CN114807053B - Cat parvovirus neutralizing monoclonal antibody and application thereof - Google Patents

Abstract

The invention discloses a neutralizing monoclonal antibody of a cat parvovirus and application thereof, and relates to the technical field of bioengineering. The invention provides a hybridoma cell strain which is preserved in China center for type culture collection (China center for type culture Collection) in 5 months and 6 days of 2022, wherein the preservation address is China university of Wuhan, and the preservation number is CCTCCNO: C2022111. the invention also provides a feline parvovirus neutralizing monoclonal antibody which is secreted by the hybridoma cells and has a specific sequence shown in SEQ ID NO:1 and 2. The hybridoma cells can secrete and generate cat tiny neutralizing monoclonal antibodies, and the monoclonal antibodies are proved by in-vitro cell level neutralization tests and animal protective tests to have high neutralizing activity, can specifically treat FPV, are simple to prepare and convenient to operate, and have great significance for preventing and treating the diseases.

Description

Cat parvovirus neutralizing monoclonal antibody and application thereof

Technical Field

The invention relates to the technical field of bioengineering, in particular to a neutralizing monoclonal antibody of cat parvovirus and application thereof.

Background

Cat parvovirus (Feline panleukopenia virus, FPV), an old cat pestivirus, also known as feline panleukopenia virus, has clinical manifestations of sudden hyperthermia, intractable vomiting, diarrhea, dehydration and severe leukopenia, is highly contagious, with the highest morbidity and mortality in young animals, and cats of all ages can be infected, mainly with young cats under 1 year old. The young cats which are not vaccinated at the ages of 3-5 months are most susceptible, the infection rate can reach 70%, and the fatality rate is 50% -60%. The virus has a wide host range, including domestic and wild felines and some wild canines, such as raccoon and fox, except dogs, and is the most virulent virus with the widest range of parvovirus infections in meat animals at present.

FPV has strong resistance to external factors and can survive for at least one year at normal temperature. It also has the ability to withstand high temperatures (80 ℃ for 30 minutes) and low pH values (3.0). In cats infected with FPV, a large amount of virus is present in the faeces of the sick cat, including saliva, urine, faeces and vomit. FPV is extremely contagious, either by direct contact infection by a cat, or by mechanical transmission by litter, utensils, mites or humans as a vehicle, the primary portal of infection being through the gastrointestinal tract, and less commonly through inhalation of aerosolized viral particles into the respiratory tract.

Because FPV is extremely infectious, cats infected with FPV need to be kept separate from the feed, and the feed environment needs to be disinfected often to reduce the virus content in the environment. However, the disease is still caused by the immunization of young cats, so that effective treatment is necessary in addition to positive prevention. In addition to immunization and drug therapy, some auxiliary care methods such as fluid infusion (electrolyte and glucose supplementation), antibacterial and insect repellent, antiemetic and gastrointestinal tract protective agents, etc. are generally performed at present. Effective neutralizing antibody therapies have not been widely used in clinical cases.

Disclosure of Invention

The invention aims to provide a neutralizing monoclonal antibody for cat parvovirus and application thereof, which are used for solving the problems in the prior art.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a hybridoma cell strain which is preserved in China center for type culture collection (China center for type culture Collection) in 5 months and 6 days in 2022, wherein the preservation address is China, university of Wuhan, and the preservation number is CCTCC NO: C2022111.

the invention also provides a feline parvovirus neutralizing monoclonal antibody which is secreted by the hybridoma cells.

The invention also provides application of the monoclonal antibody in preparing a medicine for preventing or treating cat parvovirus.

The invention also provides a preparation method of the feline parvovirus neutralizing monoclonal antibody, which comprises the steps of injecting the hybridoma cells into the abdominal cavity of a mouse to obtain mouse ascites, and purifying to obtain the feline parvovirus neutralizing monoclonal antibody.

Further, the purification uses Protein A+protein G affinity chromatography.

The invention discloses the following technical effects:

the hybridoma cells can secrete and generate cat tiny neutralizing monoclonal antibodies, and the monoclonal antibodies are proved by in-vitro cell level neutralization tests and animal protective tests to have high neutralizing activity, can specifically treat FPV, are simple to prepare and convenient to operate, and have great significance for preventing and treating the diseases.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is an IFA assay at various time points after infection of cells with FPV isolates;

fig. 2 is a monoclonal antibody neutralization potency assay, wherein a: neutralization protection rate of ascites, B: neutralization protection ratio of antibody, C:50% neutralization protection potency;

FIG. 3 is a PCR assay of pre-infection experimental animal feces, where M:2000bp DNA Marker,1-6: fecal samples from 6 cats prior to infection;

FIG. 4 is a PCR assay of experimental animal feces after infection, wherein M:2000bp DNA Marker,1-17: a fecal sample;

FIG. 5 is a graph showing clinical symptoms and features of cats following infection with FPV, wherein FPV is the positive group, FP-9mAb is the treatment group, and Mock is the negative group;

FIG. 6 is a graph showing changes in clinical index of cats following FPV infection, wherein A-F are A: body temperature, B: body weight, C: clinical scoring, D: white blood cell count, E: survival rate, F: antibody dilution fold;

FIG. 7 is a view of a pathological section of a cat after infection with FPV;

FIG. 8 is histopathological changes (HE staining) of cats following FPV infection;

fig. 9 is the histopathological changes (immunohistochemistry) of cats following infection with FPV.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

In the following examples, FPV susceptible cells CRFK were purchased from China center for type culture Collection.

Example 1

1. Purification of feline parvovirus

(1) FPV-susceptible cells CRFK were cultured to a monolayer in 6-well plates, feline parvovirus was inoculated into CRFK, the culture broth was discarded after adsorption for 1-2h in a 37℃incubator, and the CRFK cells were washed three times with PBS. The addition of DMEM maintenance solution containing 2% fetal bovine serum was continued at 37 ℃ for stationary culture, and the proliferation of virus was confirmed by indirect immunofluorescence at different time points because cytopathic effect was difficult to observe, and as a result, as shown in fig. 1, it was found that the virus amount was the greatest at 60 hours, and then cells began to shed. Thus, the first generation culture was removed at 60h and repeatedly freeze-thawed 3 times between-80℃and normal temperature, centrifuged at 5000 rpm at 4℃for 15min, and the supernatant was taken out and packed into sterile EP tubes, which were the original toxin, designated as the P0 substitution.

(2) Plaque purification of the isolated virus: after homogenization of CRFK, cell density was adjusted to 1X 10 ⁵ And inoculating a 6-hole plate with each mL, preparing virus liquid when cells grow to a single layer, and carrying out ten times serial gradient dilution to obtain five dilutions of the virus liquid. Removing culture solution in the wells, washing the wells with PBS for 3 times, inoculating 800 μL of virus solution into each well, adsorbing at 37deg.C for 2 hr, and shaking the plate every 15min to make virus solution fullAdsorbing uniformly, absorbing and discarding the virus liquid after 2 hours, and washing with PBS for three times; preparing 2% agarose solution with low melting point, melting at 72deg.C, placing in a water bath at 42deg.C for Wen Daiyong, and preheating 2 XDMEM in a water bath at 37deg.C; mixing the above 2% low melting point agarose solution with 2 XDMEM maintaining solution (2% serum, 1% double antibody) at a ratio of 1:1, adding into each well, standing 6-well plate at room temperature for 10min for solidification, standing at 37deg.C for 5% CO after agarose solidification ₂ Culturing in an incubator. Lesions were observed after 24 and 36 hours, respectively; after plaque formation, the plaques were marked by light observation, picked up with a yellow gun head together with agar, and dissolved in a suitable amount of cell culture fluid for the next round of virus proliferation and purification. The process was repeated 3 times to obtain a strain of FPV virus.

2. Immunization of animals

6 week old BALB/c female mice were immunized with purified FPV virus as described above: 100 mu L of virus particles and equal volume of Freund's complete adjuvant are emulsified and then injected into the neck and back of a mouse at multiple points, the mice are immunized for a second time after 2 weeks, freund's incomplete adjuvant is used as the adjuvant, the method and the dosage are the same, eyelid blood collection is carried out after 1 week of double-immunity, serum is separated, and serum antibody titer is detected if the titer is the same>10 ⁴ And carrying out boosting immunization, carrying out third immunization when the requirement is not met, and carrying out boosting immunization by intraperitoneal injection 3 days before fusion after the serum antibody titer meets the requirement, wherein the immunization dose is 200 mu L.

3. Cell fusion and selective culture

The PEG cell fusion method is adopted: the immunized mice were euthanized after blood collection and immersed in 75% alcohol for 15min. The scissors cut off the abdominal skin, the sterile scissors forceps were taken to blunt off the abdominal skin, a set of instruments (flame passing) was replaced, the peritoneum was cut off, the instruments (flame passing) were replaced, the spleen was gently clamped, and the surrounding adhesion tissues were separated with the scissors. The spleen outer membrane was cut, placed in a cell strainer (40 μm), crushed and filtered into a 50mL centrifuge tube, the strainer was washed with 1640, the filtrate was similarly filtered into the centrifuge tube, and the centrifuge tube was labeled to collect spleen cells. SP2/0 cells of a T75 cell flask were washed with 1640, then 10mL 1640 was added to the flask to tap the cells, then the other cells on the wall were gently blown down with a pipette, added to a 50mL empty centrifuge tube, then 10mL 1640 was added to the flask to wash, and collected in a 50mL centrifuge tube. Centrifuge tubes labeled collection SP 2/0. Centrifuging two centrifuge tubes filled with spleen cells and SP2/0 at room temperature of 1200r/min for 10min, and respectively discarding the supernatant; then 2mL 1640 was added separately and resuspended (motion must be light) with a 2mL pipette, 40mL 1640 was added separately, centrifuged, and the supernatant discarded; each tube was lightly resuspended in 1-2mL 1640 and the two cells were mixed into a centrifuge tube, then supplemented with about 1640 to 40mL, centrifuged and the supernatant discarded. The tube is tilted downward to draw excess fluid from the tube wall (which would otherwise affect the PEG concentration). The bottom of the tube is rubbed on the hand until the cells are in the form of porridge (the cell liquid flows down when tilting). The centrifuge tube was placed in a 37℃water bath, and PEG (0.8 mL) was pipetted for 1min, and the centrifuge tube was shaken while the centrifuge tube was added, and the addition was completed in 1 min. Stirring was continued for one minute. Terminating the reaction: taking a centrifuge tube filled with 40mL 1640, adding 1mL 1640 in 1min, adding 1mL 1640 in 2min, stirring while adding 1mL for three groups of 3-4min every 40s, adding 5mL for 5min and 12s, and finally adding the rest 30mL 1640 at a constant speed by using a pipette; placing in a 37 ℃ incubator for 10min, centrifuging for 1000r/m for 10min, discarding the supernatant, placing for 5-8min at 37 ℃, lightly suspending with 40mL of 1 XHAT complete medium, pouring into a plate, lightly and slowly adding into a 96-well plate of feeder cells spread in the evening before each well with a row gun of 100 μl.

4. Selection of hybridoma cell positive holes and cell cloning

First screening, culturing CRFK cells in a 96-well cell culture plate, inoculating toxin when the CRFK cells grow to 50%, and performing indirect immunofluorescence fusion cell supernatant after 60 hours, and selecting high-positive fluorescence cell wells for limiting dilution, wherein the method comprises the following steps of: cells were diluted 2-fold, wells with 30-40 cells were selected, transferred to 2.4mL of complete medium, packed into 24 wells of 96-well plates, and cultured at 100. Mu.L/well. Then, a second and third selection was performed, as above, and wells with high positive fluorescence and single cell colonies were each selected for subcloning. Monoclonal cells were screened.

The hybridoma cell FP-9-2022 strain screened by the invention is preserved in China center for type culture Collection (China, university of Wuhan and Wuhan) at 2022, and the preservation number is CCTCC NO: C2022111.

5. monoclonal antibody ascites preparation and purification

FP-9-2022 cells were grown in a complete 1640 medium, and then cells well grown were washed 2 times with 1640 medium and resuspended in 1640 medium, and 7-week-old females were intraperitoneally injected with 2.0X10 cells per mouse ⁶ And a hybridoma cell. Raising mice, collecting ascites after the abdomen is expanded after about 7 days, centrifuging for 10min in a horizontal centrifuge at 250g, and collecting supernatant.

After ascites were obtained, the antibodies were purified by Protein A+protein G affinity chromatography. The specific operation is as follows: the ascites was 10-fold diluted with phosphate buffer, filtered through a 0.45 μm filter, equilibrated with 50mL of phosphate buffer at 4deg.C, and then loaded, and after loading the sample, unbound protein was washed with 30mL of phosphate buffer. The elution of the antibodies was performed in a protein purification system and the eluate was collected into EP tubes prepared in advance. SDS-PAGE gel identification, selecting purer liquid of target antibody, concentrating by 10kDa ultrafiltration tube at 4deg.C 4500r/min, subpackaging at-20deg.C, and storing for use, and labeling as FP-9mAb.

The light chain sequence of FP-9mAb (SEQ ID NO: 1) was sequenced as:

AspIleGlnMetThrGlnSerProAlaLeuLeuSerAlaSerValGlyGluThrValThrIleThrCysArgAlaSerGluAsnIleTyrSerTyrLeuGluTrpLeuGlnGlnArgGlnGlyLysSerProGlnLeuLeuValTyrAsnAlaLysThrLeuAlaAlaGlyValProSerArgIleSerGlySerLeuSerGlyThrGlnPheSerLeuLysLeuAsnSerLeuGlnProGluAspPheGlySerTyrTyrGlnHisHisTyrSerProTyrPheGlyGlyGlyThrLeuLeuMetLys。

the heavy chain sequence of FP-9mAb (SEQ ID NO: 2) is:

GlnValGlnLeuGlnLeuProGlyThrGluLeuValLysProGlyAlaSerValArgMetSerCysLysAlaSerGlyTyrAlaPheThrSerTyrTrpIleHisTrpValLysGlnArgLeuGlyGlnGlyLeuGluTrpIleGlyGluIleAsnProSerThrGlyArgSerAsnSerAsnGluLysPheLysThrLysAlaThrLeuThrValAspLysTyrLeuSerThrAlaTyrMetGlnLeuSerSerLeuThrSerGluAspSerLeuTyrTyrCysAlaArgLysLeuTyrLeuPheProLeuTrpGlyGlyThrLeuThrValLeuAlaAlaLys。

6. monoclonal antibody neutralizing Effect

To determine the amount of FP-9mAb required for the challenge therapy trial, the neutralization titers of FP-9mAb (initial concentration of 2.4 mg/mL), ascites fluid (Ascites) were compared by neutralization assay and the results are shown in FIG. 2: the neutralization potency of FP-9mAb was 212.33, 50% of the neutralization potency of FP-9mAb (NC ₅₀ ) The content of the active component is 0.47 mug/mL, and the neutralizing activity is very high. The specific implementation is as follows: CRFK cells were cultured according to 5X 10 ⁴ The cells/well were added to 96-well cell culture plates, and after cell attachment, cell density was observed and washed twice with sterilized PBS. After 30min inactivation of the antibodies at 56 ℃, the antibodies were diluted in EP tubes and 50 μl was added per well, 4 replicates per concentration. Dilution of virus to 200 TCID ₅₀ mu.L was added to each well. Cell controls and virus controls are required to be arranged on each cell plate. Mixing virus and antibody with gentle shaking, and placing at 37deg.C CO ₂ Incubating in a cell incubator. After 60h, 96-well plates were removed from the incubator and, because FPV had no apparent cytopathic effect on CRFK cells, an indirect immunofluorescence assay (IFA) was required for result analysis, and calculation of results was performed according to the Reed-Muench two-way method.

7. Monoclonal antibody animal protection test

Whether the experimental animal is negative to FPV or not is detected by PCR, and whether FPV infection is established and antibody treatment effect are observed by detecting cat excreta in the experiment, wherein the primers used in the PCR detection are the upstream primers FPV-F: GTAACACCTTGGTCATTGGTTG, downstream primer FPV-R: CATCATCTGGATCTGTACCATG; the reaction system is 2 xTaq mix 5 mu L, FPV-F1 mu L, FPV-R1 mu L, template 1 mu L and sterile water 2 mu L; the reaction conditions are 98 ℃ for 3min,30-35 cycles (the cycle reaction is 98 ℃ for 15s, 55 ℃ for 15s and 72 ℃ for 30 s), 72 ℃ for 5min, and 16 ℃ for 2min for cooling. 6 cats 3-5 months old were kept for 3 days, blood and feces were collected, the FPV antibody was detected negative, and the PCR result was negative, which was used (see FIG. 3). After infection, 6 cats were monitored daily for body temperature, body weight, and feces were collected for PCR detection (see FIG. 4 for results), and it was found that the experimental model was established and FPV was not excreted with feces after mAb treatment. Wherein, the cats in the treatment group were respectively injected with 1.2mg of monoclonal antibody intravenously one day before and one day after the challenge (total 3 days), without other treatment measures. After the positive group is ill and dead and the experiment is finished, 3 groups of cats are subjected to pathological section examination, tissues such as intestinal tracts, stomach, spleen and the like are collected, and histopathological examination is carried out.

The animals were grouped as shown in Table 1.

TABLE 1

Clinical symptoms observation and scoring system, wherein the scoring standard refers to the relevant regulations of European pharmacopoeia to score the clinical symptoms of FPV, and mainly comprises indexes such as mental state, weight, body temperature, vomiting condition, diarrhea and the like, and the higher the score is, the more serious the symptoms are, and the death is marked as 10. The clinical observations are shown in fig. 5, the treatment and negative groups did not show any clinical symptoms of FPV infection. The positive group shows obvious clinical symptoms, diarrhea symptoms appear on the 7 th day after toxin expelling, vomiting symptoms appear on the 10 th day, hematochezia on the 11 th day, and along with the development of the disease course, the experimental animals have poor appetite, become thin gradually, become Mao Zaluan and are severely dehydrated until death on the 15 th day. The body temperature, body weight, clinical scores were within the normal range of variation for both treatment and negative groups, while the white blood cell count was within the normal range (5-18.9X10 ⁹ cell/L). Antibodies in the body rise briefly after toxin attack and fall back to their original values. While the positive group cats showed fever symptoms on day 3 after approximately the challenge, with the progress of the disease, the weight became lighter and the clinical symptoms became more and more evident, the white blood cell count was lower than the normal range on day 7, and no white blood cells were detected on day 9. All the positive groups die after toxin attack, the death rate reaches 100%, the in vivo antibody titer is also higher and higher with time, and the result is shown in figure 6. The results of pathological section examination of intestinal tracts, stomachs and spleens of experimental cats are shown in fig. 7, the treatment group and the negative group have no obvious abnormality of eye vision, the positive group shows obvious pathological changes of FPV infection, and obvious congestion, bleeding and spleen swelling of the stomach and the intestinal tracts occur. The clinical symptom scoring criteria are shown in table 2.

TABLE 2

8. Histopathological observation: after fixation of fresh parts of tissue with paraformaldehyde, embedding with conventional paraffin, cutting into 4 μm slices, HE staining, and finally observing and recording histological pathological changes under an optical microscope, as shown in FIG. 8, the treatment group and the negative group have no obvious eye-viewing abnormalities, while the positive group has intestinal villus rupture, intestinal gland epithelial cell apoptosis, gastric gland structural disorder, a large number of red blood cell infiltration, gastric mucosa rupture, crypt reduction, and significant reduction of spleen and lymph node lymphocytes. Immunohistochemical staining: conventionally dewaxing paraffin sections to water, flushing the sections with clear water for 5min, treating the sections with 3% hydrogen peroxide at room temperature for 30min, washing the sections with 0.01mol/L phosphate buffer solution twice for 5min each time, putting the sections into antigen retrieval buffer solution for thermal retrieval, taking out, naturally cooling the sections at room temperature, washing the sections with 0.01mol/LPBS for 3 times, washing the sections for 5min each time, carefully sucking residual liquid, putting the sections into a wet box, dropwise adding diluted normal goat serum for sealing for 1h at 37 ℃, carefully sucking residual liquid, and dropwise adding 1:100 diluted FPV monoclonal antibody, 4 ℃ for overnight incubation, washing the slices with 0.01mol/LPBS for 2 times, dropwise adding HRP-marked goat anti-mouse IgG for 30min at room temperature, washing the slices with 0.01mol/LPBS for 2 times, 5min each time, then developing the color with DAB/AEC in dark for 1min, washing with clear water for 5min, sequentially carrying out hematoxylin padding for 2min, washing with running water for 5min, hydrochloric acid differentiation for 15s, washing with running water again for 10min, gradient alcohol dehydration, xylene transparency, and neutral resin sealing, observing positive signals by an optical microscope, wherein the positive signals are not observed in both treatment groups and negative groups, and the result shows that no positive signals are infected by FPV, and the FP-9mAb can prevent cats from being infected by FPV, so that the cat has good protection effect. Since FPV frequently infects cells that divide and grow vigorously, in the positive group we can observe that positive signals are located in the intestinal crypt epithelium, in the stomach, positive signals are located in the gastric gland epithelium, in the spleen and lymph nodes, positive signals are located in lymphoblastic cells, which are dark brown in color.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Sequence listing

<110> university of agriculture in China

<120> a feline parvovirus neutralizing monoclonal antibody and use thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 103

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Asp Ile Gln Met Thr Gln Ser Pro Ala Leu Leu Ser Ala Ser Val Gly

1 5 10 15

Glu Thr Val Thr Ile Thr Cys Arg Ala Ser Glu Asn Ile Tyr Ser Tyr

20 25 30

Leu Glu Trp Leu Gln Gln Arg Gln Gly Lys Ser Pro Gln Leu Leu Val

35 40 45

Tyr Asn Ala Lys Thr Leu Ala Ala Gly Val Pro Ser Arg Ile Ser Gly

50 55 60

Ser Leu Ser Gly Thr Gln Phe Ser Leu Lys Leu Asn Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Gly Ser Tyr Tyr Gln His His Tyr Ser Pro Tyr Phe Gly

85 90 95

Gly Gly Thr Leu Leu Met Lys

100

<210> 2

<211> 115

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Gln Val Gln Leu Gln Leu Pro Gly Thr Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Arg Met Ser Cys Lys Ala Ser Gly Tyr Ala Phe Thr Ser Tyr

20 25 30

Trp Ile His Trp Val Lys Gln Arg Leu Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Asn Pro Ser Thr Gly Arg Ser Asn Ser Asn Glu Lys Phe

50 55 60

Lys Thr Lys Ala Thr Leu Thr Val Asp Lys Tyr Leu Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Leu Tyr Tyr Cys Ala

85 90 95

Arg Lys Leu Tyr Leu Phe Pro Leu Trp Gly Gly Thr Leu Thr Val Leu

100 105 110

Ala Ala Lys

115

Claims (5)

1. A hybridoma cell line, characterized by being deposited with the China center for type culture collection at a deposit number of CCTCC NO: C2022111.

2. a feline parvovirus neutralizing monoclonal antibody secreted by the hybridoma cell of claim 1, having a light chain sequence as set forth in SEQ ID NO:1, the heavy chain sequence is shown as SEQ ID NO: 2.

3. Use of the monoclonal antibody of claim 2 in the preparation of a medicament for treating feline parvovirus.

4. A method for preparing the feline parvovirus neutralizing monoclonal antibody according to claim 2, which is characterized by comprising the steps of injecting the hybridoma cell according to claim 1 into the abdominal cavity of a mouse to obtain ascites of the mouse, and purifying to obtain the feline parvovirus neutralizing monoclonal antibody.

5. The method of claim 4, wherein the purification is performed by Protein A+protein G affinity chromatography.