CN114807227A - Chicken fibroblast line with antiviral protein Mx gene knocked out and construction method thereof - Google Patents

Abstract

The invention relates to the technical field of gene editing, in particular to a chicken fibroblast line with a knockout antiviral protein Mx gene and a construction method thereof, and the chicken fibroblast line comprises the following steps: s1, selecting a target and designing and synthesizing sgRNA; s2, constructing a pLentiCRISPR-Mx-sgRNA vector; s3, screening positive clones by puromycin; s4, processing lentivirus and carrying out enzyme digestion detection on T7E 1; s5, screening monoclonal cell strains, successfully constructing a CRISPR/Cas9 recombinant vector of a chicken Mx gene edited by a target spot, realizing Mx gene targeted editing of chicken fibroblast DF-1, obtaining an Mx gene knockout cell line, and providing experimental materials and basic data for the subsequent Mx protein antiviral mechanism research.

Description

Chicken fibroblast line with antiviral protein Mx gene knocked out and construction method thereof

Technical Field

The invention relates to the technical field of gene editing, in particular to a chicken fibroblast line with a knockout antiviral protein Mx gene and a construction method thereof.

Background

With the rapid development of gene editing tools such as CRISPR/Cas9 and the like in recent years, efficient targeted gene editing has been realized at present by targeting different genes, and the gene editing tool is widely applied to the construction of avian cell lines so as to research the susceptibility of hosts to specific pathogens and the interaction of specific genes in the hosts and the pathogens.

DF-1 cell is an immortalized chicken fibroblast cell line, which has been widely used to study the interaction between avian pathogens and avian hosts, such as influenza A virus, Newcastle disease virus, infectious bursal disease virus and retroviruses. The Mx protein is used as one of antiviral proteins generated by I-type interferon induction, has broad-spectrum antiviral activity, especially plays an important role in inhibiting negative strand RNA viruses, obtains chicken cells modified by the Mx gene, and is helpful for providing materials for the research of Mx gene antiviral mechanisms.

In the study of the antiviral mechanism of Mx gene, DF-1 has not only Mx gene alone, so that it is difficult to perform single variable study on the antiviral mechanism of Mx gene, resulting in slow progress of the study.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a chicken fibroblast line with a knockout antiviral protein Mx gene and a construction method thereof, so that the research on an antiviral mechanism of the Mx gene is facilitated

In order to solve the technical problems, the invention provides the following technical scheme:

a method for constructing a chicken fibroblast line with a knockout antiviral protein Mx gene is characterized by comprising the following steps:

s1, selecting a target and designing and synthesizing sgRNA;

s2, constructing a pLentiCRISPR-Mx-sgRNA vector;

s3, screening positive clones by puromycin;

s4, processing lentivirus and carrying out enzyme digestion detection on T7E 1;

s4, screening monoclonal cell strains.

Preferably, the sgRNA includes sgRNA1, sgRNA2, sgRNA3, and sgRNA4, which are in sequence:

sgRNA1：GTGATTGGAGACCGGAACTC；

sgRNA2：TACTTGCTCCCTACAAGGAG；

sgRNA3：GCGTTTACTTGCTCCCTACA；

sgRNA4：AAAGTCTACCAGGTATTGGT。

preferably, the step S2 includes the following steps:

A. the pLentiCRISPR v2 skeleton vector is enzyme-cut;

B. and recovering the linearized pLentiCRISPR v2 skeleton vector after enzyme digestion, and connecting the linearized pLentiCRISPR v2 skeleton vector with the annealed sgRNA double strand.

Preferably, the pLentiCRISPR v2 backbone vector is cleaved enzymatically using BsmBI enzyme.

Preferably, in step B, the linking system comprises: 5 μ L of Ligation solution, 1 μ L of double-stranded sgRNA, 2 μ L of linearized pLentiCRISPR v2 vector, 1 μ L of Ligation solution C.

Preferably, the ligation system is supplemented to 10. mu.L with ddH 2O.

Preferably, in step B, the connection procedure is: overnight ligation, followed by transformation of the ligation products into DH 5. alpha. competent cells, addition of the ligation products to 100. mu. LDH 5. alpha. competent cells, ice bath for 30min, heat shock at 42 ℃ for 90s in a water bath, placing the ligation products on ice for 2min, addition of 1mL of antibiotic-free LB liquid medium 37 ℃ and incubation at 80rpm for 1h, plating onto LB solid plates containing ampicillin, and overnight culture.

Preferably, the step S4 includes expanding the cells after puromycin screening, collecting the cells after cell subculture after lentivirus treatment, extracting the genome, and designing and amplifying corresponding target site primers for different target sites of the Mx gene.

Preferably, the primers comprise sgRNA1-PF, sgRNA1-PR, sgRNA2-PF, sgRNA2-PR, sgRNA34-PF, and sgRNA34-PR, and the 5 '-3' sequences thereof are respectively as follows:

sgRNA1-PF：GGTTGTTTGAGTCACTGAGCCA；

sgRNA1-PR：CAGTGTCCCACCTGCACATC；

sgRNA2-PF：AAGGTTAGCAGAGAGAGGGAGA；

sgRNA2-PR：ATTGGTAGGCTTTGTTGAGGTG；

sgRNA34-PF：AAATGGCCTGCCTTGGGTTT；

sgRNA34-PR：AGGTTGCTGCTAATGGAGGA。

the CRISPR/Cas9 recombinant vector for editing the chicken Mx gene by a target point is successfully constructed, Mx gene targeted editing of chicken fibroblast DF-1 is realized, an Mx gene knockout cell line is obtained, and experimental materials and basic data are provided for the subsequent Mx protein antiviral mechanism research.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a schematic diagram of Mx gene target design provided in the embodiments of the present invention;

fig. 2 is a schematic diagram of construction and verification of the pnenticrispr-Mx-sgRNA vector of the present invention, wherein (a): a plasmid map of pLentiCRISPR v 2; (B) the method comprises the following steps BsmB I enzyme digestion identification, M: DNA Marker DL15000, 1: LentiCRISPRV2 restriction enzyme original plasmid, 2: the restriction enzyme cutting result of the LentiCRISPR v2 plasmid BsmB I; (C) the method comprises the following steps Colony PCR identification, M: DNA Marker DL2000, 1-4, 7-10, 13-16, 19-22 colony PCR products, and the rest is blank control group; (D) the method comprises the following steps Sequencing comparison result of recombinant vector

FIG. 3 is a drawing of DF-1 cell lentivirus infection and puromycin screening of the present invention, NC: wild-type DF-1 cells; control: DF-1 cells infected with pLentiCRISPR v2 empty vector virus; sgRNA 1/2/3/4: DF-1 cells infected with the targeting vector virus;

fig. 4 is a graph showing the results of detecting the cleavage efficiency of the CRISPR/Cas9 mediating 4 targets in DF-1 cells according to the present invention, (a): DF-1 cell genome extraction, M: 1Kb DNA Ladder, 1-5: DF-1 cell genome band; (B) the method comprises the following steps Amplifying the target site sequence; m: DNA Marker DL2000, 1-8 is sgRNA1/2/3/4 target site amplification band; (C-D): the digestion result of T7E1 in DF-1 cells by 4 knockout vectors;

FIG. 5 is a diagram showing the screening of monoclonal cells of the present invention (5X);

FIG. 6 shows the sequencing peaks of the PCR product of the present invention, (A-C): sequencing peak diagrams of monoclonal cell strains with mutations at sgRNA1 target points;

FIG. 7 is a TA clone sequencing analysis chart of the knockout cell strain of the present invention;

FIG. 8 is a diagram of the effect of detecting Mx knock-out by WesternBlot of the present invention (A): detecting Mx protein expression by Western Blot; (B) the method comprises the following steps Protein gray level analysis quantization map; p < 0.01;

FIG. 9 is an observation of cytopathic effect of the present invention;

FIG. 10 is a graph of viral copy number detection according to the present invention.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to the following embodiments of the present invention, and it should be understood that the described embodiments are a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It will be understood that the terms "comprises" and/or "comprising," when used in this specification and the appended claims, specify the presence of stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.

It is also to be understood that the terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the specification of the present invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

It should be further understood that the term "and/or" as used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

The invention provides a chicken fibroblast line with a knocked-out antiviral protein Mx gene and a construction method thereof, and aims to construct a CRISPR/Cas9 recombinant vector with a target point for editing the chicken Mx gene, realize Mx gene targeted editing of chicken fibroblast DF-1, obtain an Mx gene knocked-out cell line and provide experimental materials and basic data for subsequent research on an Mx protein antiviral mechanism.

Based on the construction principle of a CRISPR/Cas9 system, 4 sgRNAs are designed on a chicken genome aiming at a chicken Mx gene, and CRISPR/Cas9 vectors targeting the chicken Mx gene are respectively constructed. The CRISPR lentivirus is obtained by using a three-plasmid lentivirus packaging system and infects DF-1 cells, puromycin enriches and screens positive cells, and T7E1 enzyme digestion verifies the knockout efficiency.

Subsequently, screening a gene editing positive monoclonal cell strain of a chicken Mx gene editing mixed cell obtained by infecting pLentiCRISPR-Mx-sgRNA1 lentivirus by using a limiting dilution method, and detecting a target gene knockout event of the monoclonal cell through PCR product sequencing and TA cloning; detecting the expression condition of Mx protein of the monoclonal cell strain by Western Blot; successfully screening to obtain 1 chicken Mx gene knockout DF-1 cell strain. Preliminarily exploring the effect of chicken Mx gene in anti-virus infection, treating DF-1-Mx-/-cells by Newcastle disease virus, and detecting the NDV virus copy number in the DF-1-Mx-/-cells by absolute fluorescent quantitative PCR.

Examples

1. Target selection and design and synthesis of sgRNA

The sgRNA sequence was designed using the online software CRISPOR (http:// cr. for. net /) according to the CDS sequence of chicken Mx gene provided by GenBank (GenBank accession No.: NC-052532). According to the website score, 4 targets are selected according to the figure 1, 4 sgrnas are designed according to the targets and named as sgRNA1, sgRNA2, sgRNA3 and sgRNA4 respectively, and the sequence information of the sgRNA target points is shown in table 1.

TABLE 1sgRNA target site sequence information

Construction of pLentiCRISPR-Mx-sgRNA vector

The method comprises the following steps of utilizing BsmBI I to cut a pLentiCRISPR v2 skeleton vector, finding two fragments appearing at about 13000bp and 1900bp through electrophoresis detection, recovering a linearized pLentiCRISPR v2 skeleton vector after cutting enzyme, and connecting the linearized pLentiCRISPR v2 skeleton vector with an annealed sgRNA double chain, wherein the connecting body is as follows: ligation solution A: 5 mu L of the solution; double-stranded sgRNA: 1 mu L of the solution; linearized pLentiCRISPR v2 vector: 2 mu L of the solution; ligation solution C: 1 mu L of the solution; ddH2O to 10. mu.L, the ligation procedure was: ligation was performed overnight at 16 ℃. The ligation product was subsequently transformed into DH 5. alpha. competent cells, the ligation product was added to 100. mu. LDH 5. alpha. competent cells, ice-bathed for 30min, heat-shocked in a water bath at 42 ℃ for 90s, the ligation product was left on ice for 2min, added to 1mL of antibiotic-free LB liquid medium 37 ℃ and incubated at 80rpm for 1h and spread onto LB solid plates containing ampicillin, and cultured overnight at 37 ℃.

3. Identification of pLentiCRISPR-Mx-sgRNA vector

And (4) selecting a single clone to perform colony PCR identification. As shown in FIG. 2C, the bands with the theoretical size of 256bp appeared by electrophoresis detection. And (3) carrying out amplification culture on the positive colonies to extract plasmids, and carrying out sequencing identification, wherein the result shows that the target sequences are successfully inserted into the targeting vector, as shown in figure 2D. 4 targeting vectors are obtained and named as pLentiCRISPR-Mx-sgRNA1, pLentiCRISPR-Mx-sgRNA2, pLentiCRISPR-Mx-sgRNA3 and pLentiCRISPR-Mx-sgRNA 4.

4. Puromycin screening positive clone

When the growth density of the DF-1 cells reaches 70%, the DF-1 cells are infected by a lentivirus concentrated solution carrying a pLentiCRISPR-Rv 2 empty vector and 4 pLentiCRISPR-Mx-sgRNA targeting vectors, the cell morphology is observed, and the growth condition of the DF-1 cells before the lentivirus infection is good as shown in figure 3. After 24h, the medium containing 2 mug/mL puromycin is replaced to continuously screen for 3-7d, and positive cells are enriched. As the time for puromycin screening increases, there are a lot of dead cells in virus-infected DF-1 cells, and the screening is finished by replacing the culture medium without puromycin for amplification with reference to the death of all cells in the NC group (wild type DF-1 cells).

T7E1 enzyme digestion detection targeting efficiency

Expanding and culturing the cells after screening puromycin, taking DF-1 cells infected with pLentiCRISPRRv 2 empty vector recombinant lentivirus as a control group, taking DF-1 treated by CRISPR/Cas9 recombinant lentivirus corresponding to 4 targets as an experimental group, collecting the cells after subculturing the cells, referring to fig. 4A, extracting the genome, designing and amplifying corresponding target site primers by using Primer 5.0 software aiming at different target sites of an Mx gene, taking the genome in fig. 4A as a template, carrying out PCR amplification on the fragment of the knocked target site, wherein the reaction system is as follows: 2 × Taq PCRMasterMix: 25 mu L of the solution; sgRNA-PF: 2 mu L of the solution; sgRNA-PR: 2 mu L of the solution; gDNA: 300 ng; the ddH2O is supplemented to 50 mu L, the reaction program is 95 ℃, and the reaction time is 5 min; at 95 ℃ for 30 s; 30s at 55 ℃; 72 ℃ for 40 s; 34 cycles, 72 ℃, 5 min; storing at 12 deg.C.

Referring to fig. 4B, the results show that single bright bands consistent with theoretical sizes of 652bp, 499bp, 584bp, and 584bp are amplified, the PCR product purified by the full-scale gold gel recovery kit (cat No. eg101) is denatured and annealed to form heteroduplex DNA, the T7E1 enzyme digestion detection is performed, the PCR product is detected by 2% agarose gel electrophoresis, and referring to fig. 4C and 4D, the results show that bands with theoretical sizes, a sirna 1 target (390bp +262bp), a sgRNA2 target (284bp +215bp), a sgRNA3 target (bp +323bp), and a sgRNA4 target (468bp +116bp) are obtained by cutting at four target positions. Carrying out gray level analysis on the cut strips by using Image J software, and calculating the targeting efficiency according to a formula, wherein the formula of the targeting efficiency is as follows: fcut ═ (b + c)/(a + b + c) and Indels (%) (1- (1-fcut)1/2) × 100%, where a: uncut band gray values, b and c: the cut produces a new band gray value. After calculation, the targeting efficiency of the CRISPR/Cas9 recombinant lentiviral vector corresponding to the 4 targets on Mx genes in DF-1 cells is 20.7%, 23.1%, 23.7% and 27.8% respectively.

TABLE 2 amplification primer sequences for target sites

6. Screening of monoclonal cell lines

And (3) screening monoclonal cell strains by using a limiting dilution method for Mx gene knockout mixed cells obtained at the early stage. Dividing 1-2 treated cells into 96-well plates per well, marking culture wells containing only single cells, and observing the growth condition of the cells in real time. As shown in fig. 5, 4 cell colonies grown from single cells were randomly selected from a 96-well plate, and subsequently, a well-grown monoclonal cell line was expanded and co-screened to obtain 40 monoclonal cell lines.

7, sequencing and identifying the gene knockout cell strain by using the PCR product

Extracting 40 monoclonal cell strain genome DNA as a template, and performing PCR amplification on a sgRNA1 target spot by using a sgRNA1 target spot amplification primer in a table 2, wherein the reaction system is as follows: 2 × Taq PCR Master Mix: 25 mu L of the solution; sgRNA 1-PF: 2 mu L of the solution; sgRNA 1-PR: 2 mu L of the solution; gDNA: 300 ng; the ddH2O is supplemented to 50 mu L, the reaction program is 95 ℃, and the reaction time is 5 min; at 95 ℃ for 30 s; 30s at 55 ℃; 72 ℃ for 40 s; 34 cycles, 72 ℃, 5 min; storing at 12 deg.C. The PCR product is used for sequencing after being purified and recovered, whether the sgRNA1 target site has gene mutation or not is preliminarily identified, and the sequencing is completed by the bioscience technology company of Zexi, department of Western Amphintechnology.

The sequencing results of the PCR products were analyzed, and as shown in fig. 6, the target position of sgRNA1 of multiple sample PCR products was shown as a normal peak upstream and a nested peak downstream. Counting the sequencing result, wherein the target gene of 7 strains of cells is mutated near a sgRNA1 target spot, and the number of integral multiples of 3 of the base numbers of the three monoclonal cell strains of No. 3, No. 29 and No. 38 are deleted respectively; no. 17, No. 22, No. 25 and No. 36 four monoclonals are subjected to non-three-integer multiple deletion, and the target positions of the other 33 monoclonals are not mutated. Based on the method, the subsequent verification is carried out only on the monoclonal cell strains with non-integral multiple of base number and deletion event of 3, and the cell strains without mutation and with integral multiple of base number and mutation of deletion event of 3 are abandoned.

Note: (A-C): sequencing peak diagram of monoclonal cell strain with mutation at sgRNA1 target point

TA cloning, sequencing and analysis of indels of Mx Gene

Cloning a mutation sample PCR product TA identified by primary sequencing to a pEASY-T1 carrier for connection and transformation, coating the mutation sample PCR product TA on a plate containing IPTG and X-gal ampicillin, culturing overnight at 37 ℃, randomly selecting 10 white monoclonals from each plate for colony PCR verification, carrying out amplification culture on positive clones, and then sending a bacterium solution for sequencing and identification by taking M13F as a primer.

Comparing the sequencing result with the wild type gene sequence, as shown in FIG. 7, the 17# monoclonal one sample fails to sequence, 2bp of 4 sample target positions are deleted, and 41bp of large fragment deletion occurs at 5 sample target positions; the sequencing of two 22# monoclonal samples fails, 19bp fragment deletion occurs at the target positions of 5 samples, and 1bp deletion occurs in 3 samples; 1 # monoclonal 25 sample fails to be sequenced, 1bp of 6 sample target positions is deleted, and a c base is inserted into two sample target positions; no mutation at the target site of a sample; two 36# monoclonal samples failed sequencing, 4 samples were deleted by 15bp, and 4 samples were deleted by 64bp large fragment.

In conclusion, the No. 17 and No. 22 monoclonal cells have 2 gene mutation types, and are all deleted in non-integral multiple of three, so that the gene is subjected to frameshift mutation, and Mx protein cannot be expressed, and 2 Mx gene knockout DF-1 monoclonal cells are successfully screened and obtained and are respectively named as DF-1-17# and DF-1-22 #.

9. Mx protein expression detection result in monoclonal cell strain

In order to detect the knock-out effect of Mx genes in 2 monoclonal cell strains, DF-1-Cas9 cells and DF-1-17# and DF-1-22# monoclonal cells are treated by NDV F48E9 virus, total cell proteins are extracted after 24 hours, and the expression conditions of the Mx proteins in three cells are detected by WesternBlot. As shown in FIG. 8, after inoculation of virus, DF-1-Cas9 cells contained 76kDa band, DF-1-17# monoclonal cells contained no band, DF-1-22# monoclonal cells contained weak Mx protein band, indicating that there are wild-type DF-1 cells in DF-1-22# monoclonal cells, but no Mx protein in DF-1-17# monoclonal cells was expressed (P <0.01), therefore DF-1-17# monoclonal cells were selected for subsequent experiments and named DF-1-Mx-/-.

Phenotypic observation of cells after NDV infection

The cytopathic conditions of the groups were observed at different time intervals after NDV treatment of DF-1-Cas9 cells and DF-1-Mx-/-cells, and the results are shown in FIG. 9, wherein the solid line circle is normal cells and the dotted line circle is diseased cells, and typical cytopathic effects such as cell gap enlargement, cell fusion, syncytium formation and the like of the two groups of cells occurred 12h after NDV treatment. Compared with DF-1-Cas9 cells, the DF-1-Mx-/-cells have more diseased cells, multiple cells are broken under the same visual field, the number of syncytia is larger, the volume is larger, two groups of cells generate a large number of multinuclear giant cells in 36h, a monolayer of cells are damaged, the cells are separated from the bottom of the dish, and the result shows that the cell diseases are aggravated due to the deletion of Mx genes in the DF-1 cells.

Mx knockout to reduce the anti-NDV capacity of chicken fibroblasts

In order to research the influence of Mx gene knockout in DF-1 cells on virus infection, NDV copy number in supernatants of DF-1-Cas9 cells and DF-1-Mx-/- cells 12h, 24h and 36h after NDV virus treatment is detected by using an established fluorescent quantitative PCR method. As shown in FIG. 10, the number of virus copies was the largest in the supernatants of both cells 24h after NDV infection, 3.2X 107copies/mL and 6.5X 107copies/mL, respectively, and the number of viruses decreased after 36 h. Further comparison shows that the virus copy number of the supernatant of the Mx gene knockout cell in 3 time periods is obviously higher than that of the control group (P <0.01), wherein the difference of 24h is the largest, and the DF-1 cell with the Mx gene knockout cell has weakened antiviral ability, so that the virus replication amount is increased.

The research successfully constructs a CRISPR/Cas9 recombinant vector of a chicken Mx gene edited by a target spot, realizes Mx gene targeted editing of chicken fibroblast DF-1, obtains an Mx gene knockout cell line, verifies that the antiviral ability of the Mx gene knockout cell is reduced through Newcastle disease virus infection, and provides experimental materials and basic data for the subsequent Mx protein antiviral mechanism research.

While the invention has been described with reference to specific embodiments, the invention is not limited thereto, and various equivalent modifications and substitutions can be easily made by those skilled in the art within the technical scope of the invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

Claims (10)

1. A method for constructing a chicken fibroblast line with a knockout antiviral protein Mx gene is characterized by comprising the following steps:

s1, selecting a target and designing and synthesizing sgRNA;

s2, constructing a pLentiCRISPR-Mx-sgRNA vector;

s3, screening positive clones by puromycin;

s4, processing lentivirus and carrying out enzyme digestion detection on T7E 1;

s5, screening monoclonal cell strains.

2. The method for constructing the antiviral protein Mx gene knockout chicken fibroblast line of claim 1, wherein the sgRNAs comprise sgRNA1, sgRNA2, sgRNA3 and sgRNA4, which have the sequences:

sgRNA1：GTGATTGGAGACCGGAACTC；

sgRNA2：TACTTGCTCCCTACAAGGAG；

sgRNA3：GCGTTTACTTGCTCCCTACA；

sgRNA4：AAAGTCTACCAGGTATTGGT。

3. the method for constructing chicken fibroblast line with a knocked-out antiviral protein Mx gene according to claim 1, wherein the step S2 comprises the following steps:

A. the pLentiCRISPR v2 skeleton vector is enzyme-cut;

B. and recovering the linearized pLentiCRISPR v2 skeleton vector after enzyme digestion, and connecting the linearized pLentiCRISPR v2 skeleton vector with the annealed sgRNA double strand.

4. The method for constructing a chicken fibroblast line with a knocked-out antiviral protein Mx gene according to claim 3, wherein the method comprises the following steps: the pLentiCRISPR v2 backbone vector was digested with BsmBI enzyme.

5. The method for constructing antiviral protein Mx gene knockout chicken fibroblast cell line according to claim 3, wherein in the step B, the linking system comprises: 5 μ L of Ligation solution A, 1 μ L of double-stranded sgRNA, 2 μ L of linearized pLentiCRISPR v2 vector, 1 μ L of Ligation solution C.

6. The method for constructing a chicken fibroblast line with a knocked-out antiviral protein Mx gene according to claim 5, wherein the method comprises the following steps: the ligation system was supplemented with ddH2O to 10. mu.L.

7. The method for constructing chicken fibroblast line with the knockout antiviral protein Mx gene in claim 3, wherein in the step B, the connection procedure is as follows: overnight ligation, followed by transformation of the ligation products into DH 5. alpha. competent cells, addition of the ligation products to 100. mu. LDH 5. alpha. competent cells, ice bath for 30min, heat shock at 42 ℃ for 90s in a water bath, placing the ligation products on ice for 2min, addition of 1mL of antibiotic-free LB liquid medium 37 ℃ and incubation at 80rpm for 1h, plating onto LB solid plates containing ampicillin, and overnight culture.

8. The method for constructing a chicken fibroblast line with a knocked-out antiviral protein Mx gene as claimed in claim 1, wherein: in step S4, the method includes expanding and culturing puromycin-screened cells, collecting the cells after cell subculture after lentivirus treatment, extracting the genome, and designing and amplifying corresponding target site primers for different target sites of the Mx gene.

9. The method for constructing a chicken fibroblast line with a knocked-out antiviral protein Mx gene according to claim 8, wherein the method comprises the following steps: the primers comprise sgRNA1-PF, sgRNA1-PR, sgRNA2-PF, sgRNA2-PR, sgRNA34-PF and sgRNA34-PR, and the 5 '-3' sequences of the primers are respectively as follows:

sgRNA1-PF：GGTTGTTTGAGTCACTGAGCCA；

sgRNA1-PR：CAGTGTCCCACCTGCACATC；

sgRNA2-PF：AAGGTTAGCAGAGAGAGGGAGA；

sgRNA2-PR：ATTGGTAGGCTTTGTTGAGGTG；

sgRNA34-PF：AAATGGCCTGCCTTGGGTTT；

sgRNA34-PR：AGGTTGCTGCTAATGGAGGA。

10. the antiviral protein Mx gene knocked-out chicken fibroblast line prepared by the process of claim 1.

Images