description 7
- 238000004458 analytical method Methods 0.000 description 6
- 230000001276 controlling effect Effects 0.000 description 6
- 239000007788 liquid Substances 0.000 description 6
- 238000012163 sequencing technique Methods 0.000 description 6
- 230000008901 benefit Effects 0.000 description 4
- 238000009826 distribution Methods 0.000 description 4
- 230000004807 localization Effects 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 238000001179 sorption measurement Methods 0.000 description 4
- 244000060924 Brassica campestris Species 0.000 description 3
- 238000003306 harvesting Methods 0.000 description 3
- 230000001105 regulatory effect Effects 0.000 description 3
- 239000002699 waste material Substances 0.000 description 3
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 description 2
- 241000219198 Brassica Species 0.000 description 2
- 235000011292 Brassica rapa Nutrition 0.000 description 2
- 244000221633 Brassica rapa subsp chinensis Species 0.000 description 2
- 235000010149 Brassica rapa subsp chinensis Nutrition 0.000 description 2
- 235000000536 Brassica rapa subsp pekinensis Nutrition 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000010276 construction Methods 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 238000001514 detection method Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000013467 fragmentation Methods 0.000 description 2
- 238000006062 fragmentation reaction Methods 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 238000007689 inspection Methods 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 210000000056 organ Anatomy 0.000 description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000000926 separation method Methods 0.000 description 2
- 235000011331 Brassica Nutrition 0.000 description 1
- 235000005637 Brassica campestris Nutrition 0.000 description 1
- 241000219193 Brassicaceae Species 0.000 description 1
- 238000007400 DNA extraction Methods 0.000 description 1
- 108020002230 Pancreatic Ribonuclease Proteins 0.000 description 1
- 102000005891 Pancreatic ribonuclease Human genes 0.000 description 1
- 241000700647 Variola virus Species 0.000 description 1
- 230000009418 agronomic effect Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 238000000227 grinding Methods 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 238000005065 mining Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910052757 nitrogen Inorganic materials 0.000 description 1
- 239000000843 powder Substances 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 239000000047 product Substances 0.000 description 1
- 230000002035 prolonged effect Effects 0.000 description 1
- 238000009394 selective breeding Methods 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 230000017260 vegetative to reproductive phase transition of meristem Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a KASP molecular marker of a main effect QTL of the branch number of a vegetable heart and application thereof, wherein the main effect QTL is positioned on an A07 chromosome of the vegetable heart and is named qBrTL < 1 >; the qBrTL positioning interval is 34.24cM interval between KASP markers A0716 and A0717, which can explain 20.81% of phenotype variation, and the additive effect is 1.52; the qBrTL comprises two linked KASP molecular markers A0716 and A0717, wherein A0716 is developed according to the 28007027bp base presentation polymorphism of the A07 chromosome, the base is A or G, A0717 is developed according to the 28031606bp base presentation polymorphism of the A07 chromosome, and the base is T or G. The two KASP molecular markers can realize high-throughput and rapid auxiliary selection of the branched character of the flowering cabbage, improve the selection efficiency, accelerate the breeding process and provide a novel genetic marker for molecular breeding of multi-branched flowering cabbage.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a KASP molecular marker of a main effect QTL of a heart branching trait and application thereof.
Background
The flowering cabbage (Brassica campestris L. Ssp. Chinese var. Utilis TSEN ET LEE) is a biennial herbaceous plant (Zhang Hua, 2010; huang Xiu, 2017) in the brassica species of the brassica genus of the cruciferae family taking the flowering cabbage as an edible organ, is a special vegetable (Chen Hancai, 2021) native to Guangdong and having a wide cultivation area. The main inflorescence of the common flowering cabbage variety has obvious growth advantages, each plant usually only harvests 1 flowering cabbage in production, the yield is low compared with that of the special flowering cabbage variety in Guangdong, the flowering cabbage variety can form about 15 multi-lateral branches near the ground stem base, the multi-lateral branches can be harvested for a plurality of times by one-time planting, the lateral branches serve as commodity organs, the quantity of the lateral branches can serve as the standard for measuring the yield of the flowering cabbage (Liu Lecheng and the like, 1998), and therefore, the breeding of the multi-branch flowering cabbage variety has important significance.
The number of branches of the cabbage is a quantitative trait, the mechanism of formation is very complex, the number of branches is easily influenced by environment, so that the traditional conventional breeding method based on phenotype selection has poor selection effect on the complex quantitative trait, long breeding period, low selection efficiency and prolonged breeding period, and can not completely meet the current requirement of cabbage breeding. The combination of molecular marking technology and quantitative genetics can decompose complex quantitative traits into single quantitative trait loci (quantitative trait loci, QTL), and then the quantitative trait loci and positions can be determined by researching a plurality of genes for controlling the quantitative traits like researching the quantitative traits and utilizing the QTL positioning. Molecular marker assisted breeding is a new means for effectively combining molecular genetics with traditional phenotype selection, and target region and whole genome screening is carried out on individuals by directly utilizing molecular markers closely linked or co-separated from target trait genes, so that the purposes of improving target trait selection efficiency and shortening breeding years are achieved. The key of the molecular marker assisted selective breeding technology is to identify DNA molecular markers closely linked with important agronomic traits. KaSP has been successfully used for genotyping by constructing genetic map mining and trait-related genes. The KASP markers are not limited by the base type and site, and indels and SNPs can be detected. Fine localization of candidate genes can be achieved by KASP markers in combination with phenotypic data and then by QTL MAPPING software.
Cultivating multi-branched cabbage variety is an effective way to increase the yield and economic benefit of cabbage. The current identified genes for controlling the branch number of the cabbage are few, and the requirements of molecular breeding cannot be met. Therefore, the development of the main QTL of the heart branching character and the development of the molecular marker closely linked with the main QTL of the heart branching character has important significance for the molecular marker assisted selection breeding of multi-branch heart varieties.
Disclosure of Invention
This section is intended to outline some aspects of embodiments of the application and to briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section as well as in the description of the application and in the title of the application, which may not be used to limit the scope of the application.
The present invention has been made in view of the problems occurring in the prior art.
In order to solve the technical problems, according to one aspect of the present invention, the following technical solutions are provided:
KASP molecular marker of main effect QTL of heart of cabbage and application thereof, wherein the sequence of KASP molecular marker primer of A0716 is shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
The KASP molecular marker primer sequence of A0717 is shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.
The invention also aims at the application of the KASP molecular marker primer group of the main effect QTL of the heart branching trait in multi-branch heart breeding. The invention can be applied to early identification and screening of heart branching characters, improves the selection efficiency, and provides a new genetic marker for multi-branch heart molecular breeding.
In order to achieve the above object, the present invention adopts the following technical measures:
KASP molecular markers of the main effect QTL of the heart of the cabbage are obtained by:
(1) The common small-branch flowering cabbage DH line 'CX010' and the multi-branch city-increasing flowering cabbage DH line 'CX020' are used as parents, F 1 generation is generated by hybridization, and F 2 generation separation colony is generated by selfing.
(2) All F 2 generation segregating populations were grown under exactly identical conditions, and the branching numbers were counted for each individual of the two parental materials and F 2 generation segregating populations during the most obvious period of branching phenotype. The specific method comprises the following steps: the criteria for investigating the number of branches was that the number of branches within 5cm of the base of the stem was the base of the stem.
(3) The branching number of the F 2 group plants is separated, and the normal distribution trend is presented, so that the flowering branch character of the flowering cabbage is quantitative character. From the F 2 segregating population, 50 plants each with an extreme branching phenotype and in the intermediate branching phenotype were selected, and leaf total DNA of 'CX010' and 'CX020' and F 2 plants were extracted using the novel plant genomic DNA extraction kit (smallpox, beijing, china).
(4) 3 Pools of multi-branch phenotype (12-15 branches), few-branch phenotype (1-3 branches) and middle-branch phenotype (7-8 branches) are constructed, gradedPool-Seq sequencing is carried out on the three pools and two parents, DNA samples are broken into fragments with the length of 350bp through a fragmentation kit, and a library is built. The sequencing platform was NovaSeq (Illumina) and the sequencing mode was PE150.
(5) The original data are quality-controlled, reads are compared to a celery cabbage V3.0 reference genome (http:// brasicadb. Org/brad/datasets/pub/genome/brassica_rapa/V3.0 /) by using BWA, the comparison result is subjected to SAMTOOLS to remove repetition, mutation sites are analyzed according to the analysis flow of GATK, SNP and InDel information are obtained, and SNPeff is adopted to carry out structural annotation on the mutation sites.
(6) And carrying out Ridit inspection and analysis on the data, then carrying out noise reduction, and counting the proportion of the p-value significant sites to the total sites of the sliding window area, thereby judging the area with significant association with the character. The noise reduction parameter is window size 0.2Mb, and the p-value threshold is 10 -8. Finally, the region of 28.0-28.9 Mb of the A07 chromosome is positioned as a candidate QTL region, and the gene for regulating and controlling the branch number is positioned on the A07 chromosome.
(7) And according to SNP information, uniformly selecting SNP loci which have no other variation of 100bp before and after selection in a candidate interval, and then designing a primer to convert the SNP loci into KASP markers. The KASP marker with good genotyping is obtained by detecting the genotypes of the parent and part of F 2 population single plants, and is used for constructing a genetic linkage map.
(8) Genotyping each individual in the F 2 population was performed using specific KASP markers, QTL analysis was performed using QTL ICIMAPPING software and combining genotype and phenotype data. Based on the technical measures, a QTL locus qBrTL1 for controlling the branch number of the vegetable heart is finally obtained, and the main effect QTL is positioned on the A07 chromosome of the vegetable heart. The qBrTL1 includes two linked KASP molecular markers, A0716 and A0717, the LOD peak (10.41) is located at chromosome 7 at 27cM, the contribution rate is 20.81%, and the additive effect and dominant effect are 1.52 and 2.37, respectively. The physical positions of the A0716-labeled polymorphic base and the A0717-labeled polymorphic base were at 28007027bp and 28031606bp, respectively, on the A07 chromosome, with a distance of about 24.6kb therebetween.
Compared with the prior art, the invention has the beneficial effects that: the KASP molecular marker of the main effect QTL of the heart branches and the application thereof are obtained by developing the marker closely linked with the main effect QTL of the heart branches of the vegetable, and the QTL genetic effect positioned by the KASP molecular marker is obvious and stable, so that the requirement of molecular breeding can be met.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following detailed description of the embodiments of the present invention will be given with reference to the accompanying drawings, which are to be understood as merely some embodiments of the present invention, and from which other drawings can be obtained by those skilled in the art without inventive faculty. Wherein:
FIG. 1 is a morphology diagram of two parents of the present invention. ( The branching feature of 'CX010' is that 1-3 axillary buds are grown, but only one effective branch is formed for harvesting. The branching feature of 'CX020' is the ability to produce 12-15 branch harvests near rosette leaves. )
FIG. 2 is a statistical plot of the branching numbers of two parents of the present invention.
FIG. 3 is a graph of the branching number distribution of plants of the F 2 population. (the abscissa represents the distribution of the branching frequency and the ordinate represents the number of individuals; the result shows that the branching number is normally distributed, and the branching number is proved to belong to quantitative characters).
FIG. 4 is a diagram showing the initial localization of the gene for identifying heart branch number by GradedPool-Seq method. (the abscissa is chromosome position coordinate, the unit is 100kb, the ordinate is the ratio of points with p value lower than the threshold value in the window to the total number of points in the window, the higher the position of the points is, the stronger the association degree with the characters is, the 28.0-28.9 Mb region of the A07 chromosome, namely the highest peak region is finally positioned as a candidate QTL region, and the gene for regulating and controlling the branch number is positioned on the A07 chromosome).
FIG. 5 is a map of the localization of the major QTL (qBrTL 1) for the heart branching trait in an embodiment of the present invention.
FIG. 6 is a graph showing the genotyping results of A0716 on the F 2 population in the example of the present invention. ( A single plant with the same genotype as the heart of less-branched cabbage CX010', and the genotype is GG and shows less branching; a single plant with the same genotype as the multi-branched cabbage 'CX020', the genotype is AA, and the multi-branched cabbage is expressed; a single plant heterozygous for the genotype GA, which appears as an intermediate branch. )
FIG. 7 is a graph showing the genotyping results of A0717 on the F 2 population in the example of the present invention. ( A single plant with the same genotype as the heart of less-branched cabbage CX010', wherein the genotype is TT and the single plant shows less branching; ; an individual with the same genotype as the multi-branched cabbage 'CX020', the genotype is GG, and the multi-branched cabbage is expressed; a single plant with heterozygous genotype, the genotype of which is TG, appears as an intermediate branch. )
Detailed Description
In order that the above objects, features and advantages of the invention will be readily understood, a more particular description of the invention will be rendered by reference to the appended drawings.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways other than those described herein, and persons skilled in the art will readily appreciate that the present invention is not limited to the specific embodiments disclosed below.
Next, the present invention will be described in detail with reference to the drawings, wherein the sectional view of the device structure is not partially enlarged to general scale for the convenience of description, and the drawings are only examples, which should not limit the scope of the present invention. In addition, the three-dimensional dimensions of length, width and depth should be included in actual fabrication.
For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention will be described in further detail below with reference to the accompanying drawings.
Construction and character investigation of a heart branch number separation population:
In this example, the common less-branched core DH line 'CX010' (FIG. 1 a) and the multi-branched city-increasing core DH line 'CX020' are used as parents (FIG. 1 b), the difference of the two branches is remarkable (FIG. 2), and the F 2 segregating group is constructed by hybridization and selfing. The statistics of the number of branches per individual plant for both parental material and F 2 generation segregating populations were performed during the most obvious period of the heart branching phenotype. The specific method comprises the following steps: the criteria for investigating the number of branches was that the number of branches within 5cm of the base of the stem was the base of the stem.
The number of branches of F 2 group plants are separated, and the normal distribution trend is shown, which shows that the heart branch character is quantitative character (figure 3).
Extracting total DNA of leaves of a parent and F 2 group:
(1) Adding liquid nitrogen into fresh leaves, grinding into powder, adding 400 mu L of buffer LP1 and 6 mu L of RNase A, oscillating for 1min, and standing at room temperature for 10min; adding 130 mu L of buffer LP2, fully and uniformly mixing, and oscillating for 1min; centrifuging at 12000rpm for 5min, and transferring the supernatant into a 1.5mL centrifuge tube;
(2) Adding 1.5 times of LP3 buffer solution, shaking and uniformly mixing for 15s, wherein flocculent precipitate can appear in a centrifuge tube; transferring the solution into an adsorption column CB3, centrifuging at 12000rpm for 1min, and pouring out the waste liquid; adding 600 μl of rinsing liquid PW into the adsorption column, centrifuging at 12000rpm for 1min, pouring out the waste liquid, and repeating twice; centrifuging at 12000rpm for 2min, pouring out the waste liquid, standing the adsorption column at room temperature until the residual rinsing liquid is dried;
(3) Transferring the adsorption column into a new 1.5mL centrifuge tube, suspending and dripping 50 μl of elution buffer TE, standing at room temperature for 5min, centrifuging at 12000rpm for 2min, detecting the concentration of genomic DNA with a microplate reader, and storing at-30deg.C in a refrigerator.
Preliminary positioning of a vegetable heart branch QTL candidate region:
(1) 3 pools of multi-branch phenotype (12-15 branches), few-branch phenotype (1-3 branches) and middle-branch phenotype (7-8 branches) are constructed, gradedPool-Seq sequencing is carried out on the three pools and two parents, DNA samples are broken into fragments with the length of 350bp through a fragmentation kit, and a library is built. The sequencing platform was NovaSeq (Illumina) and the sequencing mode was PE150.
(2) The original data are quality-controlled, reads are compared to a celery cabbage V3.0 reference genome (http:// brasicadb. Org/brad/datasets/pub/genome/brassica_rapa/V3.0 /) by using BWA, the comparison result is subjected to SAMTOOLS to remove repetition, mutation sites are analyzed according to the analysis flow of GATK, SNP and InDel information are obtained, and SNPeff is adopted to carry out structural annotation on the mutation sites.
(3) And carrying out Ridit inspection and analysis on the data, then carrying out noise reduction, and counting the proportion of the p-value significant sites to the total sites of the sliding window area, thereby judging the area with significant association with the character. The noise reduction parameter is window size 0.2Mb, and the p-value threshold is 10 -8. Finally, the region of 28.0-28.9 Mb of A07 chromosome is taken as a candidate QTL region, and the gene for regulating and controlling branching is positioned on the A07 chromosome (figure 4).
And according to SNP information, uniformly selecting SNP loci which have no other variation of 100bp before and after selection in a candidate interval, and then utilizing Primer 5 software to design primers to convert the SNP loci into KASP markers.
(1) KASP label of a 0716: forward primers (5 ' -3 ') SEQ ID NO.1 (GAAGGTGACCAAGTTCATGCTCCAACACAACCAGCCCTAT) and SEQ ID NO.2 (GAAGGTCGGAGTCAACGGATTCCAACACAACCAGCCCTAC) were ligated to FAM and VIC adaptor sequences at the 5' end, respectively, as their KASP Forward primers to detect polymorphisms of the major QBrTL1 closely linked tag, the single nucleotide tag (SNP) of A0716, respectively. The sequence of the common reverse primer (REVESER PRIMER,5 '-3') is SEQ ID NO.3 (AACGTATTAAATATTGGAATTGAA).
(2) KASP label of a 0717: forward primers (5 ' -3 ') SEQ ID NO.4 (GAAGGTGACCAAGTTCATGCTGATGTGCTTATTTATGTCCAC) and SEQ ID NO.5 (GAAGGTCGGAGTCAACGGATTGATGTGCTTATTTATGTCCAA) were ligated to FAM and VIC adaptor sequences at the 5' end, respectively, as their KASP Forward primers to detect polymorphisms of the major QBrTL1 closely linked tag, the single nucleotide tag (SNP) of A0716, respectively. The sequence of the common reverse primer (REVERSE PRIMER,5 '-3') is SEQ ID NO.6 (AAAACAACAAAAACATCCCCGCTCCG).
Genetic map construction and QTL localization:
PCR reaction System (1.6. Mu.L): DNA 0.8. Mu.L, 2X KASP MASTER mix + Assay 0.8. Mu.L.
PCR reaction procedure: pre-denaturation at 94℃for 15min; denaturation at 94℃for 20s and extension at 61-55℃for 60s, each cycle reduced by 0.6℃for a total of 10 cycles; denaturation at 94℃for 20s and extension at 55℃for 60s for 26 cycles.
Genotyping based on the KASP technique was performed using IntelliQube genotyping detection platform (LGC), and the genotype of F 2 plants was determined based on the fluorescent signal of the amplified product.
And carrying out linkage analysis on KASP marker genotype and phenotype data of the F 2 population by using QTL ICIMAPPING 4.2.2 software to construct a molecular marker genetic linkage map near the target site on the A07 chromosome.
Based on the genetic map, genotype data for the F 2 population, and branching phenotype data, QTL detection was performed using QTL ICIMAPPING 4.2.2 software to detect a major QTL site (table 1, fig. 5).
TABLE 1 essential information on the major QTL locus of a branch on the A07 chromosome
The KASP molecular marker of the main effect QTL of the heart branches and the application thereof are developed by exploring the close linkage marker of the main effect QTL of the heart branches, and the KASP molecular marker primer can identify the heart genotypes of filial generations and can meet the requirements of molecular breeding.
Sequence listing
Sequence listing
Although the invention has been described hereinabove with reference to embodiments, various modifications thereof may be made and equivalents may be substituted for elements thereof without departing from the scope of the invention. In particular, the features of the disclosed embodiments may be combined with each other in any manner as long as there is no structural conflict, and the exhaustive description of these combinations is not given in this specification merely for the sake of omitting the descriptions and saving resources. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed, but that the invention will include all embodiments falling within the scope of the appended claims.
Claims (2)
1. KASP molecular marker primer group of main effect QTL of heart of dish branching trait, its characterized in that: the primer group consists of a KASP molecular marker primer of A0716 and a KASP molecular marker primer of A0717:
The KASP molecular marker primer sequence of A0716 is shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3;
The KASP molecular marker primer sequence of A0717 is shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.
2. The use of the molecular marker primer set of the main effect QTL of the heart branching trait of claim 1 in multi-branch heart breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210580254.XA CN114836569B (en) | 2022-05-26 | 2022-05-26 | KASP molecular marker of main effect QTL of heart branching character and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210580254.XA CN114836569B (en) | 2022-05-26 | 2022-05-26 | KASP molecular marker of main effect QTL of heart branching character and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114836569A CN114836569A (en) | 2022-08-02 |
| CN114836569B true CN114836569B (en) | 2024-05-17 |
Family
ID=82572709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210580254.XA Active CN114836569B (en) | 2022-05-26 | 2022-05-26 | KASP molecular marker of main effect QTL of heart branching character and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114836569B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117344045B (en) * | 2023-09-13 | 2024-07-12 | 广东省农业科学院蔬菜研究所 | Cabbage core KASP molecular marker developed based on whole genome resequencing and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102144560A (en) * | 2011-02-22 | 2011-08-10 | 沈阳农业大学 | Method and application method for obtaining novel germ plasm of brassica A genome vegetable |
| CN109182592A (en) * | 2018-11-08 | 2019-01-11 | 中国农业科学院油料作物研究所 | Chain SNP marker and application with rape multi-branched character main effect QTL site |
| CN114164294A (en) * | 2021-12-08 | 2022-03-11 | 沈阳农业大学 | SNP site related to green-keeping property of Chinese cabbage and application thereof |
-
2022
- 2022-05-26 CN CN202210580254.XA patent/CN114836569B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102144560A (en) * | 2011-02-22 | 2011-08-10 | 沈阳农业大学 | Method and application method for obtaining novel germ plasm of brassica A genome vegetable |
| CN109182592A (en) * | 2018-11-08 | 2019-01-11 | 中国农业科学院油料作物研究所 | Chain SNP marker and application with rape multi-branched character main effect QTL site |
| CN114164294A (en) * | 2021-12-08 | 2022-03-11 | 沈阳农业大学 | SNP site related to green-keeping property of Chinese cabbage and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114836569A (en) | 2022-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110592251A (en) | Development and application of major QTL (quantitative trait locus) and SNP (Single nucleotide polymorphism) molecular marker for flowering phase characters of brassica napus | |
| CN112195265B (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of pepper hybrid and application | |
| WO2023208078A1 (en) | Genome structure variation for regulating tomato fruit soluble solid content, related product, and application | |
| CN111979349A (en) | Major QTL and SNP molecular markers for controlling lotus flower color characters as well as detection primers and application thereof | |
| CN114717355A (en) | Watermelon whole genome SNP-Panel | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| CN114836569B (en) | KASP molecular marker of main effect QTL of heart branching character and application thereof | |
| CN115852032A (en) | Gene related to cowpea pod color, KASP marker and application thereof | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN113881801A (en) | Molecular marker composition with tightly linked dark green stem characters of American pumpkin and application thereof | |
| CN117965781A (en) | Peanut 40K liquid-phase SNP chip 'PeanutGBTS K' and application thereof | |
| CN110527739B (en) | Major QTL (quantitative trait locus) site of glucosinolate content of brassica napus seeds, SNP (Single nucleotide polymorphism) molecular marker and application thereof | |
| CN112575102A (en) | Main effect QTL for controlling lotus seed heart skin number, SNP molecular marker, KASP detection primer group and application | |
| CN110055350B (en) | SNP molecular marker and primer for identifying apple fruit ester flavor character and application thereof | |
| CN107475413A (en) | One kind screening improves unrighted acid C20:The related SNP of the method for the long oyster of the contents of 3 Ω 6 primer pair | |
| CN115927733B (en) | Molecular marker and application thereof | |
| CN107267504B (en) | SNP (Single nucleotide polymorphism) marker for identifying pear pulp high stone cell content based on high resolution dissolution curve and application of SNP marker | |
| CN110819732A (en) | Homozygous SNP molecular marker with plum blossom drooping branch character close linkage as well as detection method and application thereof | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters | |
| CN107354234A (en) | A kind of primer pair of the method for being used to screen the high glycogen content parent shellfish of long oyster and its related SNP mark | |
| CN113604587A (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN115707783A (en) | Rape whole genome SNP-Panel development method and breeding application | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |