CN1148194C - New use of polyunsaturated lecithin - Google Patents
New use of polyunsaturated lecithin Download PDFInfo
- Publication number
- CN1148194C CN1148194C CNB001087436A CN00108743A CN1148194C CN 1148194 C CN1148194 C CN 1148194C CN B001087436 A CNB001087436 A CN B001087436A CN 00108743 A CN00108743 A CN 00108743A CN 1148194 C CN1148194 C CN 1148194C
- Authority
- CN
- China
- Prior art keywords
- lecithin
- growth factor
- poly
- vascular endothelial
- endothelial growth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Abstract
The present invention provides a new purpose of polyunsaturated phosphatidylcholine in the preparation of an inhibitor expressed by a vascular endothelial growth factor, particularly a new purpose in the preparation of a preparation for treating liver diseases. The inhibitor expressed by a vascular endothelial growth factor containing the polyunsaturated phosphatidylcholine can obviously reduce the expressing level of a vascular endothelial growth factor excited in a damaged liver tissue so as to inhibit the blood vessel hyperplasia of a liver tissue.
Description
The present invention relates to the polyunsaturated lecithin purposes of (Poly unsaturatedPhosphatidyl Choline is called for short PPC), relate in particular to its purposes in pharmaceutical field.
Polyunsaturated lecithin is from the composition that Semen sojae atricolor is extracted and purification obtains is various but the mixture of the polyene phosphatidylcholine that composition is clearly demarcated (or claiming polyenoid lecithin).The unsaturated lecithin of poly is the multinational chronic hepatopathy that goes through to be used for treating in West Europe.
Contain the phosphatidylcholine of 72-76% and the phospholipid of 24-28% in the unsaturated lecithin of poly, two main compositions are dilinoleic acid phosphatidylcholine (32-42%) and Palmic acid-linoleic acid phosphatidylcholine (18-19%) in the phosphatidylcholine of 72-76%.
Have report to point out that the unsaturated lecithin of poly is effective in cure to the hepatic fibrosis and the liver cirrhosis that are caused by ethanol in the baboon monkey, its mechanism of action is decomposition (Lieber CS. etc., Gastroenterology, 1994,106 (1): 152-9) that promote collagen.
Also have report to point out, VEGF (Vascular EndothelialGrowth Factor, abbreviation VEGF) overexpression causes the gathering of tangible hepatocarcinoma development and new vessels, and the degree of tumor propagation is relevant with the expression of vascular endothelial growth factor gene.The inhibition of vascular endothelial growth factor expression is contained already present tumor growth, and irrelevant with the size of original tumor.These results show that VEGF plays a part crucial (Yoshi ji in the hepatoma carcinoma cell development relevant with endotheliocyte, H. etc., Vascularendothclial growth factor tightly regulates in vivo developmentof murine hepatocellular carcinoma cells, Hepatology 28 (6): 1489-96 (1998)).
The inventor etc. have carried out deep research to the expression that the unsaturated lecithin of poly suppresses VEGF, found that, the unsaturated lecithin of poly can effectively suppress the expression of VEGF, and and then to the treatment and prevention of liver disease effective, thereby finished the present invention.
The object of the present invention is to provide the new purposes of the unsaturated lecithin of poly, i.e. new application in pharmacy.
More particularly, the invention provides the purposes of the unsaturated lecithin of poly in the preparation inhibitor of vascular endothelial growth factor expression, purposes in the preparation therapeutic agent for liver disease, and contain inhibitor of vascular endothelial growth factor expression and the therapeutic agent for liver disease of the unsaturated lecithin of poly as effective ingredient.
For understanding the present invention better, below provide concrete experimental example and formulation example the present invention is described, but content of the present invention is not limited thereto.
Experimental example
1. (Cologne, Germany) the unsaturated lecithin of poly of company's production is shown in its table 1 composed as follows by Rhone-Poulenc Rorer GmbH for the employing of experiment medicine.
The composition of table 1:PPC
| Lecithin (PC) | 72％-76％ |
| Wherein contain: | |
| Dilinoleic acid lecithin (18: 2-18: 2) | 32％-42％ |
| Palmic acid-linoleic acid lecithin (16: 0-18: 2) | 18％-19％ |
| Oleic acid-linoleic acid lecithin (18: 1-18: 2) | 9％-10％ |
| Linolenic acid-linoleic acid lecithin (18: 3-18: 2) | 5％-6％ |
| Stearic acid-linoleic acid lecithin (18: 0-18: 2) | 5％ |
| Palmic acid-oleic acid lecithin (16: 0-18: 1) | 2％-3％ |
| Stearic acid-arachidonic acid lecithin (18: 0-20: 4) | 1％-2％ |
2. the form of experimental animal model
Use 8 mices (C57B6 system), intravenous injection dextrorotation galactosamine by per kilogram of body weight injection 2 grams, becomes the inductive hepatitis mice of dextrorotation galactosamine.
In the hepatitis mice model that in above-mentioned 2, obtains of check the unsaturated lecithin of poly to the inhibitory action of vascular endothelial growth factor expression
Above-mentioned 8 hepatitis mices are divided into 2 groups, 4 every group.Wherein 4 mices are accepted the dextrorotation galactosamine, and other 4 feeds contain the food of the unsaturated lecithin of poly, and the food-intake that makes the unsaturated lecithin of poly every day is between 0.5～1.0 milligram.After five days,, therefrom extract whole RNA, be used for the quantitative RT-PCR analysis with the liver excision one leaf liver of part liver resection from every mice.
The concentration of regulating RNA is to OD
260Be 0.1, the RNA with this concentration does quantitative RT-PCR on PE7700 Sequence Detection instrument then.
For this reason, design one couple of PCR primers and an oligonucleotide fluorescent probe that is applicable to PE7700 Sequence Detection instrument.The sequence of 3 ' primer that its primer is right is: 5 ' TCGGTGTTCCCAAAACTG-3 ', the sequence of 5 ' primer is: 5 '-TTTTTTGTCCCACTTGGT3 ', the sequence of oligonucleotide fluorescent probe is: fluorescent labeling-5 '-TCCCCTGCCCAAGAATGTGC-3 '-fluorescence buries in oblivion.The sequence in rake site is the part of VEGFcDNA sequence, promptly 5 '-TTTTTTGTCCCACTTGGTGGGGCCAGGGTCCTCTCCCCTGCCCAAGAATGTGCAAG GCCAGGGCATGGGGGCAAAATATGACCCAGTTTTGGGAACACCGACA-3 '.
In this experiment, VEGF cDNA whenever duplicates once, and Taq DNA synzyme utilizes its excision enzyme effect to cut fluorescence molecule on the next probe primer, comes quantitative RT-PCR with this.At the RT-PCR experiment initial stage, infer the initial amount of VEGF RNA according to the fluorescent emission amount.Like this, we can compare the difference of two groups of experiment mices.
As shown in drawings, the difference of two groups of mice Δ CT is 3.1, and the VEGF signal that is equivalent to the unsaturated lecithin treatment of poly group has reduced 10 times.These data illustrate that effectively the unsaturated lecithin of poly can reduce the VEGF level of hepatic tissue significantly, suppress the blood vessel hyperplasia of hepatic tissue.
Formulation example: capsule
Use by Rhone-Poulenc Rorer GmbH (Cologne, Germany) the unsaturated lecithin of poly produced of company is made soft capsule by well-established law, every soft capsule contains the unsaturated lecithin of 0.18g poly.
Description of drawings
Fig. 1 is with the contrast figure of PPC treatment and not treatment group in the inductive hepatitis mice of dextrorotation galactosamine.Abscissa is represented the cycle-index of RT-PCR reaction among the figure, and vertical coordinate is represented the copy number of fluorescently-labeled Messenger RNA (mRNA).
Claims (3)
1. the unsaturated lecithin of poly is in the purposes of preparation in the inhibitor of vascular endothelial growth factor expression.
2. according to the purposes of claim 1, wherein said inhibitor of vascular endothelial growth factor expression is used to prepare the medicine for the treatment of hepatic disease.
3. according to the purposes of claim 2, wherein said hepatic disease is a hepatocarcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001087436A CN1148194C (en) | 2000-06-02 | 2000-06-02 | New use of polyunsaturated lecithin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001087436A CN1148194C (en) | 2000-06-02 | 2000-06-02 | New use of polyunsaturated lecithin |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2003101198986A Division CN1518987A (en) | 2000-06-02 | 2000-06-02 | Now usage of polyunsaturated phosphatidylcholine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1326744A CN1326744A (en) | 2001-12-19 |
| CN1148194C true CN1148194C (en) | 2004-05-05 |
Family
ID=4579284
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB001087436A Expired - Fee Related CN1148194C (en) | 2000-06-02 | 2000-06-02 | New use of polyunsaturated lecithin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1148194C (en) |
-
2000
- 2000-06-02 CN CNB001087436A patent/CN1148194C/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN1326744A (en) | 2001-12-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zellweger et al. | Antitumor activity of antisense clusterin oligonucleotides is improved in vitro and in vivo by incorporation of 2′-O-(2-methoxy) ethyl chemistry | |
| Masamune et al. | Inhibition of p38 mitogen-activated protein kinase blocks activation of rat pancreatic stellate cells | |
| McCartney-Francis et al. | Selective inhibition of inducible nitric oxide synthase exacerbates erosive joint disease | |
| Cho et al. | Ascofuranone suppresses PMA-mediated matrix metalloproteinase-9 gene activation through the Ras/Raf/MEK/ERK-and Ap1-dependent mechanisms | |
| Punch et al. | Opposite modulation of opiate withdrawal behaviors on microinfusion of a protein kinase A inhibitor versus activator into the locus coeruleus or periaqueductal gray | |
| CA2566436C (en) | Phosphoinositide 3-kinase delta selective inhibitors for inhibiting angiogenesis | |
| KR0171210B1 (en) | Antisense oligonucleotide for treatment of cancer | |
| Kim et al. | Inhibition of angiogenesis and angiogenesis-dependent tumor growth by the cryptic kringle fragments of human apolipoprotein (a) | |
| NAGLER et al. | The effect of halofuginone, an inhibitor of collagen type I synthesis, on urethral stricture formation: in vivo and in vitro study in a rat model | |
| JP2005508947A (en) | Inhibition of STAT-1 | |
| JPH10500657A (en) | Curcumin, curcumin analogs, and their new uses | |
| MX2010009346A (en) | Microrna (mirna) and downstream targets for diagnostic and therapeutic purposes. | |
| JP2005314381A (en) | Prophylactic/therapeutic/ameliorating agent for proliferative nephropathy | |
| CN108686210A (en) | A kind of drug and therapy for treating fatty liver | |
| KR20080071598A (en) | Fatty acid analogues for the treatment of cancer | |
| Velázquez et al. | Butyrate inhibits seeding and growth of colorectal metastases to the liver in mice | |
| WO2016163082A1 (en) | Prophylactic/therapeutic agent for virus infections which comprises ala compound | |
| CN114504637A (en) | Application of GSDMD inhibitor in atherosclerosis | |
| CN1148194C (en) | New use of polyunsaturated lecithin | |
| US20240024276A1 (en) | Compositions and methods for improving cardiac structure and/or function | |
| CN1518987A (en) | Now usage of polyunsaturated phosphatidylcholine | |
| WO2022105903A1 (en) | Sirna for treating hepatic fibrosis and delivery preparation thereof | |
| JP4510451B2 (en) | Regulation of STAT-1-dependent gene expression | |
| CN1313159C (en) | Hab18G/CD147 molecule small segment interfering RNA medicine and application thereof | |
| JP2011055755A (en) | Obesity suppression by expression inhibition of mxd3 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: GR Ref document number: 1040639 Country of ref document: HK |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20040505 |