CN114807042A

CN114807042A - Chimeric antigen receptor modified NK cell and preparation method and application thereof

Info

Publication number: CN114807042A
Application number: CN202210074663.2A
Authority: CN
Inventors: 李晓东
Original assignee: Nanjing Zhutianzhongke Technology Development Co ltd
Current assignee: Nanjing Zhutianzhongke Technology Development Co ltd
Priority date: 2021-01-22
Filing date: 2022-01-21
Publication date: 2022-07-29
Also published as: WO2022156786A1

Abstract

The present application discloses a chimeric antigen receptor-engineered NK cell, the chimeric antigen receptor comprising: an extracellular target molecule binding domain, a transmembrane region domain, and an intracellular signaling domain; the transmembrane region domain connects the extracellular target molecule-binding domain and the intracellular signaling domain and immobilizes both on the cell membrane of the NK cell; the intracellular signaling domain comprises an intracellular activation signaling domain and/or an intracellular detection signaling domain. The chimeric antigen receptor-modified NK cells have the advantages of both immune checkpoint inhibitors and CAR-modified NK cell therapies, and provide solutions for improving solid tumor treatment.

Description

Chimeric antigen receptor modified NK cell and preparation method and application thereof

Technical Field

The application relates to a chimeric antigen receptor modified NK cell and a preparation method and application thereof, belonging to the field of biomedicine.

Background

Despite all of our remarkable progress each year through cancer prevention studies, cancer remains a major public health challenge. The study of cancer has prompted the emergence of new approaches to the prevention, detection, diagnosis, treatment and even cure of various diseases such as cancer. These advances are decreasing global cancer morbidity and mortality, while increasing the number of children and adults with longer life and higher quality who receive cancer diagnosis. For example, the age-adjusted overall cancer mortality in the united states has decreased by 27% from 1991 to 2016, which means a reduction of over 260 million cancer deaths. The number of cancer immunotherapies has increased rapidly in recent years and the working principle is to release the strength of the patient's immune system to fight against cancer, to a degree similar to the way the immune system fight against the pathogens of viruses that cause influenza or bacteria that cause streptococcal pharyngolaryngitis. Cancer immunotherapy, particularly immune checkpoint inhibitors and cell therapy, is the most exciting new approach to cancer treatment in recent years and has also entered clinical trials to a great extent.

One type of cancer immunotherapy is immune checkpoint inhibitors, which work by blocking a class of proteins called immune checkpoints on the surface of immune cells, thereby acting as a "brake" to release the function of the suppressor immune cells, e.g. inhibitors against the immune checkpoint PD-1 and its ligand protein PD-Ls, several classes of immune checkpoint inhibitors targeting PD-1/PD-Ls have been approved by the FDA in the united states for the treatment of different cancer diseases. Another form of cancer immunotherapy is Chimeric Antigen receptor modified T cell (CAR-T cell) therapy. CAR-T cell therapy has shown exciting clinical efficacy in hematological malignancies patients, and several CAR-T cell therapies targeting CD19 have been approved by the FDA in the united states for the treatment of leukemia and lymphoma, respectively.

Tumor cell therapy is advancing at an unprecedented rate, particularly since CAR-T cell therapy became available, and this strategy has proven effective against B cell malignancies and has shown promising activity in clinical trials for other hematologic cancers, as well as potentially producing some efficacy in the treatment of solid tumors. However, the side effects of cytokine release syndrome and immune effector cell-related neurotoxicity syndrome faced by CAR-T cell therapy in clinical applications increase patient hospitalization time and treatment risks and costs. Other limitations of CAR-T cell therapy include the tube-to-market challenges of producing autologous cell products and the risk of considering T cell-mediated graft-versus-host reactions, among others. Furthermore, the poor results of CAR-T cell therapy for solid tumors are largely due to the unique challenges presented by the physical barrier of the immunosuppressive microenvironment and tumor stroma formation. In view of these shortcomings of traditional CAR gene transduced α β -T cells, there is great interest in other types of subpopulations of immune cells, both innate and adaptive, as well as improved strategies for CAR engineering. Natural Killer cells (NK cells) are of great interest because of their unique biological properties, specific cytotoxicity against tumors, safety and potential use as a ready-made cell therapy. It is worth mentioning that NK cells, which are the most important lymphocyte types other than T cells and B cells, account for approximately 5% to 15% of the total proportion of human peripheral monocytes, are an important component of the innate immune system and play a crucial role in our first-line defense against pathogens and cancer cells. As their name suggests, NK cells are a special killer with a unique natural ability to eliminate abnormal cells damaged by viral infection or malignant transformation. Unlike T cells, NK cells lack the expression of the T cell receptor and CD3, which do not require the assistance of MHC-I molecules to recognize and kill abnormal cells. In this case, the role of NK cells, the "innate counterpart" of killer T cells, is of crucial importance, being able to find and recognize abnormal cells lacking "self" (non-self) MHC class I molecules. This hypothesis was further confirmed by the discovery of inhibitory and activating NK receptors in the 90 s of the 20 th century. Blocking the immunosuppressive signal that inhibits NK cells with immune checkpoint inhibitors may overcome the limitations of T cell-based immunotherapy to some extent. In addition, the NK cells have a killing mechanism similar to that of the CD8 positive killing T cells for killing target cells to a certain extent, and a solid foundation is provided for engineering and transformation of the NK cells. CAR-NK cell therapy may offer a number of advantages over CAR-T cell therapy, such as, but not limited to: (1) multiple mechanisms of activating the lethal function, (2) highly convenient manufacturing process advantages of "off-the-shelf" (3) advantages in safety, such as reduced or no cytokine release syndrome with neurotoxic syndrome exhibited by autologous therapy and reduced or no graft-versus-host reaction exhibited by allogeneic therapy, etc. Notably, the use of NK cells can result in ready-to-use allogeneic products to treat patients, thereby eliminating the necessary limitations of personalized and patient-specific products in current CAR-T cell therapies. The engineering transformation of the NK cells can lead the NK cells to target various different antigens and enhance the proliferation, amplification, persistence and the like of the NK cells in vivo, thereby finally realizing the effective anti-tumor function. In addition, NK cells, as important immune cells in the body, are not only associated with anti-tumor, anti-viral infection and immune regulation, but also in some cases are involved in the development of hypersensitivity reactions and autoimmune diseases, and are capable of recognizing target cells and killing clearance mediators. Therefore, the modification and application of the NK cells are of great significance.

Disclosure of Invention

According to one aspect of the present application, there is provided a chimeric antigen receptor engineered NK cell that combines the advantages of both immune checkpoint inhibitors and CAR engineered NK cell therapies, providing a solution for improved solid tumor therapy.

A chimeric antigen receptor engineered NK cell, the chimeric antigen receptor comprising: an extracellular target molecule binding domain, a transmembrane region domain, and an intracellular signaling domain;

the transmembrane region domain connects the extracellular target molecule-binding domain and the intracellular signaling domain and immobilizes both on the cell membrane of the NK cell;

the intracellular signaling domain comprises an intracellular activation signaling domain and/or an intracellular detection signaling domain.

Optionally, the chimeric antigen receptor engineered NK cell is an NK cell containing a nucleic acid encoding a chimeric antigen receptor.

Optionally, the chimeric antigen receptor further comprises: an extracellular spacer domain;

the extracellular spacer domain is located between the extracellular target molecule binding domain and the transmembrane region domain.

Optionally, the chimeric antigen receptor further comprises: an intracellular spacer domain;

the intracellular spacer domain is located between and connects the transmembrane region and the intracellular signaling domain.

Optionally, the chimeric antigen receptor further comprises: an intracellular hinge domain;

the intracellular hinge domain connects the intracellular detection signal domain and the intracellular activation signal domain together;

the intracellular hinge domain may be of any suitable length to connect at least two domains of interest, and is preferably designed to be sufficiently flexible so as to allow proper folding and/or function and/or activity of one or both domains it connects.

Optionally, the extracellular target molecule binding domain binds a target molecule comprising at least one of the following group of molecules: immunosuppressive signal related molecules, tumor surface antigen molecular markers, and cell surface specific antigen peptide-histocompatibility complex molecules.

Optionally, the extracellular target molecule binding domain comprises at least one of the target molecule binding domains of a molecule selected from the group consisting of: PD-1, PD-1 truncations, PD-1 protein mutants, antibodies to PD-L1, and PD-L1 binding fragments.

Optionally, the extracellular target molecule binding domain comprises at least one of an amino acid sequence comprising SEQ ID NO 1, an amino acid sequence comprising SEQ ID NO 3, an amino acid sequence comprising SEQ ID NO 5, an amino acid sequence comprising SEQ ID NO 7, an amino acid sequence comprising SEQ ID NO 9, an amino acid sequence comprising SEQ ID NO 11.

Optionally, the nucleic acid fragment of the extracellular target molecule binding domain comprises at least one of a nucleic acid sequence comprising SEQ ID NO 2, a nucleic acid sequence comprising SEQ ID NO 4, a nucleic acid sequence comprising SEQ ID NO 6, a nucleic acid sequence comprising SEQ ID NO 8, a nucleic acid sequence comprising SEQ ID NO 10.

Optionally, activation of the intracellular activation signaling domain is dependent on at least binding of the extracellular target molecule binding domain to the target molecule; the intracellular activation signaling domain comprises a molecule or fragment having a catalytic functional group.

Optionally, the intracellular activation signaling domain comprises at least one of a tyrosine kinase or a tyrosine kinase fragment;

the tyrosine kinase comprises at least one of receptor type tyrosine kinase and non-receptor type tyrosine kinase;

the tyrosine kinase fragment comprises at least one of a receptor type tyrosine kinase fragment and a non-receptor type tyrosine kinase fragment.

Optionally, the tyrosine kinase is at least one selected from the group consisting of Ack, CSK, CTK, FAK, Abl, Arg, Tnk1, Pyk2, Fer, Fes, LTK, ALK, STYK1, JAK1, JAK2, JAK3, Tyk2, DDR1, DDR2, ROS, Blk, Fgr, FRK, Fyn, TIE1, TIE2, Hck, Lck, Srm, Yes, Syk, ZAP70, Etk, Btk, HER2, HER3, HER4, instr, ITK, TEC, TXK, EGFR, IGF1R, IRR, PDGFR α, VEGFR-1, VEGFR-2, VEGFR-3, PDGFR β, Kit, CSFR, FLT, FGFR4, FGFR R, brhakcck R, metr R, prktr R, ephakr R, ephak R, ephaktr R, ephha R, ephr R, ephaktr R, eph R, eph R, ephr R, eph R, eph R, EphA R, ephr R, eph R, eph R, ephr R, ephr 685R, eph R, eph 685R, eph R, eph R, 685R, ephr R, ephha b, R, ephr R, 685R, ephr R, ephr R, ephr R, 685R, 685R, ephha 685R, ephr R, 685R, 685R, ephr 685R, 685R, 685R, 685R, and b, 685R, ephr 685R, 685R, 685R, and b, R, 685R, and b, 685.

Optionally, the intracellular activation signaling domain comprises at least one of an amino acid sequence comprising SEQ ID No. 42, an amino acid sequence comprising SEQ ID No. 44, an amino acid sequence comprising SEQ ID No. 46, an amino acid sequence comprising SEQ ID No. 48, an amino acid sequence comprising SEQ ID No. 50, an amino acid sequence comprising SEQ ID No. 52.

Optionally, the nucleic acid fragment of the intracellular activation signaling domain comprises at least one of a nucleic acid sequence comprising SEQ ID NO 43, a nucleic acid sequence comprising SEQ ID NO 45, a nucleic acid sequence comprising SEQ ID NO 47, a nucleic acid sequence comprising SEQ ID NO 49, a nucleic acid sequence comprising SEQ ID NO 51, a nucleic acid sequence comprising SEQ ID NO 53.

Optionally, the intracellular detection signaling domain comprises at least one immunoreceptor tyrosine-based activation motif.

Optionally, the intracellular detection signaling domain comprises at least one of the signaling domains of a molecule selected from the group consisting of: CD3 delta, CD3 gamma, CD3 epsilon, CD3 zeta, CD3, CD229, CEACAM-19, CEACAM-20, SIRP alpha, SLAM, CLEC-1, CLEC-2, CRACCC, CTLA-4, 2B 3, CD244, BTLA, DCAR, DCIR, Dectin-1, DNAM-1, CD300 3, CEACAM-1, CEACAM-3, CEACAM-4, Fc epsilon RI alpha, Fc epsilon beta, Fc gamma RIB, Fc gamma RI, Fc gamma RIRL, Fc gamma RIIB, Fc gamma RIIC, Fc gamma RIDAP, LRLR 3, DAP 3, G6, KIR2DL3, KILILILIR 2DL3, KIDL 3, SigR 2DL3, ScIRL 3, SciR 3, SciTRECCA 2D 3, SceR 3, SceCCK 3, SceC 3, SceR 3, SceCCK 3, SceR 3, SceCCT 3, SceR 3, SceCCT 3, SceRIL 3, SceRIR 3, SceRIL 3, SceR 3, SceRIL 685, Siglec-8, PDCD6, PILR-alpha, Siglec-9, Siglec-10, Siglec-11, Siglec-12, Siglec-14, Siglec-15, Siglec-16.

Optionally, the intracellular detection signaling domain comprises at least one of an amino acid sequence comprising SEQ ID NO 20, an amino acid sequence comprising SEQ ID NO 22, an amino acid sequence comprising SEQ ID NO 24, an amino acid sequence comprising SEQ ID NO 26, an amino acid sequence comprising SEQ ID NO 28, an amino acid sequence comprising SEQ ID NO 30, an amino acid sequence comprising SEQ ID NO 32, an amino acid sequence comprising SEQ ID NO 34, an amino acid sequence comprising SEQ ID NO 36, an amino acid sequence comprising SEQ ID NO 38, an amino acid sequence comprising SEQ ID NO 40.

Optionally, the nucleic acid fragment of the intracellular detection signaling domain comprises at least one of a nucleic acid sequence comprising SEQ ID NO 21, a nucleic acid sequence comprising SEQ ID NO 23, a nucleic acid sequence comprising SEQ ID NO 25, a nucleic acid sequence comprising SEQ ID NO 27, a nucleic acid sequence comprising SEQ ID NO 29, a nucleic acid sequence comprising SEQ ID NO 31, a nucleic acid sequence comprising SEQ ID NO 33, a nucleic acid sequence comprising SEQ ID NO 35, a nucleic acid sequence comprising SEQ ID NO 37, a nucleic acid sequence comprising SEQ ID NO 39, a nucleic acid sequence comprising SEQ ID NO 41.

Optionally, the transmembrane domain is selected from the group consisting of transmembrane domains of transmembrane proteins comprising 4-1BB, 4-1BBL, ICOS, GITR, GITRL, VSIG-3, VISTA, SIRP α, OX40, OX40L, CD40, CD40L, CD86, CD80, PD-1, PD-L1, PD-L2, CD2, CD28, B7-DC, B7-H2, B7-H3, B7-H4, B7-H5, B Sig 7-H6, B7-H7, Siglec-1, Siglec-2, Siglec-3, Siglec-4, LILRB B4, 2B4, SigLA, CD160, LAG-3, Siglec-5, Siglec-6, Siglec-7, Siglec-3, TIM-226, TIM-9, TIM-685-9, TIM-9, CD-8, CD-685-H685-4, and Siglec-2, At least one of Siglec-16, LIR1, KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR3DL1, KIR3DS1, KLRG1, KIR2DS1, LAIR1, LILRA 1, DAP 21, NKG2 fcr 1, nka lr6854, lrb1, lib 1, CTLA-1, CD155, CD112, CD113, tig, galic 6859, koct 1, kov Fc 1, c 2f and c 1;

optionally, the transmembrane region comprises at least one of an amino acid sequence comprising SEQ ID No. 12, an amino acid sequence comprising SEQ ID No. 14.

Optionally, the nucleic acid fragment of the transmembrane region comprises at least one of the nucleic acid sequence comprising SEQ ID No. 13, the nucleic acid sequence comprising SEQ ID No. 15.

Optionally, the extracellular spacer domain comprises at least one of an amino acid sequence comprising SEQ ID No. 16, an amino acid sequence comprising SEQ ID No. 18.

Optionally, the nucleic acid fragment of the extracellular spacer domain comprises at least one of the nucleic acid sequence comprising SEQ ID No. 17, the nucleic acid sequence comprising SEQ ID No. 19.

Optionally, the intracellular spacer domain is an extension of the transmembrane region domain comprising at least one molecule selected from the group consisting of: PD-1, PD-L, CD8, CD, ICOS, GITR, GITRL, OX40, B-DC, B-H, CD40, CD, B-H, VSIG-3, VISTA, SIRP α, KIR2DS, Siglec-1, Siglec-2, Siglec-3, Siglec-4, CD155, CD112, CD113, TIGIT, CD226, Siglec-5, Siglec-6, Siglec-7, Siglec-8, Siglec-9, LRlec-10, LILRB, LILRDL, LIB, Sigdl-11, Siglec-12, LRlec-12, DAP-5, DAP-KIR-2, DAP-3, KIR-3, DAP-2, DAP-3, DADL-4, DADL-D-2, DADL-5, DADL-2, DADL-6, DADL-DL-6, DADL-2, DADL-3, DADL-DL-2, DADL-3, DADL-D, DADL-2, DADL-3, DADL-4, DADL-2, DADL-3, DADL-4, DADL-6, DADL-4, DADL-2, DADL-4, DADL-1, DADL-2, DADL-4, DADL-1, DADL-6, DADL-1, DADL-2, DADL-4, DADL-1, DADL-4, DADL-2, DADL-4, DADL-1, DADL-2, DADL-4, DADL-1, DADL-2, DADL-D, DADL-1, DADL-2, and DADL-1, DADL-2, DADL-1, DADL-2, DADL-1, DADL-2, DADL-1, DADL-D, DADL-2, DADL-1, DADL-2, DADL-D, DADL-4, DADL-1, DADL-2, and DADL-1, DA, TIM-3, TIM-4, KLRG1, KLRG2, LAIR1, LAIR2, LILRA3, LILRA4, LILRA5, 2B4, BTLA, CD160, LAG-3, CTLA-4, Galectin-9, CEACAM-1, MERKT, AXL, Tyro3, BAI1, 4-1BB, 4-1BBL, MRC1, FcyR 1, FcyR 2A, FcyR 2B1, FcyR 2B2, FcyR 3A, FcyR 3B, FcyR 2, FcyR 1, FcRn, FcyR/. mu.R, or FcyR 1.

Optionally, the intracellular spacer domain comprises at least one of an amino acid sequence comprising SEQ ID No. 54, an amino acid sequence comprising SEQ ID No. 56.

Optionally, the intracellular spacer domain nucleic acid fragment comprises at least one of a nucleic acid sequence comprising SEQ ID No. 55, a nucleic acid sequence comprising SEQ ID No. 57.

Optionally, the intracellular hinge domain comprises at least one of an amino acid sequence comprising SEQ ID No. 58, an amino acid sequence comprising SEQ ID No. 60, an amino acid sequence comprising SEQ ID No. 62, an amino acid sequence comprising SEQ ID No. 64, an amino acid sequence comprising SEQ ID No. 66.

Alternatively, the intracellular hinge domain fragment comprises at least one of a nucleic acid sequence comprising SEQ ID NO 59, a nucleic acid sequence comprising SEQ ID NO 61, a nucleic acid sequence comprising SEQ ID NO 63, a nucleic acid sequence comprising SEQ ID NO 65.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; an intracellular detection signaling domain; an intracellular activation signaling domain; an intracellular spacer domain; an intracellular hinge domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; and an intracellular signaling domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; an intracellular detection signaling domain; and an intracellular activation signaling domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; and an intracellular activation signaling domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; an intracellular detection signaling domain; an intracellular activation signaling domain; and an intracellular hinge domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; and an intracellular activation signaling domain; and an intracellular spacer domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; an intracellular signaling domain; and an intracellular spacer domain.

Optionally, the chimeric antigen receptor comprises: an extracellular target molecule binding domain; a transmembrane region domain; an extracellular spacer domain; an intracellular detection signaling domain; an intracellular activation signaling domain; and an intracellular spacer domain.

Optionally, the NK cells comprise at least one of a subpopulation of endogenous NK cells and/or exogenous NK cells.

Optionally, the endogenous NK cell subpopulation comprises adaptive NK cells, memory NK cells, CD56 ^dim NK cells, CD56 ^bright At least one of NK cells;

the exogenous NK cells include at least one of an NK cell strain, embryonic stem cells, or induced pluripotent stem cell-derived NK cells.

Optionally, the NK cell line is at least one selected from the group consisting of NK-92 cell line, haNK cell line, IMC-1 cell line, NK-YS cell line, KHYG-1 cell line, NKL cell line, NKG cell line, SNK-6 cell line, YTS cell line and HANK-1 cell line.

The haNK cell strain is a high-affinity (high-affinity) CD16 positive NK cell strain.

According to another aspect of the present application, there is provided a method of preparing a chimeric antigen receptor-engineered NK cell as defined in any one of the above, comprising the steps of:

1) respectively obtaining human NK cells and chimeric antigen receptors;

2) transforming the human NK cell with the chimeric antigen receptor to obtain the chimeric antigen receptor-transformed NK cell.

Optionally, the preparation method comprises the following steps:

1) obtaining human NK cells and nucleic acids encoding chimeric antigen receptors, respectively;

2) introducing the nucleic acid encoding the chimeric antigen receptor into the human NK cell to obtain the chimeric antigen receptor engineered NK cell.

According to another aspect of the present application, there is provided a pharmaceutical composition comprising at least one of the chimeric antigen receptor-engineered NK cells described above or the chimeric antigen receptor-engineered NK cells prepared according to the preparation method described above.

Optionally, the pharmaceutical composition further comprises a monoclonal antibody;

the monoclonal antibody is selected from at least one of cetuximab, alemtuzumab, ipilimumab and ofatumumab.

Optionally, the pharmaceutical composition further comprises a cytokine;

the cytokine is at least one selected from gamma interferon and interleukin.

According to another aspect of the present application, there is provided a use of at least one of the chimeric antigen receptor-modified NK cell of any one of the above, or the chimeric antigen receptor-modified NK cell prepared according to the preparation method of any one of the above, or the pharmaceutical composition of any one of the above, in the preparation of a medicament for the treatment of:

tumors, infections, inflammatory diseases, immune diseases, nervous system diseases.

Optionally, the tumor is a tumor that is positive for PD-L1 or upregulates the expression level of PD-L1 in response to gamma interferon.

Optionally, the tumor comprises a solid tumor and/or a hematologic cancer.

Optionally, the solid tumor comprises at least one of breast cancer, skin cancer, liver cancer, ovarian cancer, prostate cancer, brain cancer, kidney cancer, lung cancer.

Optionally, the hematologic cancer comprises leukemia.

According to another aspect of the present application, there is provided a method of use of the pharmaceutical composition of any one of the above, comprising the steps of:

1) respectively obtaining human NK cells and chimeric antigen receptors;

2) transforming the human NK cell with the chimeric antigen receptor to obtain a chimeric antigen receptor-transformed NK cell;

3) (ii) returning the chimeric antigen receptor engineered NK cells to a human;

or the use method comprises the following steps:

2) introducing the nucleic acid encoding the chimeric antigen receptor into the human NK cell to obtain the chimeric antigen receptor-engineered NK cell;

3) (ii) returning said chimeric antigen receptor engineered NK cell to a human.

Optionally, step 3) further comprises:

3-1) applying at least one of a cytokine, a monoclonal antibody to the whole or part of the human body;

3-2) returning the modified immune cells to the human body.

Sequence homology applies to the identification of similarity and identity of all nucleic acid sequences and protein sequences referred to throughout this application.

Table 1 shows the amino acid and nucleic acid sequences referred to in the present application

TABLE 1

The beneficial effects that this application can produce include:

1) the NK cell modified by the chimeric antigen receptor provided by the application is modified by utilizing the chimeric antigen receptor, and the chimeric antigen receptor is provided with a specially modified intracellular signal conduction structural domain, so that the killing effect of the NK cell on tumor cells is enhanced.

2) The NK cell modified by the chimeric antigen receptor provided by the application is the NK cell modified by recoding through the new generation of chimeric antigen receptor molecule machine based on PD-1, and based on the modified immune checkpoint PD-1/PD-L1 signal channel, the specific tumor cell can be better identified and killed, so that the NK cell is not inhibited by the tumor cell expressing the immune checkpoint inhibitory signal PD-1 molecular ligand PD-L1, but is further activated to generate specific immune response aiming at the corresponding tumor cell, and the corresponding tumor cell is identified and killed.

3) The NK cell modified by the chimeric antigen receptor has better recognition and killing effects on specific tumor cells, including human prostate cancer tumor cells, human kidney cancer tumor cells, human breast cancer tumor cells, human skin cancer tumor cells, human brain cancer tumor cells, human lung cancer tumor cells, human liver cancer cells, human ovarian cancer cells and the like.

Drawings

Fig. 1 shows an exemplary method of administering a natural killer cell chimeric antigen receptor of the present disclosure, wherein the natural killer cells may be cells that are allogenic, or autologous to the individual.

FIG. 2 is a schematic diagram of the construction of the chimeric antigen receptor artificial molecular machine of the present application. Wherein FIG. 2a comprises Domain # I, Domain # II, Domain # III and Domain # VIII, FIG. 2b comprises Domain # I, Domain # II, Domain # III and Domain # VII, FIG. 2c comprises Domain # I, Domain # II, Domain # III, Domain # V and Domain # VII, FIG. 2d comprises Domain # I, Domain # II, Domain # III, Domain # V and Domain # VII, FIG. 2e comprises Domain # I, Domain # II, Domain # III, Domain # V, Domain # VI and Domain # VII, FIG. 2f comprises Domain # I, Domain # II, Domain # III, Domain # IV and Domain # VIII, and FIG. 2f comprises Domain # I, Domain # II, Domain # VIII, Domain # III, domain # IV and domain # VII, fig. 2g the chimeric antigen receptor artificial molecule machinery comprises domain # I, domain # II, domain # III, domain # IV, domain # V and domain # VII, fig. 2h the chimeric antigen receptor artificial molecule machinery comprises domain # I, domain # II, domain # III, domain # IV, domain # V, domain # VI and domain # VII.

FIG. 3 is a schematic diagram of signal activation of the artificial molecular machine of the present application, FIG. 3a shows the release and activation of the activation signal of the artificial molecular machine in the case of tyrosine kinase activation signal input, and FIG. 3b shows the release and activation of the activation signal of the chimeric antigen receptor artificial molecular machine comprising domain # I (e.g., PD-1 extracellular portion) in the case of target cell target molecule signal input (e.g., PD-L1).

FIG. 4a shows the results of C #9, C #10, C #11, C #12, C #13, C #14, C #15 and C #16 expression in human HeLa (HeLa) cells under conditions in which the tyrosine phosphatase inhibitor sodium peroxovanadate activates the protein tyrosine phosphorylation signal.

FIG. 4B shows the results of C #9 and C #15 in human HeLa (HeLa) cells under A conditions of tyrosine phosphatase inhibitor sodium perovanadate activation protein tyrosine phosphorylation signal or under B conditions of epidermal growth factor activation signal.

FIG. 4C shows the results of C #9 and C #15 in Mouse Embryonic Fibroblasts (MEF) under A conditions of tyrosine phosphatase inhibitor sodium perovanadate activating protein tyrosine phosphorylation signal or B conditions of platelet derived growth factor activating signal.

FIG. 5a shows the expression profiles of C #17 and C #18 in HeLa cells of human origin and the results of the measurement of the ability to respond to protein tyrosine phosphorylation signals under the stimulation of the tyrosine phosphatase inhibitor sodium perovanadate.

FIG. 5b shows the expression profiles of C #19 and C #20 in HeLa cells and the measurement of the ability of the tyrosine phosphatase inhibitor to respond to protein tyrosine phosphorylation signals under stimulation with sodium perovanadate.

FIG. 5C shows the results of C #17, C #18, C #19 and C #20 in human Hela (HeLa) cells under conditions in which the tyrosine phosphatase inhibitor sodium perovanadate activates the protein tyrosine phosphorylation signal.

Fig. 6 shows the results of C #9 and C #10 in the purified protein state under the condition that the non-receptor type protein tyrosine kinase Lck provides a signal for activating tyrosine phosphorylation of protein.

FIG. 7a shows the expression profiles of C #19 and C #20 in human HeLa (HeLa) cells and the results of detection in response to human PD-L1 signals under stimulation by human PD-L1-modified microspheres.

FIG. 7b shows the results of C #17, C #18, C #19 and C #20 in HeLa cells under the condition of stimulation signals from PD-L1 modified microspheres of human origin.

Fig. 8 shows a comparison of natural killer cells and natural killer cells with chimeric antigen receptor modifications of the present disclosure. In which, fig. 8a shows the natural killer cell appearance towards tumor cells. Fig. 8b shows the behavior of natural killer cells with chimeric antigen receptor modifications of the present disclosure in the face of tumor cells. Wherein, the gray scale of the natural killer cells corresponds to the tumor killing capability of the natural killer cells.

FIG. 9 shows the expression of different chimeric antigen receptors in natural killer cells NK-92.

FIG. 10 shows the expression of PD-L1 in 8 human tumor cells and 8 human tumor cells pretreated with gamma interferon. The 8 kinds of human tumor cells are breast cancer tumor cell MBA-MB-231 in FIG. 10a, brain cancer tumor cell U87-MG in FIG. 10b, kidney cancer tumor cell 786-O in FIG. 10c, skin cancer tumor cell A2058 in FIG. 10d, lung cancer tumor cell H441 in FIG. 10e, ovarian cancer tumor cell ES-2 in FIG. 10f, prostate cancer tumor cell PC-3 in FIG. 10g, and liver cancer tumor cell HA-22T in FIG. 10H, respectively.

FIG. 11 shows the results of imaging analysis of the cytotoxicity effect of chimeric antigen receptor modified human natural killer cells C #3 and C #2 in vitro co-cultured with human breast cancer tumor cell MDA-MB-231 positive to PD-L1, respectively. Fig. 11a shows that in the case of in vitro co-cultured cells in the chimeric antigen receptor modified human natural killer cell C #3 and the PD-L1 positive human breast cancer tumor cell MDA-MB-231, the initially green fluorescence labeled cell is a healthy and intact human breast cancer tumor cell, and if the chimeric antigen receptor modified human natural killer cell is killed and identified, the cell membrane is broken incompletely, the green fluorescence gradually disappears, and the propidium iodide of the red fluorescence nuclear staining reagent enters the apoptotic cell and appears as a red fluorescence cell. FIG. 11b shows that in vitro co-cultured cell situation of chimeric antigen receptor modified human natural killer cell C #2 and human breast cancer tumor cell MDA-MB-231 positive in PD-L1, human breast cancer tumor cell MDA-MB-231 cells always maintained healthy and intact, and human natural killer cell C #2 not modified by chimeric antigen receptor modification kills.

FIG. 12a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells with PD-L1 positive human breast cancer tumor cells as contemplated by the present application.

Fig. 12b illustrates the results of quantitative analysis of the cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells co-cultured in vitro, the natural killer cells and the tumor cells were tested at a ratio of E/T (effector cells/target cells) of 1:1 (mean ± sd, both n ═ 3).

Fig. 12c illustrates the results of quantitative analysis of the cytotoxicity effect of different chimeric antigen receptor modified human nk cells and PD-L1 positive human breast cancer tumor cell MDA-MB-231 cells co-cultured in vitro, the nk cells and the tumor cells were tested at a ratio of E/T (effector cells/target cells) of 2.5:1 (mean ± sd, both n ═ 3).

Figure 12d illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, with natural killer cells and tumor cells tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

Figure 12E illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells tested at a 10: 1E/T (effector/target) ratio to tumor cells (both n-1) versus PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells.

FIG. 13a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells with PD-L1 positive human breast cancer tumor cells as contemplated by the present application.

Fig. 13b illustrates the results of quantitative analysis of in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, natural killer cells and tumor cells were tested at 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3), quantitative analysis of in vitro co-culture cytotoxicity effect was timed to 60 hours, and tumor cell only group was added for reference.

Fig. 13c illustrates the results of quantitative analysis of in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, the natural killer cells and tumor cells were tested at 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3), and the time axis of quantitative analysis of in vitro co-culture cytotoxicity effect was up to 60 hours.

FIG. 14a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human skin cancer tumor cells covered by this application.

Figure 14b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human skin cancer tumor cells a2058 cells, natural killer cells and tumor cells were tested at a 1: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

Fig. 14c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human skin cancer tumor cells a2058 cells, natural killer cells and tumor cells were tested at an E/T (effector cells/target cells) ratio of 2.5:1 (mean ± sd, both n ═ 3).

Figure 14d illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human skin cancer tumor cells a2058 cells, natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

Fig. 14E illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human skin cancer tumor cells a2058 cells, natural killer cells and tumor cells were tested at a ratio of E/T (effector cells/target cells) of 10:1 (both n ═ 1).

FIG. 15a illustrates the experimental analysis and testing procedures and mode settings for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human prostate cancer tumor cells covered by this application.

Figure 15b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PC-3 cells, which are positive for PD-L1, of human prostate cancer tumor cells, natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3), and tumor cell-only groups were added for analytical reference.

Figure 15c illustrates the results of quantitative analysis of the cytotoxic effects of different chimeric antigen receptor modified human natural killer cells in vitro and PD-L1 positive human prostate cancer tumor cells PC-3 cells in co-culture, natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

FIG. 16a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and human brain cancer tumor cells positive for PD-L1, as covered by the present application.

Figure 16b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human brain cancer tumor cells U87-MG cells, natural killer cells and tumor cells were tested at 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3), and tumor cell only groups were added for analytical reference.

Figure 16c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human brain cancer tumor cells U87-MG cells, with natural killer cells and tumor cells tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

FIG. 17a illustrates the experimental analysis and testing procedure and mode setup for in vitro co-culture cytotoxicity assay of natural killer cells and PD-L1 positive human hepatoma tumor cells covered by this application.

Fig. 17b illustrates the quantitative analysis results of the cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human hepatoma tumor cell HA-22T cells co-cultured in vitro, the natural killer cells and the tumor cells were tested according to the ratio of E/T (effector cells/target cells) of 5:1 (mean ± standard deviation, all n ═ 3), and only the tumor cells were added for analysis reference.

Fig. 17c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human hepatoma tumor cell HA-22T cells, wherein the natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

FIG. 18a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human renal carcinoma tumor cells covered by this application.

Fig. 18b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human renal carcinoma tumor cells 786-O cells, natural killer cells and tumor cells were tested at 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3), and tumor cell only groups were added for analytical reference.

Figure 18c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human renal carcinoma tumor cells 786-O cells, with natural killer cells and tumor cells tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

FIG. 19a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human lung cancer tumor cells covered by the present application.

Fig. 19b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human lung cancer tumor cells H441 cells, the natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n-3), and only tumor cells were added for reference.

Figure 19c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human naive killer cells and PD-L1 positive human lung cancer tumor cells H441 cells, the natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

FIG. 20a illustrates the experimental analysis and testing procedures and mode settings for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human ovarian cancer tumor cells contemplated by the present application.

Figure 20b illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human ovarian cancer tumor cells ES-2 cells, natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n-3), and tumor cell only groups were added for analytical reference.

Figure 20c illustrates the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human ovarian cancer tumor cells ES-2 cells, with natural killer cells and tumor cells tested at a 5: 1E/T (effector/target) ratio (mean ± sd, both n ═ 3).

Figure 21a shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger ribonucleic acid GZMB by lysis and rna extraction of different chimeric antigen receptor-modified human natural killer cells using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

Figure 21b shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger ribonucleic acid GZMB, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene, after 48 hours of in vitro co-culture of different chimeric antigen receptor modified human naive killer cells with PD-L1 positive human breast cancer tumor cell MDA-MB-231 cells, after cell lysis and rna extraction.

FIG. 22a shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n-3) for expression of messenger ribonucleic acid PRF1 using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as an endogenous reference gene for cell lysis and ribonucleic acid extraction of different chimeric antigen receptor-modified human natural killer cells.

Figure 22b shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger rna PRF1 by cell lysis and rna extraction of human natural killer cells after 48 hours of in vitro co-culture of the different chimeric antigen receptor-modified human natural killer cells with PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

FIG. 23a shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n ═ 3) for expression of messenger ribonucleic acid TNFA by lysis and RNA extraction of different chimeric antigen receptor-modified human natural killer cells using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

Figure 23b shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger ribonucleic acid TNFA, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene, after 48 hours of in vitro co-culture of different chimeric antigen receptor modified human naive killer cells with PD-L1 positive human breast cancer tumor cell MDA-MB-231 cells, after cell lysis and rna extraction.

FIG. 24a shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n ═ 3) for expression of messenger ribonucleic acid IFNG in human natural killer cells modified with different chimeric antigen receptors by cell lysis and ribonucleic acid extraction, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

FIG. 24b shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n ═ 3) for expression of messenger ribonucleic acid IFNG by cell lysis and ribonucleic acid extraction of human natural killer cells after 48 hours of in vitro co-culture of the different chimeric antigen receptor-modified human natural killer cells with human breast cancer tumor cell MDA-MB-231 cells positive for PD-L1, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

Figure 25a shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger ribonucleic acid NCAM1 using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene for different chimeric antigen receptor modified human naive killer cells after cell lysis and rna extraction.

FIG. 25b shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n ═ 3) for expression of messenger ribonucleic acid NCAM1 by cell lysis and RNA extraction of human natural killer cells after 48 hours of in vitro co-culture of the different chimeric antigen receptor-modified human natural killer cells with PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

FIG. 26a shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n-3) for expression of messenger ribonucleic acid KLRK1 using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene for different chimeric antigen receptor modified human natural killer cells by cell lysis and ribonucleic acid extraction.

FIG. 26b shows quantitative real-time polymerase chain reaction (mean. + -. standard deviation, n ═ 3) for expression of messenger ribonucleic acid KLRK1 by cell lysis and RNA extraction of human natural killer cells after 48 hours of in vitro co-culture of different chimeric antigen receptor-modified human natural killer cells with PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

Figure 27a shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger ribonucleic acid NCR1 using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene for different chimeric antigen receptor modified human naive killer cells after cell lysis and rna extraction.

Figure 27b shows quantitative real-time polymerase chain reaction (mean ± sd, n ═ 3) for expression of messenger rna NCR1 by cell lysis and rna extraction of human natural killer cells after 48 hours of in vitro co-culture of the different chimeric antigen receptor-modified human natural killer cells with PD-L1 positive human breast cancer tumor cells MDA-MB-231 cells, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as endogenous reference gene.

FIG. 28a shows that the human natural killer cell C #3 modified by the chimeric antigen receptor has high expression of CRTAM, PIK3R6, GZMB and KLRF2 relative to the mRNA of the control group, and conforms to the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0002228 natural killer cell mediated immunity.

FIG. 28b shows that the human natural killer cell C #5 modified by chimeric antigen receptor has high expression of CRTAM, PIK3R6, GZMB and KLRF2 relative to the mRNA of the control group, and meets the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0002228 natural killer cell-mediated immunity.

FIG. 28C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 and C #2 have high expression levels of CRTAM, PIK3R6, GZMB and KLRF2, respectively, and meet the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0002228 natural killer cell-mediated immunity.

FIG. 28d shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #5 and C #2 have high expression levels of CRTAM, PIK3R6, GZMB and KLRF2, respectively, and meet the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0002228 natural killer cell-mediated immunity.

FIG. 29a shows that the human natural killer cell C #3 modified by chimeric antigen receptor has high expression of FOXP3, TNF, CCR7, IL10, LTA, IL18R1, IL1RL1, SLAMF1, XCL1 and EBI3 relative to the messenger ribonucleic acid of a control group, and accords with the Gene enrichment category regulated by the Gene function classification system (Gene Ontology) GO:0032649 gamma interferon production.

FIG. 29b shows that the human natural killer cell C #5 modified by chimeric antigen receptor has high expression of FOXP3, TNF, CCR7, IL10, LTA, IL18R1, IL1RL1, SLAMF1, XCL1 and EBI3 relative to the messenger RNA of a control group, and conforms to the Gene enrichment category regulated by the Gene function classification system (Gene Ontology) GO:0032649 gamma interferon production.

FIG. 29C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 relative to C #2 have high expressions of FOXP3, TNF, CCR7, IL10, LTA, IL18R1, IL1RL1, SLAMF1, XCL1 and EBI3 respectively, and meet the Gene enrichment category regulated by Gene function classification system (Gene Ontology) GO:0032649 gamma interferon production.

FIG. 29d shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #5 relative to C #2 have high expressions of FOXP3, TNF, CCR7, IL10, LTA, IL18R1, IL1RL1, SLAMF1, XCL1 and EBI3 respectively, and meet the Gene enrichment category regulated by Gene function classification system (Gene Ontology) GO:0032649 gamma interferon production.

FIG. 30a shows that human natural killer cell C #3 modified by chimeric antigen receptor has high expression of CCL3L1, CCR7, CCL4L1, CCL1, CCL22, CXCR6, CCL4, XCL1, CCL3 and XCL2 relative to the mRNA of the control group, and conforms to the Gene enrichment category of the chemokine mediated signal pathway of Gene Ontology (Gene Ontology) GO: 0070098.

FIG. 30b shows that human natural killer cell C #5 modified by chimeric antigen receptor has high expression levels of CCL3L1, CCR7, CCL4L1, CCL1, CCL22, CXCR6, CCL4, XCL1, CCL3 and XCL2 relative to the mRNA of the control group, and conforms to the Gene enrichment category of the chemokine-mediated signal pathway of Gene Ontology (Gene Ontology) GO: 0070098.

FIG. 30C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 and C #2 have high expression levels of CCL3L1, CCR7, CCL4L1, CCL1, CCL22, CXCR6, CCL4, XCL1, CCL3 and XCL2, respectively, and meet the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0070098 chemokine-mediated signal pathway.

FIG. 30d shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #5 and C #2 have high expressions of CCL3L1, CCR7, CCL4L1, CCL1, CCL22, CXCR6, CCL4, XCL1, CCL3 and XCL2, respectively, and meet the Gene enrichment category of the chemokine-mediated signal pathway of Gene Ontology (Gene Ontology) GO: 0070098.

FIG. 31a shows that the human natural killer cell C #3 modified by chimeric antigen receptor has high expression of FOXP3, TNF, CRTAM, IL10, PIK3R6, LTA, IFNG, SLAMF1, GZMB, KLRF2, XCL1, P2RX7, FCER1G, FAS, C1QA, relative to the mRNA of the control group, and conforms to the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0002449 lymphocyte-mediated immunity.

FIG. 31b shows that the human natural killer cell C #5 modified by chimeric antigen receptor has high expression of FOXP3, TNF, CRTAM, IL10, PIK3R6, LTA, IFNG, SLAMF1, GZMB, KLRF2, XCL1, P2RX7, FCER1G, FAS, C1QA, relative to the mRNA of the control group, and meets the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0002449 lymphocyte-mediated immunity.

FIG. 31C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 relative to C #2 have high expression of FOXP3, TNF, CRTAM, IL10, PIK3R6, LTA, IFNG, SLAMF1, GZMB, KLRF2, XCL1, P2RX7, FCER1G, FAS, C1QA, and meet the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0002449 lymphocyte-mediated immunity.

FIG. 31d shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #5 relative to C #2 have high expression of FOXP3, TNF, CRTAM, IL10, PIK3R6, LTA, IFNG, SLAMF1, GZMB, KLRF2, XCL1, P2RX7, FCER1G, FAS, C1QA, and meet the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0002449 lymphocyte-mediated immunity.

FIG. 32a shows that the chimeric antigen receptor modified human natural killer cell C #3 has high expression of FOXP3, CCR7, PIK3R6, IFNG, GPR183, SLAMF1, CTLA4, GPAM, XCL1, MYB, EBI3, TNFSF14 and CD80, relative to the messenger RNA of the control group, and meets the Gene enrichment category of forward regulation of lymphocyte activation of Gene function classification system (Gene Ontology) GO: 0051251.

FIG. 32b shows that the chimeric antigen receptor modified human natural killer cell C #5 has high expression of FOXP3, CCR7, PIK3R6, IFNG, GPR183, SLAMF1, CTLA4, GPAM, XCL1, MYB, EBI3, TNFSF14 and CD80, respectively, relative to the messenger ribonucleic acid of the control group, and meets the Gene enrichment category of forward regulation of activation of lymphocyte of Gene functional Classification System (Gene Ontology) GO: 0051251.

FIG. 32C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 relative to C #2 have high expression of FOXP3, CCR7, PIK3R6, IFNG, GPR183, SLAMF1, CTLA4, GPAM, XCL1, MYB, EBI3, TNFSF14, and CD80, respectively, and meet the Gene enrichment category of forward regulation of lymphocyte activation by Gene functional Classification (Gene Ontology) GO: 0051251.

FIG. 32d shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #5 relative to C #2 have high expression of FOXP3, CCR7, PIK3R6, IFNG, GPR183, SLAMF1, CTLA4, GPAM, XCL1, MYB, EBI3, TNFSF14, and CD80, respectively, and meet the Gene enrichment category of forward regulation of lymphocyte activation by Gene functional Classification (Gene Ontology) GO: 0051251.

FIG. 33a shows that the chimeric antigen receptor modified human natural killer cell C #3 has high expression of TREM1, CRTAM, S100A12, PIK3R6, IFNG, GZMB, KLRF2, XCL1, P2RX7 and GNLY relative to the mRNA of the control group, and meets the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0001906 cell killing.

FIG. 33b shows that the chimeric antigen receptor modified human natural killer cell C #5 has high expression of TREM1, CRTAM, S100A12, PIK3R6, IFNG, GZMB, KLRF2, XCL1, P2RX7 and GNLY relative to the mRNA of the control group, and meets the Gene enrichment category of the Gene function classification system (Gene Ontology) GO:0001906 cell killing.

FIG. 33C shows that the messenger RNAs of chimeric antigen receptor modified human natural killer cells C #3 relative to C #2 have high expression of TREM1, CRTAM, S100A12, PIK3R6, IFNG, GZMB, KLRF2, XCL1, P2RX7 and GNLY, respectively, and meet the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0001906 cell killing.

FIG. 33d shows that the mRNA of chimeric antigen receptor modified human natural killer cell C #5 has high expression of TREM1, CRTAM, S100A12, PIK3R6, IFNG, GZMB, KLRF2, XCL1, P2RX7 and GNLY compared with that of C #2, and meets the Gene enrichment category of Gene function classification system (Gene Ontology) GO:0001906 cell killing.

Figure 34 shows table 1, containing different versions of chimeric protein constructs showing examples of chimeric proteins according to the present disclosure, including chimeric antigen receptors based on immune checkpoint PD-1 fusions.

FIG. 35 shows a vector map of a lentiviral vector comprising two representative versions: (a) a version of the chimeric antigen receptor C #3 based on an immune checkpoint PD-1 fusion and (b) a version of the chimeric antigen receptor C #5 based on an immune checkpoint PD-1 fusion. For the information on the components contained in versions C #3 and C #5 of the chimeric antigen receptor based on the immune checkpoint PD-1 fusion, see figure 34 and related disclosure.

Detailed Description

The present application will be described in detail with reference to examples, but the present application is not limited to these examples. The present invention should in no way be construed as being limited to the following examples, but rather should be construed to cover any and all modifications which are obvious in view of the teachings provided herein.

Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following exemplary embodiments, make and use the compounds of the present invention and practice the claimed methods. The following working examples therefore particularly point out preferred embodiments of the invention and are not to be construed as limiting the remainder of the disclosure in any way.

The raw materials in the examples of the present application were all purchased commercially, unless otherwise specified.

The NK cells used in the specific examples of the present application are NK-92 cell lines;

the detection methods of FIGS. 4-7 are microscope imaging methods using fluorescence resonance energy transfer (Ishikawa-Ankerhold HC et al, molecules.2012Apr; 17(4):4047-132.) to detect the corresponding intracellular detection signaling domain # V phosphorylation expression and the state change of the molecular conformation of the intracellular activation signaling domain # VII part and the corresponding activation state expression when different artificial molecular machines respond to different external stimuli input signals.

The materials and methods used in these experiments are now described.

In the examples of the present application, the "molecular machine" and the "chimeric antigen receptor" are all chimeric proteins, which are exemplary of the present application and comprise different versions of the chimeric antigen receptor construct. In addition, an extracellular target molecule binding domain (such as a PD-1 extracellular fragment or a targeting scFv), an extracellular spacer domain, a transmembrane domain, an intracellular spacer domain, an intracellular signaling domain (belonging to a detection module), an intracellular hinge domain, an intracellular activation signaling domain (belonging to an activation module), and an intracellular signaling domain are sequentially numbered as domain # I to domain # VIII, respectively, and the corresponding contents are applicable in the present application unless otherwise specified.

According to one aspect of the present application, a chimeric antigen receptor (molecular machine) is constructed comprising:

a) an extracellular domain for specifically binding a target molecule;

b) an intracellular signaling domain comprising at least one immune cell activating signaling pathway element; activation of the immune cell activation signaling pathway element is dependent on at least binding of the extracellular domain to the target molecule; and

c) a transmembrane domain for connecting and immobilizing the extracellular domain and the intracellular signaling domain on a cell membrane.

d) An extracellular spacer domain, the extracellular target molecule binding domain and the transmembrane region domain being connected by the extracellular spacer domain.

e) An intracellular spacer domain, the transmembrane region domain and the intracellular signaling domain being linked by the intracellular spacer domain.

The target molecules recognized by the chimeric antigen receptor comprise at least one of target molecules such as tumor surface antigen molecular markers, cell surface specific antigen peptide-histocompatibility complex molecules or immune suppression signal related molecules.

The extracellular binding domain is selected from a monoclonal antibody and an antigen recognition binding fragment thereof for resisting an immunosuppressive signal related molecule commonly used in the existing chimeric antigen receptor, a monoclonal antibody and a single-chain variable fragment and an antigen recognition binding fragment thereof for resisting a tumor surface antigen molecular marker, and the extracellular binding domain is selected from the group consisting of a monoclonal antibody and an antigen recognition binding fragment thereof for resisting a tumor surface antigen molecular marker. Preferably at least one of the molecules capable of recognizing the molecular marker of the tumor surface antigen and the molecule related to the immunosuppressive signal. The antigen-binding fragment may be at least one of a molecule capable of recognizing a tumor surface antigen molecular marker, a cell surface specific antigen peptide-histocompatibility complex molecule, or a molecule capable of binding to a target molecule such as an immunosuppressive signal-related molecule, or a monoclonal antibody or a single-chain variable fragment and an antigen recognition-binding fragment thereof which are commonly used in the conventional chimeric antigen receptor, a monoclonal antibody against an immunosuppressive signal-related molecule and an antigen recognition-binding fragment thereof, a monoclonal antibody against a tumor surface antigen molecular marker and an antigen recognition-binding fragment thereof, or a monoclonal antibody against a cell surface specific antigen peptide-histocompatibility complex molecule and an antigen recognition-binding fragment thereof. Preferably, the antigen-histocompatibility complex molecule binds to at least one of an immunosuppressive signal-associated molecule, a tumor surface antigen molecule marker molecule, or a cell surface-specific antigen peptide.

An intracellular signaling domain comprising at least one intracellular activation signaling domain, preferably an immune cell activation signaling pathway element; the intracellular activation signal domain comprises a molecule having a catalytic functional group or a fragment thereof; activation of the intracellular activation signal domain is dependent on at least binding of the extracellular target molecule binding domain to the target molecule. The intracellular signaling domain contains molecules with catalytic functional groups or fragments thereof, which can enable the chimeric antigen receptor to be separated from the limitation of specific cell types and be expanded into the cell types with applicability to the molecules with catalytic functional groups, namely, the range of host cell types which can be genetically modified to express the chimeric antigen receptor and can be endowed with the chimeric antigen receptor is expanded.

The transmembrane domain, an existing transmembrane protein, can be used in this technique without further requirements.

In certain embodiments, the chimeric antigen receptor targets a killing signaling molecule associated with apoptotic, dead, dying, injured, infected, diseased, or necrotic cells. In certain embodiments, the chimeric antigen receptor targets antibody-bound cells associated with an infectious microorganism or particle. In additional embodiments, the chimeric antigen receptor targets abnormal cells associated with a disease, disorder, or other adverse condition, a neogenetic tumor-associated antigen, an antigen signaling molecule displayed by a misfolded protein.

One or more chimeric antigen receptors according to the present description may be transformed into and expressed in NK cells. In certain embodiments, the extracellular target molecule binding domain of the chimeric antigen receptor is engineered to bind to a particular target molecule. In certain embodiments, the intracellular signaling domain of the chimeric antigen receptor is selected to provide a desired killing activity. In some embodiments, in addition to engineering the extracellular target molecule binding domain of the chimeric antigen receptor to be available for binding to a particular target molecule, the intracellular signaling domain of the chimeric antigen receptor is selected to provide a desired killing activity. In one such embodiment, the intracellular signaling domain comprises at least one or more intracellular activation signaling domains. In one such embodiment, the intracellular signaling domain comprises one or more intracellular detection signaling domains and an intracellular activation signaling domain; the intracellular detection signaling domain is linked to the intracellular activation signaling domain. In one such embodiment, the intracellular signaling domain comprises one or more intracellular detection signaling domains and an intracellular activation signaling domain; the intracellular detection signaling domain and the intracellular activation signaling domain are connected via an intracellular hinge domain.

NK cells genetically modified to express one or more of the chimeric antigen receptors according to the present description can be used to specifically kill target cells or particles expressing target molecules to which the extracellular domain of the chimeric antigen receptor binds. In certain embodiments, the target cell or particle can be a tumor cell, a cancer cell, a microorganism (e.g., bacteria, fungi, viruses), a protozoan parasite, an abnormal cell, a neogenetic tumor antigen, or a misfolded protein associated with an infection, disease, disorder, or other adverse condition. In a further embodiment, NK cells genetically modified to express one or more chimeric antigen receptors according to the present specification are used for the treatment of cancer, infectious diseases (viral, bacterial, fungal, protozoan), inflammatory diseases, immune diseases (e.g., autoimmune diseases) or neurodegenerative diseases (e.g., alzheimer's disease) in a subject, either as a primary therapy or as an adjuvant or combination therapy. The chimeric antigen receptors of the present disclosure can be designed to confer a specific killing phenotype by selecting extracellular target molecule binding domains, depending on the target molecule and therapeutic indication, to use the chimeric antigen receptor for improving the cancer microenvironment and enhancing tumor regression.

Definition of

Before setting forth the disclosure in more detail, definitions of certain terms used in the present application are provided, which may be helpful in understanding the present disclosure.

Phase contrast imaging: is a technique for imaging based on a phase contrast method.

Sequence homology: in the present application, two or more nucleic acid molecules, two or more protein sequences, or both, will be referred to as having significant similarity in coding sequence, e.g., at least 80% or more, at least 81% or more, at least 82% or more, at least 83% or more, at least 84% or more, at least 85% or more, at least 86% or more, at least 87% or more, at least 88% or more, at least 89% or more, at least 90% or more, at least 91% or more, at least 92% or more, at least 93% or more, at least 94% or more, at least 95% or more, at least 96% or more, at least 97% or more, at least 98% or more, at least 99% or more, at least 99.5% or at least 100% sequence encoded identity.

PD-L1 binding fragment: will be referred to herein as a molecule or molecular fragment that specifically binds to PD-L1, such as an antibody fragment, and the like.

And (3) a catalytic function: refers to a chemical reaction in the body, in which an enzyme is used as a catalyst to accelerate the chemical reaction. Among them, tyrosine kinase (tyrosine kinase) is an enzyme that catalyzes the transfer of a phosphate group from ATP to a tyrosine residue of a protein in a cell, thereby playing a role in regulating the "on" and "off" of a signal pathway in the cell. Tyrosine kinases used in the present application include ZAP70 and SYK, among others.

Tumor microenvironment (Tumor micro environment): refers to the surrounding microenvironment in which tumor cells reside, including immune cells, fibroblasts, bone marrow-derived inflammatory cells, surrounding blood vessels, extracellular matrix, and various signaling molecules. The tumor and its surrounding environment interact with each other continuously and are closely related, the microenvironment (e.g., immune cells therein) may affect the growth and development of cancer cells, and the tumor may affect its microenvironment by releasing cell signaling molecules, e.g., promoting angiogenesis of the tumor and inducing immune tolerance. The tumor microenvironment contributes to the development of tumor heterogeneity.

Conformation: refers to the spatial arrangement resulting from the placement of atoms around a single bond in a molecule without changing its covalent bond structure. Dominant conformation refers to the conformation that has the lowest potential energy, the most stable, among the conformations of different forms. The different conformations can be mutually converted, and the covalent bond does not need to be broken and reformed during the process of changing from one conformation to another conformation. The conformation of the molecule not only has an influence on the physicochemical properties of the compound, but also has an important influence on the structure and performance of biological macromolecules (such as nucleic acids, proteins, enzymes, etc.).

Cell surface specific antigenic peptide-histocompatibility complex molecules: in the antigen presenting path, epitope peptides are first cut by proteasome, then combined with antigen processing associated transfer protein (TAP), combined with Major Histocompatibility Complex (MHC) molecules, and finally transported to the surface of antigen presenting molecules to form specific antigen peptide-histocompatibility complex molecules, and immune cells can recognize specific antigen peptides presented by specific antigen peptide-histocompatibility complex molecules on the cell surface.

Immunosuppressive signal-associated molecules: an immune checkpoint is a stimulatory or inhibitory signal-associated molecule, with inhibitory proteins not conducting signals, and costimulatory proteins conducting signals to promote an immune response to a pathogen.

A truncation body: in this application refers to fragments that are shortened by deletion of a sequence.

Protein mutants: in this application, it is intended to alter the amino acid sequence of the original protein in order to obtain a mutant protein which is non-functional or functional.

Immune checkpoint: refers to the related molecules of the intrinsic regulatory mechanisms of the immune system, such as the immune checkpoints PD-1 and CTLA-4, which not only maintain self-tolerance but also avoid the collateral damage that may be brought about during physiological immune responses. It is now known that tumours can be manipulated by building microenvironments to evade immune surveillance and attack, particularly by modulating certain specific immune checkpoint pathways.

Tumor immune escape (Tumor immunity escape): this is a phenomenon in which tumor cells can escape recognition and attack by the body's immune system through a variety of different mechanisms, thereby achieving the goal of survival and proliferation in vivo. When malignant cells appear, the immune system of the body can recognize and then specifically eliminate the malignant cells through an immune mechanism so as to prevent the tumor from developing. However, malignant cells may also evade immune surveillance by the body by different mechanisms, and proliferate continuously in vivo to form tumors.

Immunosuppression: refers to the suppression of the immune response, i.e., the body will in some cases not respond to its own tissue components, thus maintaining its tolerance, simply referred to as the state in which the immune system is not responding to the specificity of certain specific antigens.

NK cells: namely, Natural Killer cells (NK cells) are important immune cells of the body, are not only related to tumor resistance, virus infection resistance and immune regulation, but also participate in the occurrence of hypersensitivity and autoimmune diseases under certain conditions, and can recognize target cells and kill and eliminate mediators.

"nucleic acid molecule" and "polynucleotide": in the present application, RNA or DNA forms are included, specifically genomic DNA, cDNA and synthetic DNA. Nucleic acid molecules include double-stranded nucleic acid molecules or single-stranded nucleic acid molecules, including coding or antisense strands.

Embedding: in this application, reference is made to a protein or nucleic acid molecule comprising sequences that are not endogenous (and which are not normally associated or linked together in nature). For example, a chimeric nucleic acid molecule can comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.

Positive: in this application, it is meant that the expression of a particular molecular marker in a particular cell reaches a certain level. For example, a PD-L1 positive tumor cell refers to a tumor cell that has a certain level of expression of the PD-L1 protein molecule.

Cancer: in this application, refers to diseases characterized by uncontrolled and rapid growth of abnormal cells. These abnormal cells may form hematological malignancies or constitute solid tumors. Cancer cells spread to various parts of the body through the lymphatic system and the blood stream, or spread only locally. Examples of various cancers include, but are not limited to, ovarian cancer, cervical cancer, breast cancer, prostate cancer, colorectal cancer, renal cancer, skin cancer, brain cancer, lung cancer, pancreatic cancer, lymphoma, leukemia, liver cancer, and the like.

Treatment: in this application, means to obtain a beneficial or desired clinical effect. For purposes of the present invention, beneficial or desired clinical effects include, but are not limited to, one or more of the following: preventing metastasis of tumor cells, inhibiting proliferation or spread of tumors or cancer cells (or destroying cancer cell tumors), resolving PD-L1-related diseases (e.g., cancer), alleviating symptoms caused by PD-L1-related diseases (e.g., cancer), reducing the size of tumors expressing PD-L1, reducing the dosage of drugs required to treat PD-L1-related diseases (e.g., cancer), increasing the quality of life of PD-L1-related diseases (e.g., cancer) patients, slowing the progression of PD-L1-related diseases (e.g., cancer), and/or prolonging the survival of PD-L1-related diseases (e.g., cancer) patients, curing PD-L1-related diseases (e.g., cancer).

High expression: in this application, it is meant that a particular cell has a high level of expression of a particular molecular marker. For example, a tumor cell with high expression of PD-L1 refers to a tumor cell with high expression level of PD-L1 protein molecule. Highly expressed tumor cell markers are typically associated with disease states, e.g., in cells that form solid tumors in specific organs or tissues and in cells of hematological malignancies, and solid tumors or hematological malignancies characterized by high expression of tumor markers can be determined by assays using criteria well known in the art.

Carrier: in this application, refers to a nucleic acid molecule capable of transporting another nucleic acid. Vectors include plasmids, viruses, bacteriophages, cosmids. Non-viral and non-plasmid compounds that can facilitate the transfer of nucleic acids into cells are also included. "expression vector" refers to a protein expression vector that, when placed in an appropriate environment, can direct the expression of a protein encoded by one or more genes carried by the vector. Viral vectors include adeno-associated viral vectors, adenoviral vectors, retroviral vectors, lentiviral vectors, and gamma retroviral vectors. "retrovirus" refers to a virus having an RNA genome. "lentivirus" refers to a genus of retroviruses that are capable of infecting both dividing and non-dividing cells. Lentiviruses include Bovine Immunodeficiency Virus (BIV), Simian Immunodeficiency Virus (SIV), human immunodeficiency virus (HIV, including HIV types 1 and 2), Feline Immunodeficiency Virus (FIV), equine infectious anemia virus. "Gamma retrovirus" refers to a genus of the family Retroviridae. Gamma retroviruses include, but are not limited to, feline leukemia virus, feline sarcoma virus, murine leukemia virus, avian reticuloendotheliosis virus, and murine stem cell virus. Non-viral vectors include modified mRNA (modrna), self-amplifying mRNA, lipid-based DNA vectors, transposon-mediated gene transfer (PiggyBac, Sleeping Beauty), closed linear duplex (CELiD) DNA. Liposomes can be used as delivery vehicles when non-viral delivery systems are employed. The nucleic acid is introduced into the host cell in vitro, ex vivo or in vivo by using a lipid preparation. The nucleic acid is encapsulated inside the liposome, dispersed within the lipid bilayer of the liposome, and bound to the lipid by attaching to the liposome a linker molecule that binds the nucleic acid and the liposome together.

Extracellular target molecule binding domain: in this application, reference is made to molecules, such as peptides, oligopeptides, polypeptides or proteins, having the ability to specifically and non-covalently bind, associate, or otherwise recognize a target molecule, including: IgA antibody, CD138, CD38, L1CAM, CD22, CD19, PD-1, CD79b, mesothelin, PSMA, CD33, CD123, BCMA, ROR1, MUC-16, IgG antibody, IgE antibody, EGFRviii, VEGFR-2, or GD 2. Target molecule binding domains include any semisynthetic, synthetic, recombinantly produced, naturally occurring binding partner that may be directed against a target biomolecule or other target. The target molecule binding domain may be an antigen binding domain, including antibodies, functional binding domains thereof, antigen binding portions, and the like. The binding domain may comprise a single chain antibody variable region (e.g., sFv, Fab, scFv, domain antibodies), a ligand (e.g., chemokine, cytokine), a receptor extracellular domain (e.g., PD-1), or a synthetic polypeptide selected for its ability to specifically bind to a biomolecule.

Intracellular activation signaling domain: in the present application, it is meant that the cells expressing the activation signaling domain, selected from non-receptor tyrosine kinases or receptor tyrosine kinase molecules or fragments with catalytic function, are capable of promoting a biological or physiological response when subjected to an appropriate signal. The activation signaling domain may be part of a protein or protein complex that receives a signal upon binding. For example, an activation signaling domain may respond to the binding of a PD-1 fused chimeric antigen receptor to the target molecule PD-L1, thereby signaling the interior of the host cell, triggering effector functions such as secretion of inflammatory cytokines and/or chemokines, secretion of anti-inflammatory and/or immunosuppressive cytokines, NK cell action effective to kill tumor cells. The activation signaling domain may also indirectly promote a cellular response by binding to one or more other proteins that directly promote a cellular response.

Detection of signaling domain: in the present application, it is referred to that an immunoreceptor tyrosine-based activation motif (ITAM) is a conserved sequence consisting of more than ten amino acids. At that time, the detection signal transduction domain of the chimeric antigen receptor molecular machine can respond to the input of tyrosine kinase activation signals and undergo phosphorylation modification, further, the phosphorylation site modification-based interaction is carried out on the detection signal transduction domain and the activation signal transduction domain, the activation signal transduction domain is released from the self-inhibited molecular conformation state, the activation signal transduction domain is released, and the activation signal transduction domain of the molecular machine in the molecular conformation after the activation signal transduction domain is released is in an open activation state. The primary detection signal transduction sequence may include a signaling motif known as an Immunoreceptor Tyrosine Activation Motif (ITAM). ITAMs are well-defined signaling motifs found in the intracytoplasmic tail of various receptors that serve as binding sites for tyrosine kinases. Examples of ITAMs used in the present invention may include: 2B4, CD244, BTLA, CD3 delta, CD3 gamma, CD3 epsilon, CD3 zeta, CD3, CD229, CD300 3, CEACAM-1, CEACAM-3, CEACAM-4, CEACAM-19, CEACAM-20, CLEC-1, CLEC-2, CRACCC, CTLA-4, DAP 3, DCAR, DCIR, Dectin-1, DNAM-1, Fc epsilon RI alpha, Fc epsilon beta, Fc RIB, Fc gamma RI, Fc gamma RIIA, Fc gamma RIIB, Fc gamma RIIC, Fc gamma RILRIIA, FCRL3, FCRL4, FCLIDL 4, FCRL3, FCDL 6, SigR, KIDL 2, CD3, CD 6852 delta, CD 6852 delta 6852, CD3, CD 6853-3, CD3, CDK 6853, CDK 3, CDK 6853-3, CDK 6853, CDK 3, CDK-6853, CDK-3, CDK 6853, CDK-3, CDK-3, CDK 6853, CDK 3, CDK 6852, CDK 6853, CDK 3, CDK-2, CDK-3, CDK 6853, CDK 3, CDK-2, CDK 6853, CDK-6853, CDK 3, CDK-6853, CDK-D-2, CDK 3, CDK 6853, CDK 3, CDK-6853, CDK 3, CDK-6853, CDK-3, pK 6853, CDK-3, CDK-2, CDK 3, Fc gamma-6852, CDK 6853, CDK 3, Fc gamma-2, CDK 3, Fc gamma-D-3, CDK-2, CDK 3, CDK-2, CDK 3, CDK-2, CDK 6853, CDK-2, CDK 3, CDK-2, Siglec-8, Siglec-9, Siglec-10, Siglec-11, Siglec-12, Siglec-14, Siglec-15, Siglec-16, SIRP α, SLAM, TIGIT, TREML1, TREML 2.

Intracellular signaling domain: in this application, refers to the intracellular effector domain, when the immune cell surface chimeric antigen receptor molecular machine of extracellular target molecule binding domain recognition and binding target molecules, thereby through the recognition of binding to provide target molecules recognition binding signal input, then the molecular conformation of the intracellular part can be changed so as to release the activation signaling structural domain from the self-inhibited molecular conformation state, and finally the intracellular activation signaling structural domain is fully released and activated based on the conformational change of the chimeric antigen receptor molecule machine molecule under the condition of responding to the upstream target molecule recognition and binding signal input, and the activation signaling domain in the activated state may further activate various signaling pathways downstream thereof, thus, the immune cell modified by the chimeric antigen receptor performs specific functions on target cells. In certain embodiments, the signaling domain activates one or more signaling pathways that result in killing of a target cell, microorganism, or particle by a host cell. In certain embodiments, the signaling domain comprises at least one intracellular activation signaling domain. In certain other embodiments, the signaling domain comprises at least one intracellular detection signaling domain and at least one intracellular activation signaling domain. In certain other embodiments, the signaling domain comprises at least one intracellular detection signaling domain, an intracellular hinge domain, and at least one intracellular activation signaling domain.

Transmembrane domain: in this application, a polypeptide that spans the entire biological membrane once, is used to link the extracellular target molecule binding domain and the intracellular signaling domain and immobilize both on the cell membrane.

Intracellular spacer domain: in this application, it is meant that the transmembrane domain is an extension of the transmembrane domain, which is located between and connects the transmembrane domain and the intracellular signaling domain.

Intracellular hinge domain: in this application, it is meant to link the intracellular detection signaling domain to the intracellular activation signaling domain, optionally as a flexible linker peptide fragment. The hinge domain may provide the desired flexibility to allow for the desired expression, activity and/or conformational positioning of the chimeric polypeptide. The hinge domain may be of any suitable length to connect at least two domains of interest, and is preferably designed to be sufficiently flexible so as to allow proper folding and/or function and/or activity of one or both domains it connects. The hinge domain is at least 3 or more, 5 or more, 10 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, or 100 or more amino acids in length. In some embodiments, the hinge domain is about 0-200 amino acids in length; preferably, about 10 to 190 amino acids; preferably, about 20 to 180 amino acids; preferably, about 30 to 170 amino acids; preferably, about 40 to 160 amino acids; preferably, about 50 to 150 amino acids; preferably, about 60 to 140 amino acids; preferably, about 70 to 130 amino acids; preferably, about 80 to 120 amino acids; preferably about 90 to 110 amino acids. The hinge domain sequence may also comprise an endogenous protein sequence. The hinge domain sequence may comprise glycine, alanine and/or serine residues. The hinge domain may contain motifs, such as multiple or repeated motifs of GGSG, SGGG, GS, GGS or GGGGS. The hinge domain sequence can include any non-naturally occurring amino acid, or a combination thereof.

Other definitions are throughout this disclosure.

EXAMPLE 1 construction and expression of chimeric antigen receptors

Constructing a chimeric antigen receptor molecular machine and a vector fused with the immune checkpoint PD-1.

(1) By means of genetic engineering and molecular biology, domain # VIII of the intracellular portion of the chimeric antigen receptor (including domain # VII as an activation element, domain # V as a detection element, and domain # VI as a linking element) and domains # I, # III, # II, and # IV as extracellular recognition elements (see fig. 2) are fusion-ligated using Gibson Assembly, and then cloned into a gene expression vector (such as pCAG or pCDNA3 or pMSCV retroviral vector or pSIN lentiviral vector, etc.) for subsequent in vitro and in vivo studies.

Wherein as shown in FIG. 2h, domain # I can be selected from the group consisting of a ligand recognition binding portion of PD-L1 receptor PD-1, domain # II can be selected from the group consisting of an extracellular extension of a transmembrane region portion of PD-1 (i.e., between the extracellular targeting molecule PD-L1 binding domain and the transmembrane region of PD-1), domain # III can be selected from the group consisting of a transmembrane region portion of PD-1, domain # IV can be selected from the group consisting of an intracellular extension of a transmembrane region portion of PD-1 (i.e., an intracellular portion of Full-length PD-1 or Truncated PD-1 in FIG. 34; wherein the Full-length amino acid sequence of C #1Full-length PD-1 is SEQ ID NO:001+ SEQ ID NO:016+ SEQ ID NO:012+ SEQ ID NO:056 and the Full-length DNA nucleic acid sequence is SEQ ID NO:002+ SEQ ID NO:017+ 013+ SEQ ID NO:057, the full-length amino acid sequence of C #2Truncated PD-1 is SEQ ID NO:001+ SEQ ID NO:016+ SEQ ID NO:012+ SEQ ID NO:054 and the full-length DNA nucleic acid sequence is SEQ ID NO:002+ SEQ ID NO:017+ SEQ ID NO:013+ SEQ ID NO:055), the structure domain # VII is selected from tyrosine kinase parts of SYK/ZAP70 family members and the like, the structure domain # V is selected from immunoreceptor tyrosine activation motif fragment parts of molecules such as CD3 zeta, CD3 epsilon, FcRIIA, FcR gamma, DAP12 and the like (namely, from Sub1 to Sub7 in FIG. 34: CD3 ζ ITAM 1-3, CD3 ∈ ITAM, FcRIIAITAM, FcR γ ITAM, DAP12 ITAM), domain # VII and domain # VI of domain # V are optionally flexibly linked peptide fragments (i.e. different length linker peptides in fig. 34: SL, ML, LL1, LL2), see fig. 2 and 34. Finally, various versions of the artificial molecular machines listed in FIG. 34 were constructed, including C #1Full-length PD-1, C #2Truncated PD-1, C #3Truncated PD-1-Sub1-LL1-ZAP70, C #4 Truncated PD-1-Sub1-LL1-ZAP70- Δ KD, C #5Truncated PD-1-Sub5-LL1-SYK, C #6Truncated PD-1-Sub6-LL1-SYK, C #7Truncated PD-1-Sub7-LL1-SYK, C #8Truncated PD-1-Sub 4-SYK, C #9Sub 4-4, C #10 b Sub 1-4, C # 9-Sub 4-4, C # 4-C # 4-4, C # 4-4, C #3Truncated PD-4 and C #3Truncated PD-4, C #14Sub3FF-LL2-ZAP70, C #15Sub4-LL2-SYK, C #16Sub4FF-LL2-SYK, C #17 Full-length PD-1-Sub1-LL2-ZAP70, C #18Full-length PD-1-Sub1FF-LL2-ZAP70, C #19Truncated PD-1-Sub1-LL2-ZAP70, and C #20 Truncated PD-1-Sub1FF-LL2-ZAP 70.

(2) Different chimeric antigen receptor artificial molecular machines were expressed in Mouse Embryonic Fibroblast (MEF) and human HeLa (HeLa) cells by means of lipofection. Then, the expression characteristics of the artificial molecular machine in Mouse Embryonic Fibroblasts (MEFs) and human HeLa (HeLa) cells and the expression in response to external stimuli input signals were characterized using a microscopic imaging method, as detailed in fig. 4, 5, 6 and 7. Human hela cells and mouse embryo fibroblasts MEF were cultured using DMEM medium containing 10% FBS.

On the other hand, the expression of the artificial molecular machine protein in 293T cells of human origin by DNA transfection, purification and use of the purified protein for extracellular functional testing and validation, in particular comparing the expression of different domain # V and domain # VII under specific protein tyrosine phosphorylation signal input, see fig. 6 for details. Human 293T cells were cultured using DMEM medium containing 10% FBS.

Example 2 detection and characterization of chimeric antigen receptors

Based on fig. 2 and 3, a variety of detection characterization means are employed, including, but not limited to, detection and characterization of the functional performance of chimeric antigen receptors extracellularly by the form of purified proteins and detection and characterization of the functional performance of chimeric antigen receptors within eukaryotic cells by different means.

Wherein, fig. 3 shows a schematic diagram of signal activation of an artificial molecular machine. Wherein FIG. 3a shows the release and activation of the activation signal of the artificial molecular machinery in the case of tyrosine kinase activation signal input and FIG. 3b shows the release and activation of the activation signal of the chimeric antigen receptor artificial molecular machinery comprising domain # I (e.g., PD-1 extracellular portion) in the case of target cell target molecule signal input (e.g., PD-L1).

The molecular machine working model of FIG. 3a is a simplified model, and includes domain # VII, domain # VI and domain # V. Wherein the domain # VII can be selected from tyrosine kinase part of SYK/ZAP70 family members, etc., the domain # V can be selected from immune receptor tyrosine activation motif fragment part of molecules such as CD3 zeta, CD3 epsilon, FcRIIA, FcRgamma, DAP12, etc. (i.e. from Sub1 to Sub 7: CD3 zeta ITAM 1-3, CD3 epsilon ITAM, FcRIAITAM, FcRgamma ITAM, DAP12 ITAM in sequence), and the domain # VI connecting the domain # VII and the domain # V can be selected from flexible connecting peptide fragment, see FIG. 34.

Based on the Molecular conformation characteristics of members of the SYK/ZAP70 family, in their unactivated state, SYK or ZAP70 are in a self-inhibiting Molecular conformation state (Yan Q et al, Molecular and cellular biology, 2013Jun 1; 33(11): 2188-; when tyrosine kinase activation signals are input, especially phosphorylation signals of an immunoreceptor tyrosine activation motif are input, the structural domain # V of a molecular machine responds to the signal input and generates phosphorylation modification, phosphorylation of the modified domain # V will then interact with either SYK or ZAP70 based on phosphorylation site modification, especially where the flexibly linked peptide fragment of domain # VI provides sufficient flexibility for conformational change of the molecular machinery, thereby releasing domain # VII by releasing domain # VII, domain # VII of the molecular machine in the molecular conformation after domain # VII is released is in an open activated state, namely the signal activation scheme of the artificial molecular machine in the case of tyrosine kinase activation signal input as shown in FIG. 3a, and domain # VII in the activated state may further activate various signaling pathways downstream thereof. Based on the working principle, a fluorescence energy resonance transfer microscope imaging method (Ishikawa-Ankerhold HC, etc., molecules.2012Apr; 17(4): 4047-.

The molecular machine working model of fig. 3b is a model similar to the working principle of fig. 3a, and comprises seven parts: domain # I to domain # VII. As shown in FIG. 2h, domain # I may be selected as the ligand recognition binding portion of PD-L1 receptor PD-1, domain # II may be selected as the extracellular extension of the transmembrane portion of PD-1 (i.e., between the extracellular targeting molecule PD-L1 binding domain and the transmembrane region of PD-1), domain # III may be selected as the transmembrane portion of PD-1, domain # IV may be selected as the intracellular extension of the transmembrane portion of PD-1 (i.e., the intracellular portion of Truncated PD-1 in FIG. 34), domain # VII may be selected as the tyrosine kinase portion of a SYK/ZAP70 family member or the like, domain # V may be selected as the immunoreceptor tyrosine activation motif portion of the like 4 molecules such as CD3 ζ, CD3 ε, FcR γ, DAP12, etc. (i.e., domain # VI 1 to zeta b 7: CD3 ITAM 3-3, CD IIAM 3 ITAM, DAP 829, AIM, DAP 829, and flexible domain # VI is connected to the flexible structure # VI Different length linker peptides of (1): SL, ML, LL1, LL2), see fig. 2h and fig. 34.

Again, based on the molecular conformation characteristics of members of the SYK/ZAP70 family, in their unactivated state, SYK or ZAP70 will be in a self-inhibiting molecular conformation state in which domain # VII of the molecular machinery is in a closed, unactivated state; when the target molecule of the target cell exists, the domain # I of the chimeric antigen receptor molecule machine on the surface of the immune cell can recognize and bind to the target molecule, so that the recognition binding provides the recognition binding signal input of the target molecule, then the molecular conformation of the intracellular part can be changed similarly to the change in the figure 3a, finally, under the condition of responding to the upstream recognition binding signal input of the target molecule, the intracellular domain # VII can be fully released and activated based on the domain # VII with the conformational change of the chimeric antigen receptor molecule machine, and the domain # VII in the activated state can further activate various signal paths at the downstream, so that the immune cell modified by the modification of the chimeric antigen receptor can perform specific functions on the target cell, such as the cytotoxicity function of NK cells and the like. Thus, FIG. 3b is a schematic representation of the signal activation of the chimeric antigen receptor artificial molecular machine in the case of target molecule recognition binding signal input. Similarly, based on the working principle, using the microscope imaging method (fluorescence resonance energy transfer) to detect the corresponding phosphorylation expression of domain # V and the state change of the molecular conformation of domain # VII and the corresponding activation expression of the chimeric antigen receptor artificial molecular machine in response to different external stimuli input signals, the same method as the above-mentioned part 3a is adopted. In order to quantify the convenience of analysis, microscopic imaging methods are used to characterize the functions of different molecular artificial machines, and imaging readout indicators are used to represent the degree of the artificial molecular machines' responsiveness to stimulus signals and the degree of release and activation of their own activation elements by the artificial molecular machines in response to simultaneous initiation of stimulus signals based on changes in molecular conformation.

Different molecular machine proteins are expressed by mammalian cells such as human and mouse through DNA transfection, so that the expression of different artificial molecular machines responding to various different external stimulation input signals in human HeLa (HeLa) cells and Mouse Embryonic Fibroblasts (MEF) is detected and characterized by using a fluorescence microscope imaging method.

Fig. 4a demonstrates the very excellent response ability of intracellular detection signaling domains Sub1 and Sub4 of C #9 and C #15 to protein tyrosine phosphorylation signals in human hela cells and the corresponding very pronounced molecular conformation changes of C #9 and C #15 and very substantially pronounced release and activation of its own activation element, domain # VII (SYK and ZAP70), and is significantly superior to C #11 and C # 13. Furthermore, in the case where the self-activating element was disabled (inactivating mutants Sub1FF to Sub4FF), C #10, C #12, C #14, and C #16 had a significantly different weaker nearly zero ability to respond to protein tyrosine phosphorylation signals after statistical analysis than the corresponding versions C #9, C #11, C #13, and C #15, respectively, demonstrating the importance of the excellent ability to respond to protein tyrosine phosphorylation signals for domain # V (Sub1 to Sub4) of C #9, C #11, C #13, and C #15 and the significantly better ability and sensitivity to protein tyrosine phosphorylation signals for domain # V (Sub1) of C #9 and domain # V (Sub4) of C #15 than for domain # V (Sub2) of C #11 and domain # V (Sub3) of C # 13. In addition, sodium perborate, which is a20 uM tyrosine phosphatase inhibitor, can inhibit dephosphorylation of intracellular proteins, thereby promoting activation of protein tyrosine phosphorylation signals and playing a role in providing protein tyrosine phosphorylation signal input.

Fig. 4B shows the results of different artificial molecular machines in human hela cells under the a condition of 20uM tyrosine phosphatase inhibitor sodium-perovanadate activated protein tyrosine phosphorylation signal or under the B condition of 50ng/mL epidermal growth factor activation signal (mean ± standard deviation, n ═ 6), and the imaging reading index represents the degree of response ability of the artificial molecular machine to the stimulation signal after quantification and the degree of release and activation of its own activation element by the artificial molecular machine based on molecular conformation change triggered simultaneously in response to the stimulation signal. Furthermore, figure 4b demonstrates the very excellent response capability of domain # V of C #9 and C #15 (Sub1 and Sub4) to protein tyrosine phosphorylation signals and the corresponding very pronounced molecular conformation changes of C #9 and C #15 and the very substantially pronounced release and activation of its own activation element, domain # VII (SYK and ZAP70), in human hela cells. Furthermore, under the condition of the epidermal growth factor activation signal, C #9 and C #15 have a weaker near-zero response ability to the signal with a significant difference after statistical analysis, demonstrating the importance of the excellent response ability of domain # V (Sub1 and Sub4) of C #9 and C #15 to the protein tyrosine phosphorylation signal and ensuring the specific response of the artificial molecular machine to the specific protein tyrosine phosphorylation signal without responding to unrelated signal inputs, such as the epidermal growth factor activation signal. Here, the epidermal growth factor can bind to the epidermal growth factor receptor on the surface of HeLa cells to provide an epidermal growth factor activation signal, which is not involved in phosphorylation of the immunoreceptor tyrosine activation motif and thus cannot be specifically detected by domain # V of C #9 and C # 15.

Fig. 4c shows the results of the expression of different artificial molecular machines in Mouse Embryonic Fibroblasts (MEFs) under the a condition of 20uM tyrosine phosphatase inhibitor sodium-peroxovanadate-activated protein tyrosine phosphorylation signal or under the B condition of 50ng/mL platelet-derived growth factor activation signal (mean ± sd, n ═ 6), and the imaging readout index represents the degree of response ability of the artificial molecular machine to the stimulation signal after quantification and the degree of release and activation of its own activation element by the artificial molecular machine simultaneously triggered in response to the stimulation signal based on the change of molecular conformation. Furthermore, fig. 4C demonstrates the very excellent ability of the domains # V of C #9 and C #15 (Sub1 and Sub4) to respond to protein tyrosine phosphorylation signals and the very pronounced change in molecular conformation of C #9 and C #15 and the very substantially pronounced release and activation of its own activating element, domain # VII (SYK and ZAP70), in mouse embryonic fibroblasts. In addition, under the condition of platelet derived growth factor activation signal, C #9 and C #15 have a weaker near-zero response ability to the signal with a significant difference after statistical analysis, demonstrating the importance of the excellent response ability of domain # V (Sub1 and Sub4) of C #9 and C #15 to protein tyrosine phosphorylation signal and ensuring the specific response of artificial molecular machine to specific protein tyrosine phosphorylation signal without responding to irrelevant signal input, such as platelet derived growth factor activation signal. Here, the platelet-derived growth factor binds to a platelet-derived growth factor receptor on the surface of mouse embryonic fibroblasts to provide a platelet-derived growth factor activation signal that is not involved in phosphorylation of the immunoreceptor tyrosine activation motif and thus cannot be specifically detected by domain # V of C #9 and C # 15.

The human cells express different chimeric antigen receptor proteins by DNA transfection, so that the expression distribution of different artificial molecular machines in the human HeLa (HeLa) cells and the expression of responding to a plurality of different external stimuli input signals are detected and characterized by using a fluorescence microscope imaging method.

FIG. 5a shows the expression distribution of different artificial molecular machines in human hela cells and the detection of the ability to respond to protein tyrosine phosphorylation signals under the stimulation of 20uM tyrosine phosphatase inhibitor sodium perovanadate. The experimental group is the human hela cells modified by C #17, the control group is the human hela cells modified by C #18, and the color bar heat maps on the left side of the picture sequentially represent that the response capability of the chimeric antigen receptor to the stimulation signals is from low to high from bottom to top and the release and activation degrees of the chimeric antigen receptor to the self-activating element domain # VII are from low to high based on the molecular conformation change of the chimeric antigen receptor triggered simultaneously in response to the stimulation signals. First, as shown in FIG. 5a, C #17 and C #18 both exhibited correct membrane-localized expression profiles on the surface of human hela cells, without any other incorrect protein localization. In addition, the C #17 modified human hela cells show rapid and remarkable response capability to protein tyrosine phosphorylation signals stimulated by a tyrosine phosphatase inhibitor sodium perovanadate, and show extremely remarkable response capability to stimulation signals and release and activation of a self-structure domain # VII based on molecular conformation change within about half an hour after stimulation; and the C #18 modified human hela cells show significantly weaker response capability to protein tyrosine phosphorylation signals stimulated by a tyrosine phosphatase inhibitor sodium peroxyvanadate, and cannot show effective response capability to the stimulation signals and release and activation of the self domain # VII based on molecular conformation change after stimulation. Fig. 5a demonstrates the excellent responsiveness of domain # V of C #17 (Sub1) to protein tyrosine phosphorylation signals in human hela cells and the corresponding change in the apparent molecular conformation of C #17 and a sufficiently significant release and activation of its own activating element, the intracellular activation signaling domain ZAP 70. Furthermore, in the case where the self-activating element was disabled (inactivating mutant Sub1FF), C #18 had a significantly weaker nearly zero response ability to protein tyrosine phosphorylation signal than C #17, demonstrating the importance and specificity of the excellent response ability of domain # V (Sub1) of C #17 to protein tyrosine phosphorylation signal.

FIG. 5b shows the expression distribution of different artificial molecular machines in human hela cells and the detection of the ability to respond to protein tyrosine phosphorylation signals under the stimulation of 20uM tyrosine phosphatase inhibitor sodium perovanadate. The experimental group is the human hela cells modified by C #19, the control group is the human hela cells modified by C #20, and the color bar heat maps on the left side of the picture sequentially represent that the response capability of the chimeric antigen receptor to the stimulation signals is from low to high from bottom to top and the release and activation degrees of the chimeric antigen receptor to the self-activating element domain # VII are from low to high based on the molecular conformation change of the chimeric antigen receptor triggered simultaneously in response to the stimulation signals. First, as shown in fig. 5b, C #19 and C #20 both exhibited correct membrane-localized expression profiles on the surface of human hela cells without any other incorrect protein localization. In addition, the human hela cells modified by C #19 show rapid and remarkable response capability to protein tyrosine phosphorylation signals stimulated by a tyrosine phosphatase inhibitor sodium metavanadate, and show extremely remarkable response capability to the stimulation signals and release and activation of the self-domain # VII based on molecular conformation change within about half an hour after stimulation; the human hela cells modified by C #20 show almost zero extremely weak response ability to protein tyrosine phosphorylation signals stimulated by a tyrosine phosphatase inhibitor sodium perovanadate, and cannot show effective response ability to the stimulation signals and release and activation of the self-domain # VII based on molecular conformation change after stimulation. The above results fully demonstrate the signal activation pattern of the artificial molecular robot shown in figure three in human cells. Figure 5b demonstrates the excellent response of domain # V of C #19 (Sub1) to protein tyrosine phosphorylation signals in human hela cells and the corresponding change in apparent molecular conformation of C #19 and a sufficiently significant release and activation of its own activating element, domain # VII. Furthermore, in the case where the self-activating element was disabled (inactivating mutant Sub1FF), C #20 had a significantly weaker nearly zero response ability to protein tyrosine phosphorylation signal than C #19, demonstrating the importance and specificity of the excellent response ability of domain # V (Sub1) of C #19 to protein tyrosine phosphorylation signal.

Fig. 5c shows the results of the expression of different artificial molecular machines in hela cells of human origin under the condition that the tyrosine phosphatase inhibitor sodium peroxovanadate activates the tyrosine phosphorylation signal of protein (mean ± standard deviation, n ═ 10), and the imaging readout index represents the quantified degree of the response ability of the chimeric antigen receptor to the stimulation signal and the degree of the release and activation of the self-activation element of the chimeric antigen receptor based on the change of molecular conformation triggered by the response of the stimulation signal. Furthermore, fig. 5C demonstrates the excellent response ability of domain # V of C #19 (Sub1) to protein tyrosine phosphorylation signals in HeLa cells of human origin (mean value of C #19 is over 2.84) and the corresponding very significant change in molecular conformation of C #19 and its own activation element, domain # VII, is very substantially significantly released and activated, and the significant difference after statistical analysis is better than that of C #17 (mean value of C #17 is about 2.48). In addition, in the case where the self-activating element is disabled (the inactivating mutant Sub1FF), C #20 has a significantly different response ability to the protein tyrosine phosphorylation signal after statistical analysis (the average value of C #20 is about 0.055, and the average value of C #18 is about 0.34) than C #18, which proves the importance of the excellent response ability of domain # V of C #19 and C #17 to the protein tyrosine phosphorylation signal and the significantly better specificity of response to the protein tyrosine phosphorylation signal of C #19 than C #17, indicating that domain # IV of C #19 has a better functional performance than domain # IV of C # 17.

Proteins C #9 and C #10 were purified from transfected 293T cells using chromatographic purification techniques and 4 ℃ protein dialysis, and then the purified molecular machinery proteins were dissolved in a kinase buffer solution (50 mM Tris HCl solution, 100mM NaCl, 10mM MgCl, 2mM dithiothreitol) at a concentration of 50nM, and the non-receptor type protein tyrosine kinase Lck protein providing 1mM ATP as a substrate required for phosphorylation and 100nM in activated state was added. Here, Src family protein non-receptor type protein tyrosine kinase Lck (Lymphocyte-specific protein tyrosine kinase) can promote activation of protein tyrosine phosphorylation signal, functions to provide specific protein tyrosine phosphorylation signal input, and can provide phosphorylation signal input of immunoreceptor tyrosine activation motif.

And detecting optical signals before and after ATP and Lck are added and carrying out quantitative analysis. Under the condition that Lck provides signals for activating protein tyrosine phosphorylation, the results of C #9 and C #10 in the state of purified protein (mean value plus standard deviation, n is 3), and the imaging reading index represents the degree of the response ability of the chimeric antigen receptor to the stimulation signals after quantification and the release and activation degree of the chimeric antigen receptor to the self-activating elements based on the molecular conformation change triggered simultaneously in response to the stimulation signals.

The group C #9(+) of fig. 6 demonstrates the excellent response ability of the intracellular detection signaling domain Sub1 of C #9 to protein tyrosine phosphorylation signals (average about 0.8) and the very marked change in molecular conformation of C #9 and the very substantially significant release and activation of its own activation element, the intracellular activation signaling domain ZAP 70. In addition, the C #10(+) group demonstrated that, in the case where the self-detecting element was disabled (inactivating mutant Sub1FF), C #10 had a weaker response ability to the protein tyrosine phosphorylation signal (average value less than 0.08) that was significantly different after statistical analysis than C #9, demonstrating the importance of the excellent response ability of domain # V of C #9 to the protein tyrosine phosphorylation signal and the C #9 version had excellent specificity to the protein tyrosine phosphorylation signal response.

Different chimeric antigen receptor proteins are expressed in human cells by DNA transfection, so that the expression distribution of different chimeric antigen receptors in human HeLa (HeLa) cells and the expression responding to the input of a physiological specificity human PD-L1 signal are detected and characterized by using a fluorescence microscope imaging method, and the used physiological specificity human PD-L1 signal is a microsphere modified by human PD-L1.

FIG. 7a shows the expression distribution of different chimeric antigen receptors in human HeLa cells and the detection of the ability to respond to human PD-L1 signaling under stimulation by human PD-L1 modified microspheres. The experimental group is the human hela cells modified by C #19, the control group is the human hela cells modified by C #20, and the provided phase contrast imaging experimental picture provides the image information of the interaction of the cells and the microspheres. The color bar heat map below the picture sequentially represents the low-to-high response capability of the chimeric antigen receptor to the stimulation signal and the low-to-high release and activation degree of the intracellular activation signaling domain ZAP70 of the chimeric antigen receptor based on the molecular conformation change triggered by the response to the stimulation signal. First, both C #19 and C #20 shown in fig. 7a exhibited correct membrane-localized expression profiles on the surface of human hela cells. In addition, the C #19 modified human hela cells show rapid and significant response capability to the stimulation signals of the human PD-L1 modified microspheres, exhibit extremely significant response capability to the stimulation signals and release and activation of the self-domain # VII thereof based on molecular conformation change beginning at about 18 minutes after stimulation, and show highly specific spatial characteristics in response to the stimulation signals of the human PD-L1 modified microspheres, i.e., exhibit response capability only locally at the positions where the cells and microspheres interact in the phase contrast imaging experimental pictures; and the C #20 modified human hela cells show significantly weaker response capability to the stimulation signal of the human PD-L1 modified microspheres, and cannot show effective response capability to the stimulation signal and release and activation of the self domain # VII based on the change of molecular conformation after stimulation. Figure 7a demonstrates the excellent responsiveness of domain # V of C #19 (Sub1) to human PD-L1 signaling in human hela cells and the corresponding change in apparent molecular conformation of C #19 and a sufficiently pronounced release and activation of its own activating element, the intracellular activation signaling domain ZAP 70. Furthermore, in the case where the self-activating element was disabled (inactivating mutant Sub1FF), C #20 had a significantly weaker ability to respond to the human PD-L1 signal than C #19, demonstrating the importance and specificity of the domain # V (Sub1) of C #19 to the excellent ability to respond to the human PD-L1 signal.

Fig. 7b shows the results of different chimeric antigen receptors in human hela cells under the condition of human PD-L1 modified microsphere stimulation signals (mean ± sd, n ═ 10), and the imaging readout index represents the degree of the response ability of the chimeric antigen receptor to the stimulation signals after quantification and the degree of the release and activation of its own activation elements by the chimeric antigen receptor based on the change of molecular conformation triggered simultaneously in response to the stimulation signals. Moreover, figure 7b demonstrates the excellent responsiveness of domain # V of C #19 (Sub1) to protein tyrosine phosphorylation signals in hela cells of human origin (mean value of about 0.46 for group C # 19) and the corresponding very pronounced change in molecular conformation of C #19 and the very substantially pronounced release and activation of its own activation element, intracellular activation signaling domain ZAP70, with a marked difference after statistical analysis superior to that of version C #17 (mean value of about 0.23 for group C # 17). In addition, in the case of the self-activation element being disabled (the inactivating mutant Sub1FF), C #20 has a significantly different response ability to protein tyrosine phosphorylation signals after statistical analysis (the average value of C #20 is about 0.046, and the average value of C #18 is about 0.126) than C #18, which proves the importance of the excellent response ability of domain # V of C #19 and C #17 to the human PD-L1 signals and the significantly better specificity of C #19 to the human PD-L1 signal than C #17, indicating that domain # IV of C #19 has a better functional performance than domain # IV of C #17 version.

In conclusion, after detection and characterization by different means, the chimeric antigen receptor artificial molecular machine is proved to show excellent response capability to different stimulatory signal inputs, particularly high specific response to human PD-L1 signal input, and importance of an intracellular signaling domain # VIII, particularly capability of the domain # VII to stimulate modified lymphocyte effector functions after being released and activated. Among them, as shown in fig. 34, the functionality of C #19 is particularly prominent, i.e., the Truncated PD-1-Sub1-LL2-ZAP70 version, which also provides support and guarantee for the subsequent cytotoxic killing experiment.

Example 3 detection of tumor killing ability of chimeric antigen receptor-modified Natural killer cells

Through tumor cytotoxicity killing experiments, the mechanism of tumor killing detection of human native killer cells on human tumor cells positive to PD-L1 after modification of chimeric antigen receptor fused with immune checkpoint PD-1 is understood as shown in FIG. 8. Figure 8a shows that when natural killer cells recognize and bind to a target molecule (e.g., PD-L1) on the surface of tumor cells at an immune checkpoint receptor (e.g., endogenous PD-1) on their surface, the ability of natural killer cells to poison the corresponding tumor cells is inhibited by the inhibitory immune checkpoint signaling pathway. Fig. 8b shows that when the human natural killer cell modified based on the modification of the chimeric antigen receptor fused at the immune checkpoint PD-1 recognizes and binds to the target molecule PD-L1 on the surface of the tumor cell, the modified natural killer cell can be effectively activated and effectively kill the corresponding tumor cell. The human tumor cells used for the in vitro tumor cell killing experiment express the reporter gene firefly luciferase through modification, and the luciferase in the tumor cells can accurately reflect the overall cell survival rate, namely the survival number of the tumor cells is quantified by detecting the activity of the luciferase in the tumor cells.

(1) Detecting the expression level of the chimeric antigen receptor of the human natural killer cell modified based on the modification of the chimeric antigen receptor of the immune checkpoint PD-1 fusion.

The virus particles of the chimeric antigen receptor artificial molecular machine fused with different immune check points PD-1 are prepared by slow virus packaging, namely, a retrovirus expression vector (such as pSIN plasmid and the like) and a packaging plasmid (such as pCMV delta R8.2 and pCMV-VSV-G or psPAX2 and pMD2.G and the like) carrying the chimeric antigen receptor artificial molecular machine fused with different immune check points PD-1 are transfected into 293T cells, virus supernatant is harvested, and the virus supernatant is separated and frozen after filtration, and the virus titer is determined. A certain amount of the virus supernatant was added to a petri dish of human natural killer cells NK-92 and cultured for 24 hours, and the virus solution was discarded the next day. And 2-3 days after the natural killer cells NK-92 are infected by the virus, a cell population of the natural killer cells NK-92 with high expression of the chimeric antigen receptor fused with the PD-1 on the cell surface is screened out by using PD-1 antibody staining (see figure 9). The chimeric antigen receptors C #2, C #3 and C #5 fused by different immune check points PD-1 have more than 90% of expressions in natural killer cells NK-92 relative to a control group, and are used for detecting the effect of the tumor killing cells of the natural killer cells NK-92 modified and modified based on the modification of the chimeric antigen receptors fused by the immune check points PD-1 in a co-culture experiment. The tumor cell killing ability of the chimeric antigen receptors C #2 and C #3 fused with the natural killer cells NK-92 expressing different immune checkpoints PD-1 respectively through image observation is shown in FIG. 11, and the tumor cell killing efficacy of the chimeric antigen receptors C #2, C #3 and C #5 fused with the natural killer cells NK-92 expressing different immune checkpoints PD-1 respectively is shown in FIGS. 12-20.

(2) Detection of the expression level of the immune checkpoint inhibitory signaling pathway molecule PD-L1 on different tumor cells.

The expression conditions of PD-L1 on 8 human-derived cancer tumor cells are respectively stained and detected by using a PD-L1 antibody, namely a human-derived breast cancer tumor cell MBA-MB-231, a human-derived brain cancer tumor cell U87-MG, a human-derived kidney cancer tumor cell 786-O, a human-derived skin cancer tumor cell A2058, a human-derived lung cancer tumor cell H441, a human-derived ovarian cancer tumor cell ES-2, a human-derived prostate cancer tumor cell PC-3 and a human-derived liver cancer tumor cell HA-22T. FIGS. 10a to 10h show the expression of PD-L1 in 8 human tumor cells and after pretreatment with gamma interferon, the expression ratio of PD-L1 in 8 human cancer cells relative to a negative Control group (Isotype Control) is 90.1%, 97.1%, 91.9%, 89.5%, 99.4%, 99.9%, 93.7% and 93.6% respectively, after gamma interferon pretreatment, the expression ratio of PD-L1 is increased, the expression amount is obviously improved and is respectively 97.5%, 99.7%, 99.9%, 99.6%, 100.0%, 99.9% and 99.5%, further disclosing that the gamma interferon can promote the expression of PD-L1 on tumor cells, and in vitro experiment, gamma interferon is used to pre-treat tumor cell to simulate the tumor microenvironment in body, and the 8 kinds of human cancer tumor cells are used in the tumor cell killing experiment.

(3) The image observation analyzes the tumor killing capacity of the human natural killer cells after the chimeric antigen receptor is modified.

The tumor killing capacity of the human natural killer cell NK-92 to the human breast cancer tumor cell MBA-MB-231 positive to PD-L1 after the modification and modification of the chimeric antigen receptor C #3 based on the fusion of the immune checkpoint PD-1 is analyzed by image observation:

human breast cancer tumor cell MDA-MB-231 expressing reporter gene green fluorescent protein is pretreated by gamma interferon for 24 hours to increase the cell surfaceExpression of facial PD-L1, 1X10 ⁵ The modified human natural killer cells NK-92 and 1x10 ⁵ Tumor cells were co-cultured in a 35mm glass chassis at an E/T (effector/target) ratio of 1:1 and time-lapse live microscopy was used to observe whether human natural killer cells modified by the modification of the chimeric antigen receptor version C #3 fused to the immune checkpoint PD-1 could effectively kill the human breast cancer tumor cells MBA-MB-231 positive to PD-L1. Adding 100mmol/L Propidium Iodide (PI) into the culture solution, observing the damage of the breast cancer tumor cells caused by killing, and the co-culture time is 0 minute. Referring to FIG. 11, the experimental group was C #3 modified human natural killer cell NK-92, and the control group was C #2 modified human natural killer cell NK-92. Figure 11 shows images taken every 3 minutes showing the superposition of green, red (propidium iodide) and bright field channels. In the experimental group (fig. 11a), the fluorescence image is displayed at the indicated time point, which represents 0 th minute, the modified humanized natural killer cell is contacted and combined with the tumor target cell expressing green fluorescent protein, at 36 th, 42 th and 81 th minutes, the humanized natural killer cell is continuously and directly contacted with the tumor target cell after the modification and modification of C #3 is displayed, the cell membrane of the tumor target cell is damaged, the propidium iodide enters the tumor target cell and gradually emits red fluorescence, and finally, at 117 th minute, the damaged and incomplete death of the tumor target cell is displayed, and the whole killed tumor target cell loses green fluorescence and shows red fluorescence or even red fluorescence disappears; while the control group C #2 modified human native killer cells (fig. 11b) showed significant binding effect to recognition contact of green fluorescent protein-expressing human PD-L1 positive tumor target cells, effective killing of green fluorescent protein-expressing tumor target cells was not achieved at 0, 24, 48, 90 min up to 117 min, nor was tumor target cell damage promoted. The results of image observation and analysis prove that the chimeric antigen receptor C #3 modified immune natural killer cells have remarkably different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in the control group C #2 can not show effective performance under the condition of co-culture of the PD-L1 positive human-derived tumor cellsRecognizing the ability to kill tumor cells.

(4) And detecting the tumor killing capacity of the human natural killer cells after the chimeric antigen receptor is modified.

Detecting the tumor killing capacity of human natural killer cells NK-92 to human breast cancer tumor cells MDA-MB-231 positive to PD-L1 after the modification and modification of the chimeric antigen receptor based on the immune checkpoint PD-1 fusion:

tumor killing detection of human natural killer cell NK-92 with chimeric antigen receptor modification on human breast cancer tumor cell MDA-MB-231 positive to PD-L1:

human breast cancer tumor cells MDA-MB-231 expressing reporter gene firefly luciferase are pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 1x10 is added ³ 、2.5x10 ³ 、5x10 ³ 、10x10 ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates at E/T (effector cells/target cells) ratios of 1:1, 2.5:1, 5:1, and 10:1 for 24 hours, which was 0 hour from the start. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human breast cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human breast cancer tumor cells. Please see fig. 12. Wherein, the tumor cell only group is the human breast cancer tumor cell MDA-MB-231, the human natural killer cell in the control group is the human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human breast cancer tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 12a illustrates the experimental flow and mode set up of in vitro co-culture cytotoxicity assay of natural killer cells with PD-L1 positive human breast cancer tumor cells covered by this application. FIG. 12b shows the results of quantitative analysis of the cytotoxicity of different chimeric antigen receptor artificial molecule machine-modified human natural killer cells and PD-L1 positive human tumor cells in vitro co-culture based on the fusion of immune checkpoint PD-1Tumor cells were tested at an E/T (effector/target) ratio of 1: 1. At 24 hours after incubation (mean value of 2.0 in C #3 group and mean value of 3.1 in control group), human immune natural killer cells after modification of chimeric antigen receptor C #3 fused at immune checkpoint PD-1 showed the maximum tumor cell removal capacity compared to human natural killer cells in control group, respectively, and the cell number of human tumor cells was 66.6% relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1, while the human natural killer cells in other control groups can not show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1. Fig. 12C shows the results of quantitative analysis of the cytotoxicity effect of different chimeric antigen receptor artificial molecule machine-modified human natural killer cells based on the immune checkpoint PD-1 fusion and PD-L1 positive human tumor cells in vitro co-culture, wherein the natural killer cells and the tumor cells are tested at an E/T (effector cells/target cells) ratio of 2.5:1 at 24 hours after incubation (mean value of 0.9 in C #3 group and mean value of 2.2 in control group), compared to the human natural killer cells in control group, the human immune natural killer cells after the chimeric antigen receptor C #3 modification respectively show the maximum tumor cell clearance capacity, and the cell number of the human tumor cells is 40.9% relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1, while the human natural killer cells in other control groups can not show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1. FIG. 12d shows the results of quantitative analysis of the in vitro co-culture cytotoxicity effects of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, the natural killer cells and the tumor cells having an E/T (potency) of 5:1Response cell/target cell) ratio at 24 hours after incubation (average value of C #3 group is 0.2, average value of C #5 group is 0.4, average value of control group is 1.4), the chimeric antigen receptors C #3 and C #5 respectively show the maximum tumor cell removing ability after modification of the human-derived immune natural killer cells compared with the human-derived natural killer cells in the control group, and the cell numbers of the human-derived tumor cells are 14.3% and 28.6% respectively relative to those in the control group. The line graph of quantitative analysis proves that the immune natural killer cells modified by the chimeric antigen receptors C #3 and C #5 have remarkably different capabilities of recognizing and killing tumor cells after statistical analysis under the condition of co-culture with the human tumor cells positive by PD-L1, while the human natural killer cells in other control groups cannot show effective capabilities of recognizing and killing tumor cells under the condition of co-culture of the human tumor cells positive by PD-L1. Fig. 12E shows the results of quantitative analysis of the cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human tumor cells in vitro co-cultured with the natural killer cells and tumor cells tested at a ratio of E/T (effector cells/target cells) of 10:1 at 24 hours after incubation (value of C #3 is 0.1, value of control group is 0.9), compared to the human natural killer cells in control group, the chimeric antigen receptors C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity, respectively, and the cell number of human tumor cells was 11.1% relative to the cell number in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1, while the human natural killer cells in other control groups can not show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1.

To understand whether the human natural killer cells can maintain the efficacy of killing tumor cells for a long time after the modification of the chimeric antigen receptor based on the immune checkpoint PD-1 fusion, the tumor killing capacity of the human natural killer cells to human breast cancer tumor cells MDA-MB-231 positive to PD-L1 after the modification of the chimeric antigen receptor based on the immune checkpoint PD-1 fusion is further tested for a long time:

the long-time detection of tumor killing of the human natural killer cell NK-92 to the human breast cancer tumor cell MDA-MB-231 positive to PD-L1 by the chimeric antigen receptor is as follows:

human breast cancer tumor cells MDA-MB-231 expressing reporter gene firefly luciferase are pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 60 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 60 hours after incubation respectively, further quantifying the number of the human breast cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human breast cancer tumor cells. Please see fig. 13. Wherein, the tumor cell only group is the human breast cancer tumor cell MDA-MB-231, the human natural killer cell in the control group is the human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human breast cancer tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 13a illustrates the experimental flow and mode set up of in vitro co-culture cytotoxicity assays of natural killer cells with PD-L1 positive human breast cancer tumor cells encompassed by the present application. FIGS. 13b and c show the results of quantitative analysis of the cytotoxic effects of different chimeric antigen receptor artificial molecular machine-modified human natural killer cells and PD-L1 positive human tumor cells co-cultured in vitro based on the immune checkpoint PD-1 fusion, natural killer cells and tumor cells were tested at a 5: 1E/T (effector/target) ratio. At 60 hours after incubation (mean 0.3 for group C #3, mean 0.4 for group C #5, mean 1.4 for group control, mean 6.8 for group tumor cells only), chimeric immune checkpoint PD-1 fusions were compared to human natural killer cells in control, even in long-term co-culture with human breast cancer tumor cellsThe antigen receptors C #3 and C #5 are modified and transformed to human immune natural killer cells which respectively show the capacity of eliminating the maximum tumor cells, and the cell number of the human tumor cells is 21.4 percent and 28.6 percent relative to the cell number in a control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have remarkably different abilities of recognizing and killing tumor cells after statistical analysis under the condition of long-time co-culture with the PD-L1 positive human tumor cells, while the human natural killer cells in other control groups can not show effective abilities of recognizing and killing tumor cells under the condition of co-culture of the PD-L1 positive human tumor cells.

Tumor killing detection of human natural killer cells NK-92 with chimeric antigen receptor modification on human skin cancer tumor cells A2058 positive to PD-L1:

human skin cancer tumor cell A2058 expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 1x10 ³ 、2.5x10 ³ 、5x10 ³ 、10x10 ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at E/T (effector cells/target cells) ratios of 1:1, 2.5:1, 5:1, and 10:1, with the co-culture time starting at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human skin cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human skin cancer tumor cells. Please see fig. 14. Wherein, the tumor cell group is only human skin cancer tumor cell A2058 cell per se, the human natural killer cell in the control group is a human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human skin cancer tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 14a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human skin cancer tumor cells covered by this application. FIG. 14b shows a different chimerizationThe result of quantitative analysis of the in vitro co-culture cytotoxicity effect of the antigen receptor modified human natural killer cells and the PD-L1 positive human tumor cells is that the natural killer cells and the tumor cells are tested according to the E/T (effector cells/target cells) ratio of 1: 1. At 24 hours after incubation (mean value of 3.2 in C #3 group and mean value of 5.3 in control group), the human immune natural killer cells after modification of chimeric antigen receptor C #3 showed the maximum tumor cell removal capacity compared to the human natural killer cells in control group, and the cell number of human tumor cells was 60.4% relative to the cell number in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1, while the human natural killer cells in other control groups can not show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1. Fig. 14C shows the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human tumor cells, wherein the natural killer cells and tumor cells were tested at an E/T (effector cells/target cells) ratio of 2.5:1 at 24 hours after incubation (average value of 1.5 in C #3 group and average value of 3.8 in control group), compared to the human natural killer cells in control group, the chimeric antigen receptor C #3 modified human immune natural killer cells showed the maximum tumor cell clearance capacity, and the cell number of the human tumor cells was 39.5% relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1, while the human natural killer cells in other control groups can not show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the human tumor cells positive to PD-L1. FIG. 14(d) shows in vitro co-cultured cells of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cellsAs a result of quantitative analysis of cytotoxicity effect, when natural killer cells and tumor cells were tested at an E/T (effector cells/target cells) ratio of 5:1 at 24 hours after incubation (average value of C #3 group is 0.5, average value of C #5 group is 0.3, average value of control group is 3.3), compared with human natural killer cells in control group, human immune natural killer cells after modification of chimeric antigen receptors C #3 and C #5 fused at immune checkpoint PD-1 showed the maximum tumor cell clearance respectively, and the cell number of human tumor cells was 15.0% and 9.1% respectively relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have remarkably different abilities of recognizing and killing tumor cells after statistical analysis under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups can not show effective abilities of recognizing and killing tumor cells under the condition of co-culture of the PD-L1 positive human-derived tumor cells. Fig. 14E shows the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor modified human natural killer cells and PD-L1 positive human tumor cells, wherein the natural killer cells and tumor cells were tested at an E/T (effector cells/target cells) ratio of 10:1 at 24 hours after incubation (value of C #3 group is 0.1, value of control group is 2.7), compared to the human natural killer cells in control group, the chimeric antigen receptor C #3 modified human immune natural killer cells showed the maximum tumor cell removal capacity, respectively, and the cell number of the human tumor cells was 3.7% relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have remarkably different abilities of recognizing and killing tumor cells after statistical analysis under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups can not show effective abilities of recognizing and killing tumor cells under the condition of co-culture of the PD-L1 positive human-derived tumor cells.

Tumor killing detection of human natural killer cell NK-92 with chimeric antigen receptor modification on human prostate cancer tumor cell PC-3 positive to PD-L1:

human prostate cancer tumor cell PC-3 expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting the luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, so as to quantify the number of the human prostate cancer tumor cells and calculate the cytotoxicity of the human natural killer cells to the human prostate cancer tumor cells. Please see fig. 15. Wherein, the tumor cell group is only human prostate cancer tumor cell PC-3, the human natural killer cell in the control group is the human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human prostate cancer tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 15a illustrates the experimental analysis and testing procedures and mode settings for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human prostate cancer tumor cells covered by this application. FIGS. 15b and c show the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, which were tested at a 5: 1E/T (effector/target) ratio. At 24 hours after incubation (average value of C #3 group is 0.03, average value of C #5 group is 0.09, average value of control group is 0.35, average value of tumor cell group only is 0.94), compared with human natural killer cells in control group, chimeric antigen receptor C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity respectively, and the cell number of human tumor cells was 8.6% and 25.7% respectively relative to that in control group. The line graph of quantitative analysis proves that the chimeric antigen receptors C #3 and C #5 modified immune natural killer cells have remarkable difference after statistical analysis under the condition of being cultured with human tumor cells positive to PD-L1The ability to recognize and kill tumor cells, while the human natural killer cells in other control groups failed to show effective ability to recognize and kill tumor cells in the face of co-culture conditions of human tumor cells positive to PD-L1.

Tumor killing detection of chimeric antigen receptor-modified human natural killer cells NK-92 on human brain cancer tumor cells U87-MG positive to PD-L1:

human brain cancer tumor cell U87-MG for expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5X10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human brain cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human brain cancer tumor cells. Please see fig. 16. Wherein, the tumor cell group is only human brain cancer tumor cell U87-MG cell, the human natural killer cell in the control group is the human natural killer cell without chimeric antigen receptor modification, and the target cell survival index represents the relative cell number of the human brain cancer tumor cell expressing reporter gene firefly luciferase in the cell culture system. FIG. 16a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and human brain cancer tumor cells positive for PD-L1, as covered by the present application. FIGS. 16b and c show the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, which were tested at a 5: 1E/T (effector/target) ratio. At 24 hours after incubation (mean value of C #3 group is 0.2, mean value of C #5 group is 0.4, mean value of control group is 1.6, mean value of tumor cell only group is 3.7), chimeric antigen receptor C #3 and C #5 are modified to human immune natural killer cellsThe cells showed the maximum tumor cell clearance, and the cell numbers of the human tumor cells were 12.5% and 25.0% relative to those in the control group, respectively. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups cannot show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells.

Tumor killing detection of human natural killer cell NK-92 with chimeric antigen receptor modification on human liver cancer tumor cell HA22T positive to PD-L1:

human liver cancer tumor cell HA-22T expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human liver cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human liver cancer tumor cells. Please see fig. 17. Wherein, the tumor cell group is only the human hepatoma tumor cell HA22T, the human natural killer cell in the control group is the human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human hepatoma tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 17a illustrates the experimental analysis and testing procedure and mode setup for in vitro co-culture cytotoxicity assay of natural killer cells and PD-L1 positive human hepatoma tumor cells covered by this application. FIGS. 17b and c show the results of quantitative analysis of the cytotoxicity of different chimeric antigen receptor-modified human natural killer cells in vitro co-cultured with PD-L1-positive human tumor cellsCell to tumor cells experiments were performed with an E/T (effector/target) ratio of 5: 1. At 24 hours after incubation (mean value of C #3 group is 0.2, mean value of C #5 group is 0.2, mean value of control group is 0.9, mean value of tumor cell group only is 2.7), compared with human natural killer cells in control group, chimeric antigen receptor C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity respectively, and cell number of human tumor cells was 22.2% and 22.2% respectively relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups cannot show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells.

Tumor killing detection of human natural killer cells NK-92 modified by chimeric antigen receptor on PD-L1 positive human renal carcinoma tumor cells 786-O:

human kidney cancer tumor cell 786-O expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human renal carcinoma tumor cells and calculating cytotoxicity of the human natural killer cells to the human renal carcinoma tumor cells. Please see fig. 18. Wherein, the tumor cell group is only human renal carcinoma tumor cell 786-O cell per se, the human natural killer cell in the control group is a human natural killer cell which is not modified by the chimeric antigen receptor, and the survival index of the target cell represents the relative cell number of the human renal carcinoma tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 18a illustrates the concepts contained in the present applicationThe experimental analysis and test flow and mode setting of the in-vitro co-culture cytotoxicity of the natural killer cells of the cover and the positive human renal carcinoma tumor cells of PD-L1. FIGS. 18b and c show the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, which were tested at a 5: 1E/T (effector/target) ratio. At 24 hours after incubation (mean value of C #3 group is 0.1, mean value of C #5 group is 0.2, mean value of control group is 0.7, mean value of tumor cell group only is 7.1), compared with human natural killer cells in control group, chimeric antigen receptor C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity respectively, and the cell number of human tumor cells was about 14.3% and 28.6% respectively relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups cannot show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells.

Tumor killing detection of human natural killer cell NK-92 with chimeric antigen receptor modification on human lung cancer tumor cell H441 with positive PD-L1:

human lung cancer tumor cell H441 expressing reporter gene firefly luciferase is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates for 24 hours at an E/T (effector cells/target cells) ratio of 5:1, with the co-culture time beginning at hour 0. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, further quantifying the number of the human lung cancer tumor cells and calculating cytotoxicity of the human natural killer cells to the human lung cancer tumor cells. See fig. 19. Wherein, only swellingThe tumor cell group is only human lung cancer tumor cell H441, the human natural killer cell in the control group is a human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human lung cancer tumor cell expressing the reporter gene firefly luciferase in a cell culture system. FIG. 19a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human lung cancer tumor cells covered by the present application. FIGS. 19b and c show the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, which were tested at a 5: 1E/T (effector/target) ratio. At 24 hours after incubation (average value of C #3 group is 0.1, average value of C #5 group is 0.7, average value of control group is 1.5, average value of tumor cell group only is 1.8), compared with human natural killer cells in control group, chimeric antigen receptor C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity respectively, and the cell number of human tumor cells was 6.7% and 46.7% respectively relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups cannot show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells.

Tumor killing detection of human natural killer cell NK-92 with chimeric antigen receptor modification on human ovarian cancer tumor cell ES-2 positive to PD-L1:

human ovarian cancer tumor cells ES-2 expressing reporter gene firefly luciferase are pretreated with gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, and 5x10 is added ³ The modified human natural killer cells NK-92 and 1x10 are respectively ³ Tumor cells were co-cultured in 48-well plates at an E/T (effector/target) ratio of 5:1The time of co-cultivation started at hour 0 after 24 hours. And detecting luciferase activity in the cell culture system at three co-culture time points of 0 hour, 4 hours and 24 hours after incubation respectively, so as to quantify the number of the human ovarian cancer tumor cells and calculate the cytotoxicity of the human natural killer cells to the human lung cancer tumor cells. Please see fig. 20. Wherein, the tumor cell group is only human ovarian cancer tumor cell ES-2 cell per se, the human natural killer cell in the control group is a human natural killer cell which is not modified by the chimeric antigen receptor, and the target cell survival index represents the relative cell number of the human lung cancer tumor cell expressing the reporter gene firefly luciferase in the cell culture system. FIG. 20a illustrates the experimental analysis and testing procedure and mode set up for in vitro co-culture cytotoxicity of natural killer cells and PD-L1 positive human lung cancer tumor cells covered by the present application. FIGS. 19b and c show the results of quantitative analysis of the in vitro co-culture cytotoxicity effect of different chimeric antigen receptor-modified human natural killer cells and PD-L1-positive human tumor cells, which were tested at a 5: 1E/T (effector/target) ratio. At 24 hours after incubation (average value of C #3 group is 0.1, average value of C #5 group is 0.1, average value of control group is 1.3, average value of tumor cell group only is 2.9), compared with human natural killer cells in control group, chimeric antigen receptor C #3 and C #5 modified human immune natural killer cells showed the maximum tumor cell removal capacity respectively, and the cell number of human tumor cells was 7.7% and 7.7% respectively relative to that in control group. The quantitative analysis line graph proves that the chimeric antigen receptor C #3 and C #5 modified immune natural killer cells have statistically different and excellent capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells, while the human-derived natural killer cells in other control groups cannot show effective capacity of recognizing and killing tumor cells under the condition of co-culture with the PD-L1 positive human-derived tumor cells.

(5) And (3) an anti-tumor related function experiment of the human natural killer cell after the chimeric antigen receptor is modified is detected.

Detecting the expression of multiple gene transcription levels of a human natural killer cell NK-92 modified by a chimeric antigen receptor fused based on an immune checkpoint PD-1 and under the condition of co-culture with tumor cells:

human breast cancer tumor cell MDA-MB-231 is pretreated by gamma interferon for 24 hours to increase the expression of PD-L1 on the cell surface, 2.5x10 ⁵ The modified human natural killer cells NK-92 and 1x10 ⁵ Tumor cells were co-cultured in 6-well plates according to an E/T (effector cells/target cells) ratio of 2.5:1, which was recorded as 0 hour, after which modified NK-92 cells were isolated at 48 hours after incubation and their expression of Gene transcription levels associated with anti-tumor efficacy was detected, and at the same time, expression of Gene transcription levels associated with modified NK-cells under conditions not co-cultured with tumor cells was detected, including quantitative real-time polymerase chain reaction (qPCR) analysis and Gene function classification system (GO, Gene Ontology) enrichment analysis, see fig. 21-33. Wherein the qPCR primers are respectively as follows: the forward primer (5 '-3' CGACAGTACCATTGAGTTGTGCG, shown as SEQ ID NO: 67) and the reverse primer (5 '-3' TTCGTCCATAGGAGACAATGCCC, shown as SEQ ID NO: 68) detect the target gene GZMB; a forward primer (5 '-3' ACTCACAGGCAGCCAACTTTGC shown as SEQ ID NO: 69) and a reverse primer (5 '-3' CTCTTGAAGTCAGGGTGCAGCG shown as SEQ ID NO: 70) are used for detecting the target gene PRF 1; detecting the target gene TNFA by a forward primer (5 '-3' CTCTTCTGCCTGCTGCACTTTG shown as SEQ ID NO: 71) and a reverse primer (5 '-3' ATGGGCTACAGGCTTGTCACTC shown as SEQ ID NO: 72); a forward primer (5 '-3' GAGTGTGGAGACCATCAAGGAAG shown as SEQ ID NO: 73) and a reverse primer (5 '-3' TGCTTTGCGTTGGACATTCAAGTC shown as SEQ ID NO: 74) detect the target gene IFNG; the forward primer (5 '-3' CATCACCTGGAGGACTTCTACC, shown as SEQ ID NO: 75) and the reverse primer (5 '-3' CAGTGTACTGGATGCTCTTCAGG, shown as SEQ ID NO: 76) detect the target gene NCAM 1; a forward primer (5 '-3' GGTATGAGAGCCAGGCTTCTTG shown as SEQ ID NO: 77) and a reverse primer (5 '-3' GAATGGAGCCATCTTCCCACTG shown as SEQ ID NO: 78) detect the target gene KLRK 1; a forward primer (5 '-3' CAGCAACTTGCTGGATCTGGTG, shown as SEQ ID NO: 79) and a reverse primer (5 '-3' AGACGGCAGT)AGAAGGTCACCT, shown as SEQ ID NO: 80) to detect the target gene NCR 1.

The results of the quantitative analysis in fig. 21a show the results of the quantitative analysis of the transcriptional level of the effector function-associated gene GZMB of different human native killer cells engineered based on chimeric antigen receptors fused to the immune checkpoint PD-1, without co-culturing with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar or even lower GZMB gene transcription levels (the average value of the C #3 group is 0.622, the average value of the C #5 group is 0.813, the average value of the control group is 1.000, the average value of the C #2 group is 1.381; the normalization and analysis are carried out by taking the housekeeping gene GAPDH gene as an endogenous reference gene of qPCR), and the C #3 and C #5 are respectively 62.2 percent and 81.3 percent relative to the control group. The results of the quantitative analysis in fig. 21b show the results of quantitative analysis of the transcriptional level of the effector function-associated gene GZMB of different human native killer cells engineered based on chimeric antigen receptor fused to immune checkpoint PD-1 at the 48 hour time point of co-culture with tumor cells. Wherein, compared with human natural killer cells in a control group, the human natural killer cells modified and modified by the chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher GZMB gene transcription levels (the average value of the C #3 group is 5.641, the average value of the C #5 group is 3.325, the average value of the control group is 1.000, the average value of the C #2 group is 0.653; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and C #3 and C #5 respectively show 5.641 times and 3.325 times relative to the control group. The above quantitative results prove that the excellent GZMB gene transcription expression level which is obviously different after statistical analysis is achieved when chimeric antigen receptor versions C #3 and C #5 modified based on the fusion of the immune checkpoint PD-1 are cultured together with human tumor cells positive to PD-L1, which means that the gene expression of encoding Granzyme B protein (Granzyme B is secreted by natural killer cells and can induce the programmed cell death of target cells, and is an important effector of the natural killer cells for playing the role of anti-tumor immune killing) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. And the human natural killer cells in the experimental group C #2 and the control group do not show obvious improvement of the transcription expression level of the GZMB gene under the condition of co-culture of the human natural killer cells positive to PD-L1, and the transcription expression level of the GZMB gene in the experimental group C #2 is lower than that in the control group.

The results of the quantitative analysis in fig. 22a show the results of the quantitative analysis of the transcriptional level of the effector function-associated gene PRF1 of different human native killer cells engineered based on chimeric antigen receptors fused to the immune checkpoint PD-1, without co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar or even lower PRF1 gene transcription levels (the average value of the C #3 group is 1.119, the average value of the C #5 group is 0.645, the average value of the control group is 1.000, the average value of the C #2 group is 1.450; the normalization and analysis are carried out by taking the housekeeping gene GAPDH as an endogenous reference gene of qPCR), and the C #3 and C #5 are respectively 111.9 percent and 64.5 percent relative to the control group. The results of the quantitative analysis in fig. 22b show the results of the quantitative analysis of the transcriptional level of the effector function-associated gene PRF1 of different human native killer cells engineered chimeric antigen receptors based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. Compared with human natural killer cells in a control group, the human natural killer cells modified and transformed by the chimeric antigen receptors C #3 and C #5 with the PD-1 fusion of the immune checkpoint respectively show higher PRF1 gene transcription levels (the average value of the C #3 group is 1.546, the average value of the C #5 group is 2.702, the average value of the control group is 1.000, the average value of the C #2 group is 0.490; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and the C #5 are respectively 1.546 times and 2.702 times relative to the control group. The above quantitative results prove that the excellent PRF1 gene transcription expression level, which is remarkably different after statistical analysis, of the chimeric antigen receptor C #3 and C #5 versions modified human natural killer cells based on the fusion of the immune checkpoint PD-1 under the condition of co-culture with PD-L1 positive human tumor cells, means that the gene expression of the encoded Perforin protein (Perforin is secreted by natural killer cells and plays a core role in the cell lysis mediated by the natural killer cells, and is an important effector of the natural killer cells for playing an anti-tumor immune killing role) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. And the human natural killer cells in other experimental group C #2 and the control group do not show obvious improvement of PRF1 gene transcription expression level under the condition of co-culture of the human natural killer cells facing PD-L1 positive human tumor cells, and the PRF1 gene transcription expression level in the experimental group C #2 is lower than the PRF1 gene transcription expression level in the control group.

The results of the quantitative analysis in fig. 23a show the results of the quantitative analysis of the transcription level of the effector function-associated gene TNFA of different human native killer cells engineered based on chimeric antigen receptor fused at immune checkpoint PD-1, without co-culturing with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar or slightly higher transcription levels of the TNFA gene (the average value of the C #3 group is 2.958, the average value of the C #5 group is 0.476, the average value of the control group is 1.000, the average value of the C #2 group is 1.082; the normalization and analysis are carried out by taking the housekeeping gene GAPDH gene as an endogenous reference gene of qPCR), and the C #3 and the C #5 are respectively 2.958 times and 47.6% relative to the control group. The results of the quantitative analysis in fig. 23b show the results of the quantitative analysis of the transcription level of the effector function-associated gene TNFA of different human native killer cells engineered based on the chimeric antigen receptor fused at the immune checkpoint PD-1 at the 48 hour time point of co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells modified and transformed by the chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher transcription levels of the TNFA gene (the average value of the C #3 group is 3.536, the average value of the C #5 group is 5.240, the average value of the control group is 1.000, the average value of the C #2 group is 0.630; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and the C #5 are 3.536 times and 5.240 times respectively compared with the control group. The above quantitative results prove that the chimeric antigen receptor versions C #3 and C #5 modified human natural killer cells based on the fusion of the immune checkpoint PD-1 have remarkably different TNFA gene transcription expression levels after statistical analysis under the condition of co-culture with PD-L1 positive human tumor cells, which means that the gene expression of encoded TNF-alpha protein (tumor necrosis factor-alpha is secreted by natural killer cells, can induce apoptosis to prevent tumor occurrence, is an important effector of the natural killer cells to play the role of anti-tumor immune killing) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. However, the other experimental group C #2 and the control group did not show a significant increase in TNFA gene transcription expression level under the co-culture condition of the human natural killer cells facing PD-L1 positive human tumor cells, and the TNFA gene transcription expression level in the experimental group C #2 was lower than the TFNA gene transcription expression level in the control group.

The results of the quantitative analysis in fig. 24a show the results of the quantitative analysis of the transcription level of the effector function-associated gene IFNG of different human native killer cells engineered based on chimeric antigen receptor fused to immune checkpoint PD-1, without co-culturing with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused by the immune checkpoint PD-1 respectively show similar, even lower or slightly higher IFNG gene transcription levels (the average value of the C #3 group is 1.198, the average value of the C #5 group is 0.339, the average value of the control group is 1.000, the average value of the C #2 group is 2.845; the normalization and analysis are carried out by taking the housekeeping gene GAPDH as an endogenous reference gene of qPCR), and the C #3 and the C #5 are 119.8 percent and 33.9 percent respectively relative to the control group. The results of the quantitative analysis in fig. 24b show the results of the quantitative analysis of the transcription level of the effector function-associated gene IFNG of different human native killer cells engineered chimeric antigen receptor based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells modified and transformed by the chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher transcription levels of the IFNG gene (the average value of the C #3 group is 1.832, the average value of the C #5 group is 1.684, the average value of the control group is 1.000, the average value of the C #2 group is 0.649; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and C #5 are 1.832 times and 1.684 times respectively compared with the control group. The above quantitative results prove that the chimeric antigen receptor C #3, C #5 version modified human natural killer cells based on the fusion of the immune checkpoint PD-1 have remarkably different IFNG gene transcription expression levels after statistical analysis under the condition of co-culture with PD-L1 positive human tumor cells, which means that the gene expression of the encoded IFN-gamma protein (gamma-interferon is secreted by natural killer cells and recruits and activates various immune effector cells, which are important effector factors for the natural killer cells to exert anti-tumor immune killing effect) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. While the co-culture condition of the human natural killer cells in the other experimental group C #2 and the control group facing the human tumor cells positive to PD-L1 did not show a significant increase in the transcriptional expression level of the IFNG gene, and the transcriptional expression level of the IFNG gene in the experimental group C #2 was lower than that in the control group.

The results of the quantitative analysis in fig. 25a show the results of the quantitative analysis of the transcription level of the effector function associated gene NCAM1 of different human native killer cells engineered based on chimeric antigen receptor fused to immune checkpoint PD-1, without co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar, even lower or slightly higher transcription level of NCAM1 gene (the average value of the C #3 group is 1.016, the average value of the C #5 group is 0.397, the average value of the control group is 1.000, the average value of the C #2 group is 1.418; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and the C #5 are respectively 101.6 percent and 39.7 percent relative to the control group. The quantitative analysis result of fig. 25(b) shows the quantitative analysis result of the transcription level of the effector function-associated gene NCAM1 of different human native killer cells engineered based on the chimeric antigen receptor fused at the immune checkpoint PD-1 at the time point of co-culturing with tumor cells for 48 hours. Compared with human natural killer cells in a control group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher NCAM1 gene transcription levels (the average value of the C #3 group is 0.929, the average value of the C #5 group is 3.331, the average value of the control group is 1.000, the average value of the C #2 group is 0.786; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and the C #5 are respectively 0.929 times and 3.331 times relative to the control group. The above quantitative results prove that the excellent NCAM1 gene transcription expression level, which is remarkably different after statistical analysis, of chimeric antigen receptor C #3 and C #5 versions (especially C #5 versions) modified human natural killer cells based on the fusion of the immune checkpoint PD-1 has under the condition of co-culture with PD-L1 positive human tumor cells, means that the gene expression of the encoded CD56 protein (the neuron adhesion molecule CD56 is a receptor protein expressed under the activation state of natural killer cells, promotes the activation and anti-tumor effect capability of the natural killer cells, plays an important role in anti-tumor immune killing on the natural killer cells) is up-regulated, and the protein is directly related to the anti-tumor effect of the natural killer cells. However, the human natural killer cells in the other experimental group C #2 and the control group did not show a significant increase in the transcriptional expression level of the NCAM1 gene under the co-culture condition of the human natural killer cells facing PD-L1 positive human tumor cells, and the transcriptional expression level of the NCAM1 gene in the experimental group C #2 was lower than that of the NCAM1 gene in the control group.

The results of the quantitative analysis in fig. 26a show the results of the quantitative analysis of the transcriptional level of the effector function-associated gene KLRK1 of different human naive killer cells engineered chimeric antigen receptor based on immune checkpoint PD-1 fusion, without co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar, even lower or slightly higher KLRK1 gene transcription levels (the average value of the C #3 group is 1.426, the average value of the C #5 group is 0.275, the average value of the control group is 1.000, the average value of the C #2 group is 1.368; the normalization and analysis are carried out by taking the housekeeping gene GAPDH as an endogenous reference gene of qPCR), and C #3 and C #5 are respectively 1.426-fold and 27.5 percent relative to the control group. The quantitative analysis result of fig. 26(b) shows the quantitative analysis result of the transcription level of the effector function-related gene KLRK1 of different human natural killer cell-derived chimeric antigen receptor engineered based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. Wherein, compared with human natural killer cells in a control group, human natural killer cells modified and transformed by immune checkpoint PD-1 fused chimeric antigen receptors C #3 and C #5 respectively show higher KLRK1 gene transcription levels (the average value of the C #3 group is 1.612, the average value of the C #5 group is 3.225, the average value of the control group is 1.000, the average value of the C #2 group is 0.664; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and C #3 and C #5 are respectively 1.612 times and 3.225 times relative to the control group. The above quantitative results prove that the excellent KLRK1 gene transcription expression level, which is significantly different after statistical analysis, of the chimeric antigen receptor C #3 and C #5 versions modified based on the PD-1 fusion of the immune checkpoint, has been obtained under the condition that the human natural killer cells are cultured together with the PD-L1 positive human tumor cells, which means that the gene expression of the encoded NKG2D protein (NKG2D protein is a strong activating receptor on the surface of natural killer cells, plays an important role in natural immunity, participates in the clearance and killing of the tumor by the natural killer cells, plays a key role in anti-tumor immune killing of the natural killer cells) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. In other experimental group C #2 and the control group, the human natural killer cells in the face of PD-L1 positive human tumor cells under the co-culture condition can not show obvious increase of KLRK1 gene transcription expression level, and the KLRK1 gene transcription expression level in the experimental group C #2 is lower than that of KLRK1 gene transcription expression level in the control group.

The results of the quantitative analysis in fig. 27a show the results of the quantitative analysis of the transcription level of the effector function-associated gene NCR1 of different human native killer cells engineered based on chimeric antigen receptor fused to immune checkpoint PD-1, without co-culture with tumor cells. Wherein, compared with the human natural killer cells in the control group, the human natural killer cells after the modification and modification of the chimeric antigen receptors C #3, C #5 and C #2 fused with the immune checkpoint PD-1 respectively show similar or even lower NCR1 gene transcription levels (the average value of the C #3 group is 0.988, the average value of the C #5 group is 0.448, the average value of the control group is 1.000, the average value of the C #2 group is 1.410; the normalization and analysis are carried out by taking the housekeeping gene GAPDH as the endogenous reference gene of qPCR), and the C #3 and the C #5 are respectively 98.8 percent and 44.8 percent relative to the control group. The results of quantitative analysis in fig. 27(b) show the results of quantitative analysis of the transcription level of the human effector function-associated gene NCR1 derived from natural killer cells, engineered based on chimeric antigen receptor fused at the immune checkpoint PD-1, at the 48 hour time point of co-culture with tumor cells. Compared with human natural killer cells in a control group, the human natural killer cells modified and transformed by the chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher NCR1 gene transcription levels (the average value of the C #3 group is 1.809, the average value of the C #5 group is 4.114, the average value of the control group is 1.000, the average value of the C #2 group is 0.686; the housekeeping gene GAPDH gene is used as an endogenous reference gene of qPCR for standardization and analysis), and the C #3 and the C #5 are 1.809 times and 4.114 times relative to the control group respectively. The above quantitative results prove that the excellent NCR1 gene transcription expression level which is remarkably different after statistical analysis is provided for chimeric antigen receptor versions C #3 and C #5 modified human natural killer cells based on the fusion of the immune checkpoint PD-1 under the condition of co-culture with PD-L1 positive human tumor cells, which means that the gene expression of the encoded NKp46 protein (NKp46 is an activating receptor on the surface of natural killer cells, is involved in the elimination and killing of target cells by the natural killer cells and plays a key role in anti-tumor immune killing of the natural killer cells) is up-regulated, and the protein is directly related to the anti-tumor efficacy of the natural killer cells. However, the human natural killer cells in the other experimental group C #2 and the control group did not show a significant increase in the transcriptional expression level of the NCR1 gene under the co-culture condition of the human natural killer cells facing PD-L1 positive human tumor cells, and the transcriptional expression level of the NCR1 gene in the experimental group C #2 was lower than that of the NCR1 gene in the control group.

The quantitative analysis results of fig. 28 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with an immune checkpoint PD-1 respectively show higher gene enrichment of GO:0002228(natural killer cell mediated immunity), and have stronger natural killer cell mediated immunity and anti-tumor functional effects.

The quantitative analysis results of fig. 29 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to the GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with an immune checkpoint PD-1 respectively show significantly higher gene enrichment of GO:0032649(regulation of interferon-gamma production), and combined with the qPCR result of the IFNG gene in FIG. 24, the human natural killer cells modified and transformed by the chimeric antigen receptors C #3 and C #5 are further proved to have stronger interferon-gamma production secretion and anti-tumor functional effects.

The quantitative analysis results of fig. 30 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to the GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with an immune checkpoint PD-1 respectively show higher gene enrichment of GO:0070098(chemokine-mediated signaling pathway), and have stronger cell migration function and anti-tumor function effect.

The quantitative analysis results in fig. 31 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to the GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with an immune checkpoint PD-1 respectively show higher gene enrichment of GO:0002449(lymphocyte mediated immunity), and have stronger lymphocyte mediated immunity and anti-tumor functional effects.

The quantitative analysis results in fig. 32 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with an immune checkpoint PD-1 respectively show significantly higher GO:0051251(positive regulation of lymphocyte activation) gene enrichment, and have stronger lymphocyte activation and anti-tumor functional effects.

The quantitative analysis results in fig. 33 show the results of a GO enrichment analysis related to effector function of different chimeric antigen receptor engineered human native killer cells based on immune checkpoint PD-1 fusion at the 48 hour time point of co-culture with tumor cells. According to the GO database annotation classification information, compared with human natural killer cells of a control group and a C #2 group, the human natural killer cells modified and transformed by chimeric antigen receptors C #3 and C #5 fused with the immune checkpoint PD-1 respectively show higher gene enrichment of GO:0001906(cell killing) and have stronger cell killing function and anti-tumor function effect.

In conclusion, through various tumor cytotoxic killing experiments and verification of anti-tumor functions, the chimeric antigen receptor modified natural killer cell based on the immune checkpoint PD-1 fusion exhibits excellent killing capability on tumor cells as shown in FIG. 8, especially on human tumor cells positive to PD-L1. Among them, C #3 and C #5, which are particularly prominent, are Truncated PD-1-Sub1-LL1-ZAP70 and truncatated PD-1-Sub5-LL1-SYK versions, respectively, and demonstrate the necessity and importance of multiple domains of the chimeric antigen receptor for the chimeric antigen receptor to fully perform its function.

Finally, as mentioned above, immune checkpoint blockers and cell therapies are the direction of major breakthroughs in the field of tumor immunity since the last few days. The characteristics of PD-1/PD-L1 antibody drugs and natural killer cells are comprehensively considered, and the application combines various means such as tumor immunology, synthetic biology, molecular engineering, cell engineering and the like to develop a new generation of solid tumor cell therapy based on an immune checkpoint PD-1 signal pathway. The cell therapy applies a chimeric antigen receptor artificial molecular machine which is based on an immune checkpoint PD-1 and has the function of coding and regulating natural killer cells, when tumor cells expressing an immune checkpoint inhibitory signal PD-1 molecular ligand PD-L1 try to inhibit the function of the natural killer cells through a PD-1/PD-L1 immune checkpoint signal channel by the same brake blocking mechanism on the natural killer cells, the modified natural killer cells are recoded by the new generation of artificial molecular machine based on the PD-1, are not inhibited but not inhibited by PD-L1 positive tumor cells, but are further activated to generate specific immune response aiming at the corresponding tumor cells, so that the corresponding tumor cells are identified and killed.

Various cytotoxicity and anti-tumor functional experiments in the application prove that natural killer cells modified by chimeric antigen receptor can better show the activation capability under the condition of inhibiting by immunosuppressive signal molecule ligand PD-L1 and excellent effects of killing and removing various PD-L1 positive solid tumors, including breast cancer, brain cancer, kidney cancer, skin cancer, lung cancer, ovarian cancer, prostate cancer, liver cancer and the like. Therefore, the natural killer cells after the chimeric antigen receptor molecule is modified and transformed successfully overcome the immunosuppression in the entity tumor microenvironment, namely the key problems of immunosuppression, immune escape and the like in the entity tumor immunotherapy are solved, and the tool is believed to open up a new way for the entity tumor therapy and provide an innovative and accurate treatment method for the human cancer therapy.

Although the present application has been described with reference to a few embodiments, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the application as defined by the appended claims.

Sequence listing

<110> Beijing Helian science and technology group, Inc

<120> chimeric antigen receptor modified NK cell and preparation method and application thereof

<130> 2021

<150> 2021100906020

<151> 2021-01-22

<160> 80

<170> SIPOSequenceListing 1.0

<210> 1

<211> 117

<212> PRT

<213> Artifical

<400> 1

Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp Asn

1 5 10 15

Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val Leu

20 25 30

Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala

35 40 45

Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg Val

50 55 60

Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg Ala

65 70 75 80

Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala

85 90 95

Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val Thr

100 105 110

Glu Arg Arg Ala Glu

115

<210> 2

<211> 351

<212> DNA

<213> Artifical

<400> 2

ccccccacct tctccccagc cctgctcgtg gtgaccgaag gggacaacgc caccttcacc 60

tgcagcttct ccaacacatc ggagagcttc gtgctaaact ggtaccgcat gagccccagc 120

aaccagacgg acaagctggc cgccttcccc gaggaccgca gccagcccgg ccaggactgc 180

cgcttccgtg tcacacaact gcccaacggg cgtgacttcc acatgagcgt ggtcagggcc 240

cggcgcaatg acagcggcac ctacctctgt ggggccatct ccctggcccc caaggcgcag 300

atcaaagaga gcctgcgggc agagctcagg gtgacagaga gaagggcaga a 351

<210> 3

<211> 110

<212> PRT

<213> Artifical

<400> 3

Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp Asn Ala

1 5 10 15

Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val Leu Asn

20 25 30

Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe

35 40 45

Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg Val Thr

50 55 60

Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg Ala Arg

65 70 75 80

Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro

85 90 95

Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val

100 105 110

<210> 4

<211> 330

<212> DNA

<213> Artifical

<400> 4

cccaccttct ccccagccct gctcgtggtg accgaagggg acaacgccac cttcacctgc 60

agcttctcca acacatcgga gagcttcgtg ctaaactggt accgcatgag ccccagcaac 120

cagacggaca agctggccgc cttccccgag gaccgcagcc agcccggcca ggactgccgc 180

ttccgtgtca cacaactgcc caacgggcgt gacttccaca tgagcgtggt cagggcccgg 240

cgcaatgaca gcggcaccta cctctgtggg gccatctccc tggcccccaa ggcgcagatc 300

aaagagagcc tgcgggcaga gctcagggtg 330

<210> 5

<211> 121

<212> PRT

<213> Artifical

<400> 5

Phe Leu Asp Ser Pro Asp Arg Pro Trp Asn Pro Pro Thr Phe Ser Pro

1 5 10 15

Ala Leu Leu Val Val Thr Glu Gly Asp Asn Ala Thr Phe Thr Cys Ser

20 25 30

Phe Ser Asn Thr Ser Glu Ser Phe Val Leu Asn Trp Tyr Arg Met Ser

35 40 45

Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala Phe Pro Glu Asp Arg Ser

50 55 60

Gln Pro Gly Gln Asp Cys Arg Phe Arg Val Thr Gln Leu Pro Asn Gly

65 70 75 80

Arg Asp Phe His Met Ser Val Val Arg Ala Arg Arg Asn Asp Ser Gly

85 90 95

Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gln Ile Lys

100 105 110

Glu Ser Leu Arg Ala Glu Leu Arg Val

115 120

<210> 6

<211> 363

<212> DNA

<213> Artifical

<400> 6

ttcttagact ccccagacag gccctggaac ccccccacct tctccccagc cctgctcgtg 60

gtgaccgaag gggacaacgc caccttcacc tgcagcttct ccaacacatc ggagagcttc 120

gtgctaaact ggtaccgcat gagccccagc aaccagacgg acaagctggc cgccttcccc 180

gaggaccgca gccagcccgg ccaggactgc cgcttccgtg tcacacaact gcccaacggg 240

cgtgacttcc acatgagcgt ggtcagggcc cggcgcaatg acagcggcac ctacctctgt 300

ggggccatct ccctggcccc caaggcgcag atcaaagaga gcctgcgggc agagctcagg 360

gtg 363

<210> 7

<211> 251

<212> PRT

<213> Artifical

<400> 7

Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Thr

20 25 30

Lys Ala Ala Trp Tyr Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu

35 40 45

Trp Leu Gly Arg Thr Tyr Phe Arg Ser Lys Trp Tyr Asn Asp Tyr Ala

50 55 60

Asp Ser Val Lys Ser Arg Leu Thr Ile Asn Pro Asp Thr Ser Lys Asn

65 70 75 80

Gln Phe Ser Leu Gln Leu Lys Ser Val Ser Pro Glu Asp Thr Ala Val

85 90 95

Tyr Tyr Cys Ala Arg Gly Gln Tyr Thr Ala Phe Asp Ile Trp Gly Gln

100 105 110

Gly Thr Met Val Thr Val Ser Ser Gly Ile Leu Gly Ser Gly Gly Gly

115 120 125

Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Ser Ala Leu

130 135 140

Ile Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln Ser Ile Thr Ile

145 150 155 160

Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr Asp Leu Val Ser

165 170 175

Trp Tyr Gln Gln Tyr Pro Gly Gln Ala Pro Arg Leu Ile Ile Tyr Glu

180 185 190

Val Ile Lys Arg Pro Ser Gly Ile Ser Asp Arg Phe Ser Gly Ser Lys

195 200 205

Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu Gln Ala Glu Asp

210 215 220

Glu Ala Asp Tyr Tyr Cys Cys Ser Tyr Ala Gly Arg Arg Leu His Gly

225 230 235 240

Val Phe Gly Gly Gly Thr Gln Leu Thr Val Leu

245 250

<210> 8

<211> 753

<212> DNA

<213> Artifical

<400> 8

caggtacagc tgcagcagtc aggtccagga ctggtgaagc cctcgcagac cctctcactc 60

acctgtgcca tctccgggga cagtgtctct agcaccaagg ctgcttggta ctggatcagg 120

cagtcccctt cgagaggcct tgagtggctg ggaaggacat acttccggtc caagtggtat 180

aatgactatg ccgactctgt gaaaagtcga ttaaccatca acccagacac atccaagaac 240

cagttctccc tgcaacttaa gtctgtgagt cccgaggaca cggctgtgta ttactgtgca 300

agagggcaat acactgcttt tgatatctgg ggccaaggga caatggtcac cgtctcttca 360

ggaattctag gatccggtgg cggtggcagc ggcggtggtg gttccggagg cggcggttct 420

cagtctgctc tgattcagcc tgcctccgtg tctgggtccc ctggacagtc gatcactatc 480

tcctgtactg gcaccagtag tgatgttgga ggttatgacc ttgtctcctg gtaccaacag 540

tacccgggcc aagcccccag actcatcatt tatgaggtca ttaagcggcc ctcagggatt 600

tctgatcgct tctctggttc caagtctggc aacacggcct ccctgacaat ctctgggctc 660

caggctgagg acgaggctga ttattattgc tgctcatatg caggtagacg tcttcatggt 720

gtgttcggag gaggcaccca gctgaccgtc ctc 753

<210> 9

<211> 245

<212> PRT

<213> Artifical

<400> 9

Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Ile Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Gly Tyr

20 25 30

Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Met Ile Tyr Asp Val Ser Asn Arg Pro Ser Gly Val Ser Asn Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Thr Ser Ser

85 90 95

Ser Thr Arg Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu Gly Gly

100 105 110

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln

115 120 125

Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg

130 135 140

Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ile Met Met

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ser Ile

165 170 175

Tyr Pro Ser Gly Gly Ile Thr Phe Tyr Ala Asp Thr Val Lys Gly Arg

180 185 190

Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met

195 200 205

Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ile

210 215 220

Lys Leu Gly Thr Val Thr Thr Val Asp Tyr Trp Gly Gln Gly Thr Leu

225 230 235 240

Val Thr Val Ser Ser

245

<210> 10

<211> 735

<212> DNA

<213> Artifical

<400> 10

cagtccgccc tgacccagcc tgcctccgtg tctggctccc ctggccagtc catcaccatc 60

agctgcaccg gcacctccag cgacgtgggc ggctacaact acgtgtcctg gtatcagcag 120

caccccggca aggcccccaa gctgatgatc tacgacgtgt ccaaccggcc ctccggcgtg 180

tccaacagat tctccggctc caagtccggc aacaccgcct ccctgaccat cagcggactg 240

caggcagagg acgaggccga ctactactgc tcctcctaca cctcctccag caccagagtg 300

ttcggcaccg gcacaaaagt gaccgtgctg ggagggggcg gttccggagg aggcggcagc 360

gggggaggag gtagcgaggt gcagctgctg gaatccggcg gaggactggt gcagcctggc 420

ggctccctga gactgtcttg cgccgcctcc ggcttcacct tctccagcta catcatgatg 480

tgggtgcgac aggcccctgg caagggcctg gaatgggtgt cctccatcta cccctccggc 540

ggcatcacct tctacgccga caccgtgaag ggccggttca ccatctcccg ggacaactcc 600

aagaacaccc tgtacctgca gatgaactcc ctgcgggccg aggacaccgc cgtgtactac 660

tgcgcccgga tcaagctggg caccgtgacc accgtggact actggggcca gggcaccctg 720

gtgacagtgt cctcc 735

<210> 11

<211> 254

<212> PRT

<213> Artifical

<400> 11

Glu Ile Val Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Ile Ile Thr Cys Gln Ala Ser Glu Asp Ile Tyr Ser Leu

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Asp Leu Ala Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Ala Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gly Asn Tyr Gly Ser Ser Ser

85 90 95

Ser Ser Ser Tyr Gly Ala Val Phe Gly Gln Gly Thr Lys Leu Thr Val

100 105 110

Leu Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly

130 135 140

Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Thr Val Ser Gly

145 150 155 160

Ile Asp Leu Ser Ser Tyr Thr Met Gly Trp Val Arg Gln Ala Pro Gly

165 170 175

Lys Gly Leu Glu Trp Val Gly Ile Ile Ser Ser Gly Gly Arg Thr Tyr

180 185 190

Tyr Ala Ser Trp Ala Lys Gly Arg Phe Thr Ile Ser Arg Asp Thr Ser

195 200 205

Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

210 215 220

Ala Val Tyr Tyr Cys Ala Arg Gly Arg Tyr Thr Gly Tyr Pro Tyr Tyr

225 230 235 240

Phe Ala Leu Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

245 250

<210> 12

<211> 21

<212> PRT

<213> Artifical

<400> 12

Val Gly Val Val Gly Gly Leu Leu Gly Ser Leu Val Leu Leu Val Trp

1 5 10 15

Val Leu Ala Val Ile

20

<210> 13

<211> 63

<212> DNA

<213> Artifical

<400> 13

gttggtgtcg tgggcggcct gctgggcagc ctggtgctgc tagtctgggt cctggccgtc 60

atc 63

<210> 14

<211> 24

<212> PRT

<213> Artifical

<400> 14

Thr Leu Val Val Gly Val Val Gly Gly Leu Leu Gly Ser Leu Val Leu

1 5 10 15

Leu Val Trp Val Leu Ala Val Ile

20

<210> 15

<211> 72

<212> DNA

<213> Artifical

<400> 15

accctggtgg ttggtgtcgt gggcggcctg ctgggcagcc tggtgctgct agtctgggtc 60

ctggccgtca tc 72

<210> 16

<211> 20

<212> PRT

<213> Artifical

<400> 16

Val Pro Thr Ala His Pro Ser Pro Ser Pro Arg Pro Ala Gly Gln Phe

1 5 10 15

Gln Thr Leu Val

20

<210> 17

<211> 60

<212> DNA

<213> Artifical

<400> 17

gtgcccacag cccaccccag cccctcaccc aggccagccg gccagttcca aaccctggtg 60

<210> 18

<211> 23

<212> PRT

<213> Artifical

<400> 18

Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro

1 5 10 15

Arg Pro Ala Gly Gln Phe Gln

20

<210> 19

<211> 69

<212> DNA

<213> Artifical

<400> 19

acagagagaa gggcagaagt gcccacagcc caccccagcc cctcacccag gccagccggc 60

cagttccaa 69

<210> 20

<211> 20

<212> PRT

<213> Artifical

<400> 20

Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp

1 5 10 15

Val Leu Asp Lys

20

<210> 21

<211> 60

<212> DNA

<213> Artifical

<400> 21

aaccagctct ataacgagct caatctagga cgaagagagg agtacgatgt tttggacaag 60

<210> 22

<211> 20

<212> PRT

<213> Artifical

<400> 22

Asn Gln Leu Phe Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Phe Asp

1 5 10 15

Val Leu Asp Lys

20

<210> 23

<211> 60

<212> DNA

<213> Artifical

<400> 23

aaccagctct ttaacgagct caatctagga cgaagagagg agttcgatgt tttggacaag 60

<210> 24

<211> 21

<212> PRT

<213> Artifical

<400> 24

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

1 5 10 15

Ser Glu Ile Gly Met

20

<210> 25

<211> 63

<212> DNA

<213> Artifical

<400> 25

gaaggcctgt acaatgaact gcagaaagat aagatggcgg aggcctacag tgagattggg 60

atg 63

<210> 26

<211> 21

<212> PRT

<213> Artifical

<400> 26

Glu Gly Leu Phe Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Phe

1 5 10 15

Ser Glu Ile Gly Met

20

<210> 27

<211> 63

<212> DNA

<213> Artifical

<400> 27

gaaggcctgt tcaatgaact gcagaaagat aagatggcgg aggccttcag tgagattggg 60

atg 63

<210> 28

<211> 20

<212> PRT

<213> Artifical

<400> 28

Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp

1 5 10 15

Ala Leu His Met

20

<210> 29

<211> 60

<212> DNA

<213> Artifical

<400> 29

gatggccttt accagggact cagtacagcc accaaggaca cctacgacgc ccttcacatg 60

<210> 30

<211> 20

<212> PRT

<213> Artifical

<400> 30

Asp Gly Leu Phe Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Phe Asp

1 5 10 15

Ala Leu His Met

20

<210> 31

<211> 60

<212> DNA

<213> Artifical

<400> 31

gatggccttt tccagggact cagtacagcc accaaggaca ccttcgacgc ccttcacatg 60

<210> 32

<211> 20

<212> PRT

<213> Artifical

<400> 32

Pro Asp Tyr Glu Pro Ile Arg Lys Gly Gln Arg Asp Leu Tyr Ser Gly

1 5 10 15

Leu Asn Gln Arg

20

<210> 33

<211> 60

<212> DNA

<213> Artifical

<400> 33

ccagactatg agcccatccg gaaaggccag cgggacctgt attctggcct gaatcagaga 60

<210> 34

<211> 20

<212> PRT

<213> Artifical

<400> 34

Pro Asp Phe Glu Pro Ile Arg Lys Gly Gln Arg Asp Leu Phe Ser Gly

1 5 10 15

Leu Asn Gln Arg

20

<210> 35

<211> 60

<212> DNA

<213> Artifical

<400> 35

ccagactttg agcccatccg gaaaggccag cgggacctgt tttctggcct gaatcagaga 60

<210> 36

<211> 27

<212> PRT

<213> Artifical

<400> 36

Gly Gly Tyr Met Thr Leu Asn Pro Arg Ala Pro Thr Asp Asp Asp Lys

1 5 10 15

Asn Ile Tyr Leu Thr Leu Pro Pro Asn Gly Thr

20 25

<210> 37

<211> 81

<212> DNA

<213> Artifical

<400> 37

ggcggctaca tgactctgaa ccccagggca cctactgacg atgataaaaa catctacctg 60

actcttcctc ccaacggtac c 81

<210> 38

<211> 20

<212> PRT

<213> Artifical

<400> 38

Gly Val Tyr Thr Gly Leu Ser Thr Arg Asn Gln Glu Thr Tyr Glu Thr

1 5 10 15

Leu Lys His Glu

20

<210> 39

<211> 60

<212> DNA

<213> Artifical

<400> 39

ggtgtttaca cgggcctgag caccaggaac caggagactt acgagactct gaagcatgag 60

<210> 40

<211> 22

<212> PRT

<213> Artifical

<400> 40

Ser Pro Tyr Gln Glu Leu Gln Gly Gln Arg Ser Asp Val Tyr Ser Asp

1 5 10 15

Leu Asn Thr Gln Gly Thr

20

<210> 41

<211> 66

<212> DNA

<213> Artifical

<400> 41

tcgccttatc aggaactcca gggtcagagg tcggatgtct acagcgacct caacacacag 60

ggtacc 66

<210> 42

<211> 618

<212> PRT

<213> Artifical

<400> 42

Pro Asp Pro Ala Ala His Leu Pro Phe Phe Tyr Gly Ser Ile Ser Arg

1 5 10 15

Ala Glu Ala Glu Glu His Leu Lys Leu Ala Gly Met Ala Asp Gly Leu

20 25 30

Phe Leu Leu Arg Gln Cys Leu Arg Ser Leu Gly Gly Tyr Val Leu Ser

35 40 45

Leu Val His Asp Val Arg Phe His His Phe Pro Ile Glu Arg Gln Leu

50 55 60

Asn Gly Thr Tyr Ala Ile Ala Gly Gly Lys Ala His Cys Gly Pro Ala

65 70 75 80

Glu Leu Cys Glu Phe Tyr Ser Arg Asp Pro Asp Gly Leu Pro Cys Asn

85 90 95

Leu Arg Lys Pro Cys Asn Arg Pro Ser Gly Leu Glu Pro Gln Pro Gly

100 105 110

Val Phe Asp Cys Leu Arg Asp Ala Met Val Arg Asp Tyr Val Arg Gln

115 120 125

Thr Trp Lys Leu Glu Gly Glu Ala Leu Glu Gln Ala Ile Ile Ser Gln

130 135 140

Ala Pro Gln Val Glu Lys Leu Ile Ala Thr Thr Ala His Glu Arg Met

145 150 155 160

Pro Trp Tyr His Ser Ser Leu Thr Arg Glu Glu Ala Glu Arg Lys Leu

165 170 175

Tyr Ser Gly Ala Gln Thr Asp Gly Lys Phe Leu Leu Arg Pro Arg Lys

180 185 190

Glu Gln Gly Thr Tyr Ala Leu Ser Leu Ile Tyr Gly Lys Thr Val Tyr

195 200 205

His Tyr Leu Ile Ser Gln Asp Lys Ala Gly Lys Tyr Cys Ile Pro Glu

210 215 220

Gly Thr Lys Phe Asp Thr Leu Trp Gln Leu Val Glu Tyr Leu Lys Leu

225 230 235 240

Lys Ala Asp Gly Leu Ile Tyr Cys Leu Lys Glu Ala Cys Pro Asn Ser

245 250 255

Ser Ala Ser Asn Ala Ser Gly Ala Ala Ala Pro Thr Leu Pro Ala His

260 265 270

Pro Ser Thr Leu Thr His Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser

275 280 285

Asp Gly Tyr Thr Pro Glu Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro

290 295 300

Arg Pro Met Pro Met Asp Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp

305 310 315 320

Pro Glu Glu Leu Lys Asp Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu

325 330 335

Leu Ile Ala Asp Ile Glu Leu Gly Cys Gly Asn Phe Gly Ser Val Arg

340 345 350

Gln Gly Val Tyr Arg Met Arg Lys Lys Gln Ile Asp Val Ala Ile Lys

355 360 365

Val Leu Lys Gln Gly Thr Glu Lys Ala Asp Thr Glu Glu Met Met Arg

370 375 380

Glu Ala Gln Ile Met His Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu

385 390 395 400

Ile Gly Val Cys Gln Ala Glu Ala Leu Met Leu Val Met Glu Met Ala

405 410 415

Gly Gly Gly Pro Leu His Lys Phe Leu Val Gly Lys Arg Glu Glu Ile

420 425 430

Pro Val Ser Asn Val Ala Glu Leu Leu His Gln Val Ser Met Gly Met

435 440 445

Lys Tyr Leu Glu Glu Lys Asn Phe Val His Arg Asp Leu Ala Ala Arg

450 455 460

Asn Val Leu Leu Val Asn Arg His Tyr Ala Lys Ile Ser Asp Phe Gly

465 470 475 480

Leu Ser Lys Ala Leu Gly Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser

485 490 495

Ala Gly Lys Trp Pro Leu Lys Trp Tyr Ala Pro Glu Cys Ile Asn Phe

500 505 510

Arg Lys Phe Ser Ser Arg Ser Asp Val Trp Ser Tyr Gly Val Thr Met

515 520 525

Trp Glu Ala Leu Ser Tyr Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly

530 535 540

Pro Glu Val Met Ala Phe Ile Glu Gln Gly Lys Arg Met Glu Cys Pro

545 550 555 560

Pro Glu Cys Pro Pro Glu Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile

565 570 575

Tyr Lys Trp Glu Asp Arg Pro Asp Phe Leu Thr Val Glu Gln Arg Met

580 585 590

Arg Ala Cys Tyr Tyr Ser Leu Ala Ser Lys Val Glu Gly Pro Pro Gly

595 600 605

Ser Thr Gln Lys Ala Glu Ala Ala Cys Ala

610 615

<210> 43

<211> 1854

<212> DNA

<213> Artifical

<400> 43

ccagaccccg cggcgcacct gcccttcttc tacggcagca tctcgcgtgc cgaggccgag 60

gagcacctga agctggcggg catggcggac gggctcttcc tgctgcgcca gtgcctgcgc 120

tcgctgggcg gctatgtgct gtcgctcgtg cacgatgtgc gcttccacca ctttcccatc 180

gagcgccagc tcaacggcac ctacgccatt gccggcggca aagcgcactg tggaccggca 240

gagctctgcg agttctactc gcgcgacccc gacgggctgc cctgcaacct gcgcaagccg 300

tgcaaccggc cgtcgggcct cgagccgcag ccgggggtct tcgactgcct gcgagacgcc 360

atggtgcgtg actacgtgcg ccagacgtgg aagctggagg gcgaggccct ggagcaggcc 420

atcatcagcc aggccccgca ggtggagaag ctcattgcta cgacggccca cgagcggatg 480

ccctggtacc acagcagcct gacgcgtgag gaggccgagc gcaaacttta ctctggggcg 540

cagaccgacg gcaagttcct gctgaggccg cggaaggagc agggcacata cgccctgtcc 600

ctcatctatg ggaagacggt gtaccactac ctcatcagcc aagacaaggc gggcaagtac 660

tgcattcccg agggcaccaa gtttgacacg ctctggcagc tggtggagta tctgaagctg 720

aaggcggacg ggctcatcta ctgcctgaag gaggcctgcc ccaacagcag tgccagcaac 780

gcctcagggg ctgctgctcc cacactccca gcccacccat ccacgttgac tcatcctcag 840

agacgaatcg acaccctcaa ctcagatgga tacacccctg agccagcacg cataacgtcc 900

ccagacaaac cgcggccgat gcccatggac acgagcgtgt atgagagccc ctacagcgac 960

ccagaggagc tcaaggacaa gaagctcttc ctgaagcgcg ataacctcct catagctgac 1020

attgaacttg gctgcggcaa ctttggctca gtgcgccagg gcgtgtaccg catgcgcaag 1080

aagcagatcg acgtggccat caaggtgctg aagcagggca cggagaaggc agacacggaa 1140

gagatgatgc gcgaggcgca gatcatgcac cagctggaca acccctacat cgtgcggctc 1200

attggcgtct gccaggccga ggccctcatg ctggtcatgg agatggctgg gggcgggccg 1260

ctgcacaagt tcctggtcgg caagagggag gagatccctg tgagcaatgt ggccgagctg 1320

ctgcaccagg tgtccatggg gatgaagtac ctggaggaga agaactttgt gcaccgtgac 1380

ctggcggccc gcaacgtcct gctggttaac cggcactacg ccaagatcag cgactttggc 1440

ctctccaaag cactgggtgc cgacgacagc tactacactg cccgctcagc agggaagtgg 1500

ccgctcaagt ggtacgcacc cgaatgcatc aacttccgca agttctccag ccgcagcgat 1560

gtctggagct atggggtcac catgtgggag gccttgtcct acggccagaa gccctacaag 1620

aagatgaaag ggccggaggt catggccttc atcgagcagg gcaagcggat ggagtgccca 1680

ccagagtgtc cacccgaact gtacgcactc atgagtgact gctggatcta caagtgggag 1740

gatcgccccg acttcctgac cgtggagcag cgcatgcgag cctgttacta cagcctggcc 1800

agcaaggtgg aagggccccc aggcagcaca cagaaggctg aggctgcctg tgcc 1854

<210> 44

<211> 634

<212> PRT

<213> Artifical

<400> 44

Ala Ser Ser Gly Met Ala Asp Ser Ala Asn His Leu Pro Phe Phe Phe

1 5 10 15

Gly Asn Ile Thr Arg Glu Glu Ala Glu Asp Tyr Leu Val Gln Gly Gly

20 25 30

Met Ser Asp Gly Leu Tyr Leu Leu Arg Gln Ser Arg Asn Tyr Leu Gly

35 40 45

Gly Phe Ala Leu Ser Val Ala His Gly Arg Lys Ala His His Tyr Thr

50 55 60

Ile Glu Arg Glu Leu Asn Gly Thr Tyr Ala Ile Ala Gly Gly Arg Thr

65 70 75 80

His Ala Ser Pro Ala Asp Leu Cys His Tyr His Ser Gln Glu Ser Asp

85 90 95

Gly Leu Val Cys Leu Leu Lys Lys Pro Phe Asn Arg Pro Gln Gly Val

100 105 110

Gln Pro Lys Thr Gly Pro Phe Glu Asp Leu Lys Glu Asn Leu Ile Arg

115 120 125

Glu Tyr Val Lys Gln Thr Trp Asn Leu Gln Gly Gln Ala Leu Glu Gln

130 135 140

Ala Ile Ile Ser Gln Lys Pro Gln Leu Glu Lys Leu Ile Ala Thr Thr

145 150 155 160

Ala His Glu Lys Met Pro Trp Phe His Gly Lys Ile Ser Arg Glu Glu

165 170 175

Ser Glu Gln Ile Val Leu Ile Gly Ser Lys Thr Asn Gly Lys Phe Leu

180 185 190

Ile Arg Ala Arg Asp Asn Asn Gly Ser Tyr Ala Leu Cys Leu Leu His

195 200 205

Glu Gly Lys Val Leu His Tyr Arg Ile Asp Lys Asp Lys Thr Gly Lys

210 215 220

Leu Ser Ile Pro Glu Gly Lys Lys Phe Asp Thr Leu Trp Gln Leu Val

225 230 235 240

Glu His Tyr Ser Tyr Lys Ala Asp Gly Leu Leu Arg Val Leu Thr Val

245 250 255

Pro Cys Gln Lys Ile Gly Thr Gln Gly Asn Val Asn Phe Gly Gly Arg

260 265 270

Pro Gln Leu Pro Gly Ser His Pro Ala Thr Trp Ser Ala Gly Gly Ile

275 280 285

Ile Ser Arg Ile Lys Ser Tyr Ser Phe Pro Lys Pro Gly His Arg Lys

290 295 300

Ser Ser Pro Ala Gln Gly Asn Arg Gln Glu Ser Thr Val Ser Phe Asn

305 310 315 320

Pro Tyr Glu Pro Glu Leu Ala Pro Trp Ala Ala Asp Lys Gly Pro Gln

325 330 335

Arg Glu Ala Leu Pro Met Asp Thr Glu Val Tyr Glu Ser Pro Tyr Ala

340 345 350

Asp Pro Glu Glu Ile Arg Pro Lys Glu Val Tyr Leu Asp Arg Lys Leu

355 360 365

Leu Thr Leu Glu Asp Lys Glu Leu Gly Ser Gly Asn Phe Gly Thr Val

370 375 380

Lys Lys Gly Tyr Tyr Gln Met Lys Lys Val Val Lys Thr Val Ala Val

385 390 395 400

Lys Ile Leu Lys Asn Glu Ala Asn Asp Pro Ala Leu Lys Asp Glu Leu

405 410 415

Leu Ala Glu Ala Asn Val Met Gln Gln Leu Asp Asn Pro Tyr Ile Val

420 425 430

Arg Met Ile Gly Ile Cys Glu Ala Glu Ser Trp Met Leu Val Met Glu

435 440 445

Met Ala Glu Leu Gly Pro Leu Asn Lys Tyr Leu Gln Gln Asn Arg His

450 455 460

Val Lys Asp Lys Asn Ile Ile Glu Leu Val His Gln Val Ser Met Gly

465 470 475 480

Met Lys Tyr Leu Glu Glu Ser Asn Phe Val His Arg Asp Leu Ala Ala

485 490 495

Arg Asn Val Leu Leu Val Thr Gln His Tyr Ala Lys Ile Ser Asp Phe

500 505 510

Gly Leu Ser Lys Ala Leu Arg Ala Asp Glu Asn Tyr Tyr Lys Ala Gln

515 520 525

Thr His Gly Lys Trp Pro Val Lys Trp Tyr Ala Pro Glu Cys Ile Asn

530 535 540

Tyr Tyr Lys Phe Ser Ser Lys Ser Asp Val Trp Ser Phe Gly Val Leu

545 550 555 560

Met Trp Glu Ala Phe Ser Tyr Gly Gln Lys Pro Tyr Arg Gly Met Lys

565 570 575

Gly Ser Glu Val Thr Ala Met Leu Glu Lys Gly Glu Arg Met Gly Cys

580 585 590

Pro Ala Gly Cys Pro Arg Glu Met Tyr Asp Leu Met Asn Leu Cys Trp

595 600 605

Thr Tyr Asp Val Glu Asn Arg Pro Gly Phe Ala Ala Val Glu Leu Arg

610 615 620

Leu Arg Asn Tyr Tyr Tyr Asp Val Val Asn

625 630

<210> 45

<211> 1902

<212> DNA

<213> Artifical

<400> 45

gccagcagcg gcatggctga cagcgccaac cacctgccct tctttttcgg caacatcacc 60

cgggaggagg cagaagatta cctggtccag gggggcatga gtgatgggct ttatttgctg 120

cgccagagcc gcaactacct gggtggcttc gccctgtccg tggcccacgg gaggaaggca 180

caccactaca ccatcgagcg ggagctgaat ggcacctacg ccatcgccgg tggcaggacc 240

catgccagcc ccgccgacct ctgccactac cactcccagg agtctgatgg cctggtctgc 300

ctcctcaaga agcccttcaa ccggccccaa ggggtgcagc ccaagactgg gccctttgag 360

gatttgaagg aaaacctcat cagggaatat gtgaagcaga catggaacct gcagggtcag 420

gctctggagc aggccatcat cagtcagaag cctcagctgg agaagctgat cgctaccaca 480

gcccatgaaa aaatgccttg gttccatgga aaaatctctc gggaagaatc tgagcaaatt 540

gtcctgatag gatcaaagac aaatggaaag ttcctgatcc gagccagaga caacaacggc 600

tcctacgccc tgtgcctgct gcacgaaggg aaggtgctgc actatcgcat cgacaaagac 660

aagacaggga agctctccat ccccgaggga aagaagttcg acacgctctg gcagctagtc 720

gagcattatt cttataaagc agatggtttg ttaagagttc ttactgtccc atgtcaaaaa 780

atcggcacac agggaaatgt taattttgga ggccgtccac aacttccagg ttcccatcct 840

gcgacttggt cagcgggtgg aataatctca agaatcaaat catactcctt cccaaagcct 900

ggccacagaa agtcctcccc tgcccaaggg aaccggcaag agagtactgt gtcattcaat 960

ccgtatgagc cagaacttgc accctgggct gcagacaaag gcccccagag agaagcccta 1020

cccatggaca cagaggtgta cgagagcccc tacgcggacc ccgaggagat caggcccaag 1080

gaggtttacc tggaccgaaa gctgctgacg ctggaagaca aagaactggg ctctggtaat 1140

tttggaactg tgaaaaaggg ctactaccaa atgaaaaaag ttgtgaaaac cgtggctgtg 1200

aaaatactga aaaacgaggc caatgacccc gctcttaaag atgagttatt agcagaagca 1260

aatgtcatgc agcagctgga caacccgtac atcgtgcgga tgatcgggat atgcgaggcc 1320

gagtcctgga tgctggttat ggagatggca gaacttggtc ccctcaataa gtatttgcag 1380

cagaacagac atgtcaagga taagaacatc atagaactgg ttcatcaggt ttccatgggc 1440

atgaagtact tggaggagag caattttgtg cacagagatc tggctgcaag aaatgtgttg 1500

ctagttaccc aacattacgc caagatcagt gatttcggac tttccaaagc actgcgtgct 1560

gatgaaaact actacaaggc ccagacccat ggaaagtggc ctgtcaagtg gtacgctccg 1620

gaatgcatca actactacaa gttctccagc aaaagcgatg tctggagctt tggagtgttg 1680

atgtgggaag cattctccta tgggcagaag ccatatcgag ggatgaaagg aagtgaagtc 1740

accgctatgt tagagaaagg agagcggatg gggtgccctg cagggtgtcc aagagagatg 1800

tacgatctca tgaatctgtg ctggacatac gatgtggaaa acaggcccgg attcgcagca 1860

gtggaactgc ggctgcgcaa ttactactat gacgtggtga ac 1902

<210> 46

<211> 336

<212> PRT

<213> Artifical

<400> 46

Pro Asp Pro Ala Ala His Leu Pro Phe Phe Tyr Gly Ser Ile Ser Arg

1 5 10 15

Ala Glu Ala Glu Glu His Leu Lys Leu Ala Gly Met Ala Asp Gly Leu

20 25 30

Phe Leu Leu Arg Gln Cys Leu Arg Ser Leu Gly Gly Tyr Val Leu Ser

35 40 45

Leu Val His Asp Val Arg Phe His His Phe Pro Ile Glu Arg Gln Leu

50 55 60

Asn Gly Thr Tyr Ala Ile Ala Gly Gly Lys Ala His Cys Gly Pro Ala

65 70 75 80

Glu Leu Cys Glu Phe Tyr Ser Arg Asp Pro Asp Gly Leu Pro Cys Asn

85 90 95

Leu Arg Lys Pro Cys Asn Arg Pro Ser Gly Leu Glu Pro Gln Pro Gly

100 105 110

Val Phe Asp Cys Leu Arg Asp Ala Met Val Arg Asp Tyr Val Arg Gln

115 120 125

Thr Trp Lys Leu Glu Gly Glu Ala Leu Glu Gln Ala Ile Ile Ser Gln

130 135 140

Ala Pro Gln Val Glu Lys Leu Ile Ala Thr Thr Ala His Glu Arg Met

145 150 155 160

Pro Trp Tyr His Ser Ser Leu Thr Arg Glu Glu Ala Glu Arg Lys Leu

165 170 175

Tyr Ser Gly Ala Gln Thr Asp Gly Lys Phe Leu Leu Arg Pro Arg Lys

180 185 190

Glu Gln Gly Thr Tyr Ala Leu Ser Leu Ile Tyr Gly Lys Thr Val Tyr

195 200 205

His Tyr Leu Ile Ser Gln Asp Lys Ala Gly Lys Tyr Cys Ile Pro Glu

210 215 220

Gly Thr Lys Phe Asp Thr Leu Trp Gln Leu Val Glu Tyr Leu Lys Leu

225 230 235 240

Lys Ala Asp Gly Leu Ile Tyr Cys Leu Lys Glu Ala Cys Pro Asn Ser

245 250 255

Ser Ala Ser Asn Ala Ser Gly Ala Ala Ala Pro Thr Leu Pro Ala His

260 265 270

Pro Ser Thr Leu Thr His Pro Gln Arg Arg Ile Asp Thr Leu Asn Ser

275 280 285

Asp Gly Tyr Thr Pro Glu Pro Ala Arg Ile Thr Ser Pro Asp Lys Pro

290 295 300

Arg Pro Met Pro Met Asp Thr Ser Val Tyr Glu Ser Pro Tyr Ser Asp

305 310 315 320

Pro Glu Glu Leu Lys Asp Lys Lys Leu Phe Leu Lys Arg Asp Asn Leu

325 330 335

<210> 47

<211> 1008

<212> DNA

<213> Artifical

<400> 47

ccagaccccg cggcgcacct gcccttcttc tacggcagca tctcgcgtgc cgaggccgag 60

gagcacctga agctggcggg catggcggac gggctcttcc tgctgcgcca gtgcctgcgc 120

tcgctgggcg gctatgtgct gtcgctcgtg cacgatgtgc gcttccacca ctttcccatc 180

gagcgccagc tcaacggcac ctacgccatt gccggcggca aagcgcactg tggaccggca 240

gagctctgcg agttctactc gcgcgacccc gacgggctgc cctgcaacct gcgcaagccg 300

tgcaaccggc cgtcgggcct cgagccgcag ccgggggtct tcgactgcct gcgagacgcc 360

atggtgcgtg actacgtgcg ccagacgtgg aagctggagg gcgaggccct ggagcaggcc 420

atcatcagcc aggccccgca ggtggagaag ctcattgcta cgacggccca cgagcggatg 480

ccctggtacc acagcagcct gacgcgtgag gaggccgagc gcaaacttta ctctggggcg 540

cagaccgacg gcaagttcct gctgaggccg cggaaggagc agggcacata cgccctgtcc 600

ctcatctatg ggaagacggt gtaccactac ctcatcagcc aagacaaggc gggcaagtac 660

tgcattcccg agggcaccaa gtttgacacg ctctggcagc tggtggagta tctgaagctg 720

aaggcggacg ggctcatcta ctgcctgaag gaggcctgcc ccaacagcag tgccagcaac 780

gcctcagggg ctgctgctcc cacactccca gcccacccat ccacgttgac tcatcctcag 840

agacgaatcg acaccctcaa ctcagatgga tacacccctg agccagcacg cataacgtcc 900

ccagacaaac cgcggccgat gcccatggac acgagcgtgt atgagagccc ctacagcgac 960

ccagaggagc tcaaggacaa gaagctcttc ctgaagcgcg ataacctc 1008

<210> 48

<211> 369

<212> PRT

<213> Artifical

<400> 48

Ala Ser Ser Gly Met Ala Asp Ser Ala Asn His Leu Pro Phe Phe Phe

1 5 10 15

Gly Asn Ile Thr Arg Glu Glu Ala Glu Asp Tyr Leu Val Gln Gly Gly

20 25 30

Met Ser Asp Gly Leu Tyr Leu Leu Arg Gln Ser Arg Asn Tyr Leu Gly

35 40 45

Gly Phe Ala Leu Ser Val Ala His Gly Arg Lys Ala His His Tyr Thr

50 55 60

Ile Glu Arg Glu Leu Asn Gly Thr Tyr Ala Ile Ala Gly Gly Arg Thr

65 70 75 80

His Ala Ser Pro Ala Asp Leu Cys His Tyr His Ser Gln Glu Ser Asp

85 90 95

Gly Leu Val Cys Leu Leu Lys Lys Pro Phe Asn Arg Pro Gln Gly Val

100 105 110

Gln Pro Lys Thr Gly Pro Phe Glu Asp Leu Lys Glu Asn Leu Ile Arg

115 120 125

Glu Tyr Val Lys Gln Thr Trp Asn Leu Gln Gly Gln Ala Leu Glu Gln

130 135 140

Ala Ile Ile Ser Gln Lys Pro Gln Leu Glu Lys Leu Ile Ala Thr Thr

145 150 155 160

Ala His Glu Lys Met Pro Trp Phe His Gly Lys Ile Ser Arg Glu Glu

165 170 175

Ser Glu Gln Ile Val Leu Ile Gly Ser Lys Thr Asn Gly Lys Phe Leu

180 185 190

Ile Arg Ala Arg Asp Asn Asn Gly Ser Tyr Ala Leu Cys Leu Leu His

195 200 205

Glu Gly Lys Val Leu His Tyr Arg Ile Asp Lys Asp Lys Thr Gly Lys

210 215 220

Leu Ser Ile Pro Glu Gly Lys Lys Phe Asp Thr Leu Trp Gln Leu Val

225 230 235 240

Glu His Tyr Ser Tyr Lys Ala Asp Gly Leu Leu Arg Val Leu Thr Val

245 250 255

Pro Cys Gln Lys Ile Gly Thr Gln Gly Asn Val Asn Phe Gly Gly Arg

260 265 270

Pro Gln Leu Pro Gly Ser His Pro Ala Thr Trp Ser Ala Gly Gly Ile

275 280 285

Ile Ser Arg Ile Lys Ser Tyr Ser Phe Pro Lys Pro Gly His Arg Lys

290 295 300

Ser Ser Pro Ala Gln Gly Asn Arg Gln Glu Ser Thr Val Ser Phe Asn

305 310 315 320

Pro Tyr Glu Pro Glu Leu Ala Pro Trp Ala Ala Asp Lys Gly Pro Gln

325 330 335

Arg Glu Ala Leu Pro Met Asp Thr Glu Val Tyr Glu Ser Pro Tyr Ala

340 345 350

Asp Pro Glu Glu Ile Arg Pro Lys Glu Val Tyr Leu Asp Arg Lys Leu

355 360 365

Leu

<210> 49

<211> 1107

<212> DNA

<213> Artifical

<400> 49

gccagcagcg gcatggctga cagcgccaac cacctgccct tctttttcgg caacatcacc 60

cgggaggagg cagaagatta cctggtccag gggggcatga gtgatgggct ttatttgctg 120

cgccagagcc gcaactacct gggtggcttc gccctgtccg tggcccacgg gaggaaggca 180

caccactaca ccatcgagcg ggagctgaat ggcacctacg ccatcgccgg tggcaggacc 240

catgccagcc ccgccgacct ctgccactac cactcccagg agtctgatgg cctggtctgc 300

ctcctcaaga agcccttcaa ccggccccaa ggggtgcagc ccaagactgg gccctttgag 360

gatttgaagg aaaacctcat cagggaatat gtgaagcaga catggaacct gcagggtcag 420

gctctggagc aggccatcat cagtcagaag cctcagctgg agaagctgat cgctaccaca 480

gcccatgaaa aaatgccttg gttccatgga aaaatctctc gggaagaatc tgagcaaatt 540

gtcctgatag gatcaaagac aaatggaaag ttcctgatcc gagccagaga caacaacggc 600

tcctacgccc tgtgcctgct gcacgaaggg aaggtgctgc actatcgcat cgacaaagac 660

aagacaggga agctctccat ccccgaggga aagaagttcg acacgctctg gcagctagtc 720

gagcattatt cttataaagc agatggtttg ttaagagttc ttactgtccc atgtcaaaaa 780

atcggcacac agggaaatgt taattttgga ggccgtccac aacttccagg ttcccatcct 840

gcgacttggt cagcgggtgg aataatctca agaatcaaat catactcctt cccaaagcct 900

ggccacagaa agtcctcccc tgcccaaggg aaccggcaag agagtactgt gtcattcaat 960

ccgtatgagc cagaacttgc accctgggct gcagacaaag gcccccagag agaagcccta 1020

cccatggaca cagaggtgta cgagagcccc tacgcggacc ccgaggagat caggcccaag 1080

gaggtttacc tggaccgaaa gctgctg 1107

<210> 50

<211> 263

<212> PRT

<213> Artifical

<400> 50

Leu Ile Ala Asp Ile Glu Leu Gly Cys Gly Asn Phe Gly Ser Val Arg

1 5 10 15

Gln Gly Val Tyr Arg Met Arg Lys Lys Gln Ile Asp Val Ala Ile Lys

20 25 30

Val Leu Lys Gln Gly Thr Glu Lys Ala Asp Thr Glu Glu Met Met Arg

35 40 45

Glu Ala Gln Ile Met His Gln Leu Asp Asn Pro Tyr Ile Val Arg Leu

50 55 60

Ile Gly Val Cys Gln Ala Glu Ala Leu Met Leu Val Met Glu Met Ala

65 70 75 80

Gly Gly Gly Pro Leu His Lys Phe Leu Val Gly Lys Arg Glu Glu Ile

85 90 95

Pro Val Ser Asn Val Ala Glu Leu Leu His Gln Val Ser Met Gly Met

100 105 110

Lys Tyr Leu Glu Glu Lys Asn Phe Val His Arg Asp Leu Ala Ala Arg

115 120 125

Asn Val Leu Leu Val Asn Arg His Tyr Ala Lys Ile Ser Asp Phe Gly

130 135 140

Leu Ser Lys Ala Leu Gly Ala Asp Asp Ser Tyr Tyr Thr Ala Arg Ser

145 150 155 160

Ala Gly Lys Trp Pro Leu Lys Trp Tyr Ala Pro Glu Cys Ile Asn Phe

165 170 175

Arg Lys Phe Ser Ser Arg Ser Asp Val Trp Ser Tyr Gly Val Thr Met

180 185 190

Trp Glu Ala Leu Ser Tyr Gly Gln Lys Pro Tyr Lys Lys Met Lys Gly

195 200 205

Pro Glu Val Met Ala Phe Ile Glu Gln Gly Lys Arg Met Glu Cys Pro

210 215 220

Pro Glu Cys Pro Pro Glu Leu Tyr Ala Leu Met Ser Asp Cys Trp Ile

225 230 235 240

Tyr Lys Trp Glu Asp Arg Pro Asp Phe Leu Thr Val Glu Gln Arg Met

245 250 255

Arg Ala Cys Tyr Tyr Ser Leu

260

<210> 51

<211> 789

<212> DNA

<213> Artifical

<400> 51

ctcatagctg acattgaact tggctgcggc aactttggct cagtgcgcca gggcgtgtac 60

cgcatgcgca agaagcagat cgacgtggcc atcaaggtgc tgaagcaggg cacggagaag 120

gcagacacgg aagagatgat gcgcgaggcg cagatcatgc accagctgga caacccctac 180

atcgtgcggc tcattggcgt ctgccaggcc gaggccctca tgctggtcat ggagatggct 240

gggggcgggc cgctgcacaa gttcctggtc ggcaagaggg aggagatccc tgtgagcaat 300

gtggccgagc tgctgcacca ggtgtccatg gggatgaagt acctggagga gaagaacttt 360

gtgcaccgtg acctggcggc ccgcaacgtc ctgctggtta accggcacta cgccaagatc 420

agcgactttg gcctctccaa agcactgggt gccgacgaca gctactacac tgcccgctca 480

gcagggaagt ggccgctcaa gtggtacgca cccgaatgca tcaacttccg caagttctcc 540

agccgcagcg atgtctggag ctatggggtc accatgtggg aggccttgtc ctacggccag 600

aagccctaca agaagatgaa agggccggag gtcatggcct tcatcgagca gggcaagcgg 660

atggagtgcc caccagagtg tccacccgaa ctgtacgcac tcatgagtga ctgctggatc 720

tacaagtggg aggatcgccc cgacttcctg accgtggagc agcgcatgcg agcctgttac 780

tacagcctg 789

<210> 52

<211> 261

<212> PRT

<213> Artifical

<400> 52

Thr Leu Glu Asp Lys Glu Leu Gly Ser Gly Asn Phe Gly Thr Val Lys

1 5 10 15

Lys Gly Tyr Tyr Gln Met Lys Lys Val Val Lys Thr Val Ala Val Lys

20 25 30

Ile Leu Lys Asn Glu Ala Asn Asp Pro Ala Leu Lys Asp Glu Leu Leu

35 40 45

Ala Glu Ala Asn Val Met Gln Gln Leu Asp Asn Pro Tyr Ile Val Arg

50 55 60

Met Ile Gly Ile Cys Glu Ala Glu Ser Trp Met Leu Val Met Glu Met

65 70 75 80

Ala Glu Leu Gly Pro Leu Asn Lys Tyr Leu Gln Gln Asn Arg His Val

85 90 95

Lys Asp Lys Asn Ile Ile Glu Leu Val His Gln Val Ser Met Gly Met

100 105 110

Lys Tyr Leu Glu Glu Ser Asn Phe Val His Arg Asp Leu Ala Ala Arg

115 120 125

Asn Val Leu Leu Val Thr Gln His Tyr Ala Lys Ile Ser Asp Phe Gly

130 135 140

Leu Ser Lys Ala Leu Arg Ala Asp Glu Asn Tyr Tyr Lys Ala Gln Thr

145 150 155 160

His Gly Lys Trp Pro Val Lys Trp Tyr Ala Pro Glu Cys Ile Asn Tyr

165 170 175

Tyr Lys Phe Ser Ser Lys Ser Asp Val Trp Ser Phe Gly Val Leu Met

180 185 190

Trp Glu Ala Phe Ser Tyr Gly Gln Lys Pro Tyr Arg Gly Met Lys Gly

195 200 205

Ser Glu Val Thr Ala Met Leu Glu Lys Gly Glu Arg Met Gly Cys Pro

210 215 220

Ala Gly Cys Pro Arg Glu Met Tyr Asp Leu Met Asn Leu Cys Trp Thr

225 230 235 240

Tyr Asp Val Glu Asn Arg Pro Gly Phe Ala Ala Val Glu Leu Arg Leu

245 250 255

Arg Asn Tyr Tyr Tyr

260

<210> 53

<211> 783

<212> DNA

<213> Artifical

<400> 53

acgctggaag acaaagaact gggctctggt aattttggaa ctgtgaaaaa gggctactac 60

caaatgaaaa aagttgtgaa aaccgtggct gtgaaaatac tgaaaaacga ggccaatgac 120

cccgctctta aagatgagtt attagcagaa gcaaatgtca tgcagcagct ggacaacccg 180

tacatcgtgc ggatgatcgg gatatgcgag gccgagtcct ggatgctggt tatggagatg 240

gcagaacttg gtcccctcaa taagtatttg cagcagaaca gacatgtcaa ggataagaac 300

atcatagaac tggttcatca ggtttccatg ggcatgaagt acttggagga gagcaatttt 360

gtgcacagag atctggctgc aagaaatgtg ttgctagtta cccaacatta cgccaagatc 420

agtgatttcg gactttccaa agcactgcgt gctgatgaaa actactacaa ggcccagacc 480

catggaaagt ggcctgtcaa gtggtacgct ccggaatgca tcaactacta caagttctcc 540

agcaaaagcg atgtctggag ctttggagtg ttgatgtggg aagcattctc ctatgggcag 600

aagccatatc gagggatgaa aggaagtgaa gtcaccgcta tgttagagaa aggagagcgg 660

atggggtgcc ctgcagggtg tccaagagag atgtacgatc tcatgaatct gtgctggaca 720

tacgatgtgg aaaacaggcc cggattcgca gcagtggaac tgcggctgcg caattactac 780

tat 783

<210> 54

<211> 29

<212> PRT

<213> Artifical

<400> 54

Cys Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg Thr Gly Gln

1 5 10 15

Pro Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser

20 25

<210> 55

<211> 87

<212> DNA

<213> Artifical

<400> 55

tgctcccggg ccgcacgagg gacaatagga gccaggcgca ccggccagcc cctgaaggag 60

gacccctcag ccgtgcctgt gttctct 87

<210> 56

<211> 97

<212> PRT

<213> Artifical

<400> 56

Cys Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg Thr Gly Gln

1 5 10 15

Pro Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser Val Asp Tyr

20 25 30

Gly Glu Leu Asp Phe Gln Trp Arg Glu Lys Thr Pro Glu Pro Pro Val

35 40 45

Pro Cys Val Pro Glu Gln Thr Glu Tyr Ala Thr Ile Val Phe Pro Ser

50 55 60

Gly Met Gly Thr Ser Ser Pro Ala Arg Arg Gly Ser Ala Asp Gly Pro

65 70 75 80

Arg Ser Ala Gln Pro Leu Arg Pro Glu Asp Gly His Cys Ser Trp Pro

85 90 95

Leu

<210> 57

<211> 291

<212> DNA

<213> Artifical

<400> 57

tgctcccggg ccgcacgagg gacaatagga gccaggcgca ccggccagcc cctgaaggag 60

gacccctcag ccgtgcctgt gttctctgtg gactatgggg agctggattt ccagtggcga 120

gagaagaccc cggagccccc cgtgccctgt gtccctgagc agacggagta tgccaccatt 180

gtctttccta gcggaatggg cacctcatcc cccgcccgca ggggctcagc tgacggccct 240

cggagtgccc agccactgag gcctgaggat ggacactgct cttggcccct c 291

<210> 58

<211> 12

<212> PRT

<213> Artifical

<400> 58

Gly Gly Ser Gly Gly Thr Gly Gly Ser Gly Gly Thr

1 5 10

<210> 59

<211> 36

<212> DNA

<213> Artifical

<400> 59

ggcgggtctg gcgggacagg aggttcaggt ggcaca 36

<210> 60

<211> 34

<212> PRT

<213> Artifical

<400> 60

Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr

1 5 10 15

Lys Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser

20 25 30

Thr Lys

<210> 61

<211> 102

<212> DNA

<213> Artifical

<400> 61

ggttcaactt ctggctctgg gaaaccagga agcggcgaag ggtccaccaa gggaagcacc 60

agtggttcag gtaagcctgg ttctggtgaa ggtagcacta aa 102

<210> 62

<211> 128

<212> PRT

<213> Artifical

<400> 62

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

1 5 10 15

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

20 25 30

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

35 40 45

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

50 55 60

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

65 70 75 80

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

85 90 95

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

100 105 110

Ser Ala Gly Gly Gly Gly Ser Gly Gly Thr Gly Gly Ser Gly Gly Thr

115 120 125

<210> 63

<211> 384

<212> DNA

<213> Artifical

<400> 63

agcgcaggcg gatcagctgg agggtctgca gggggtagtg caggtggctc agctggcggg 60

agcggctcag ctgggggatc tgctggtggc agtacctcag caggcggtag cgccggaggt 120

tctgctggtg gctccgcagg agggtctgca ggcggttccg ggagtgcagg tggatctgca 180

ggtgggtcaa caagtgctgg tggatccgca ggaggttcag caggcgggag tgctggaggc 240

tctgcaggcg gtagcgggag tgccggtggc agcgcagggg gaagcactag tgctggaggc 300

agtgcaggtg gcagcgcagg aggctctgcc gggggaagcg ccgggggcgg cgggtctggc 360

gggacaggag gttcaggtgg caca 384

<210> 64

<211> 116

<212> PRT

<213> Artifical

<400> 64

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

1 5 10 15

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

20 25 30

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

35 40 45

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

50 55 60

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

65 70 75 80

Ser Ala Gly Gly Ser Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Thr

85 90 95

Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly Ser Ala Gly Gly

100 105 110

Ser Ala Gly Gly

115

<210> 65

<211> 348

<212> DNA

<213> Artifical

<400> 65

agcgcaggcg gatcagctgg agggtctgca gggggtagtg caggtggctc agctggcggg 60

agcggctcag ctgggggatc tgctggtggc agtacctcag caggcggtag cgccggaggt 120

tctgctggtg gctccgcagg agggtctgca ggcggttccg ggagtgcagg tggatctgca 180

ggtgggtcaa caagtgctgg tggatccgca ggaggttcag caggcgggag tgctggaggc 240

tctgcaggcg gtagcgggag tgccggtggc agcgcagggg gaagcactag tgctggaggc 300

agtgcaggtg gcagcgcagg aggctctgcc gggggaagcg ccgggggc 348

<210> 66

<211> 6

<212> PRT

<213> Artifical

<400> 66

Gly Gly Ser Gly Gly Thr

1 5

<210> 67

<211> 23

<212> DNA

<213> artificial

<400> 67

cgacagtacc attgagttgt gcg 23

<210> 68

<211> 23

<212> DNA

<213> artificial

<400> 68

ttcgtccata ggagacaatg ccc 23

<210> 69

<211> 22

<212> DNA

<213> artificial

<400> 69

actcacaggc agccaacttt gc 22

<210> 70

<211> 22

<212> DNA

<213> artificial

<400> 70

ctcttgaagt cagggtgcag cg 22

<210> 71

<211> 22

<212> DNA

<213> artificial

<400> 71

ctcttctgcc tgctgcactt tg 22

<210> 72

<211> 22

<212> DNA

<213> artificial

<400> 72

atgggctaca ggcttgtcac tc 22

<210> 73

<211> 23

<212> DNA

<213> artificial

<400> 73

gagtgtggag accatcaagg aag 23

<210> 74

<211> 24

<212> DNA

<213> artificial

<400> 74

tgctttgcgt tggacattca agtc 24

<210> 75

<211> 22

<212> DNA

<213> artificial

<400> 75

catcacctgg aggacttcta cc 22

<210> 76

<211> 23

<212> DNA

<213> artificial

<400> 76

cagtgtactg gatgctcttc agg 23

<210> 77

<211> 22

<212> DNA

<213> artificial

<400> 77

ggtatgagag ccaggcttct tg 22

<210> 78

<211> 22

<212> DNA

<213> artificial

<400> 78

gaatggagcc atcttcccac tg 22

<210> 79

<211> 22

<212> DNA

<213> artificial

<400> 79

cagcaacttg ctggatctgg tg 22

<210> 80

<211> 22

<212> DNA

<213> artificial

<400> 80

agacggcagt agaaggtcac ct 22

Claims

1. A chimeric antigen receptor engineered NK cell, wherein said chimeric antigen receptor comprises: an extracellular target molecule binding domain, a transmembrane region domain, and an intracellular signaling domain;

2. The chimeric antigen receptor-engineered NK cell of claim 1, wherein the chimeric antigen receptor further comprises: an extracellular spacer domain;

the extracellular spacer domain is located between the extracellular target molecule binding domain and the transmembrane region domain;

preferably, the chimeric antigen receptor further comprises: an intracellular spacer domain;

the intracellular spacer domain is located between and connects the transmembrane region and the intracellular signaling domain;

preferably, the chimeric antigen receptor further comprises: an intracellular hinge domain;

the intracellular hinge domain connects the intracellular detection signal domain and the intracellular activation signal domain together.

3. The chimeric antigen receptor-engineered NK cell of claim 1, wherein the extracellular target molecule-binding domain-bound target molecule comprises at least one of the following group of molecules: immunosuppressive signal-associated molecules, tumor surface antigen molecular markers, cell surface specific antigen peptide-histocompatibility complex molecules;

preferably, the extracellular target molecule binding domain comprises at least one of the target molecule binding domains of a molecule selected from the group consisting of: PD-1, PD-1 truncations, PD-1 protein mutants, antibodies to PD-L1 and PD-L1 binding fragments;

preferably, the extracellular target molecule binding domain comprises at least one of an amino acid sequence comprising SEQ ID NO 1, an amino acid sequence comprising SEQ ID NO 3, an amino acid sequence comprising SEQ ID NO 5, an amino acid sequence comprising SEQ ID NO 7, an amino acid sequence comprising SEQ ID NO 9, an amino acid sequence comprising SEQ ID NO 11;

preferably, the nucleic acid fragment of the extracellular target molecule binding domain comprises at least one of a nucleic acid sequence comprising SEQ ID NO 2, a nucleic acid sequence comprising SEQ ID NO 4, a nucleic acid sequence comprising SEQ ID NO 6, a nucleic acid sequence comprising SEQ ID NO 8, a nucleic acid sequence comprising SEQ ID NO 10;

preferably, activation of the intracellular activation signalling domain is dependent on at least binding of the extracellular target molecule binding domain to the target molecule; the intracellular activation signaling domain comprises a molecule or fragment having a catalytic functional group;

preferably, the intracellular activation signaling domain comprises at least one of a tyrosine kinase or a tyrosine kinase fragment;

the tyrosine kinase fragment comprises at least one of a receptor type tyrosine kinase fragment and a non-receptor type tyrosine kinase fragment;

preferably, the tyrosine kinase is at least one selected from the group consisting of Ack, CSK, CTK, FAK, Abl, Arg, Tnk1, Pyk2, Fer, Fes, LTK, ALK, STYK1, JAK1, JAK2, JAK3, Tyk2, DDR1, DDR2, ROS, Blk, Fgr, FRK, Fyn, TIE1, TIE2, Hck, Lck, Srm, Yes, Syk, ZAP70, Etk, Btk, HER2, HER3, HER4, instr, ITK, TEC, TXK, EGFR, IGF1R, IRR, PDGFR α, VEGFR-1, VEGFR-2, VEGFR-3, PDGFR β, Kit, CSFR, FLT, R, FGFR R, prktr R, epsk R, eppr6854, epsk R, epprksb, epsk R, eppr6854, epsk R, epsk R, epsk R, epsk R, epsk R, epsk;

preferably, the intracellular activation signaling domain comprises at least one of an amino acid sequence comprising SEQ ID NO 42, an amino acid sequence comprising SEQ ID NO 44, an amino acid sequence comprising SEQ ID NO 46, an amino acid sequence comprising SEQ ID NO 48, an amino acid sequence comprising SEQ ID NO 50, an amino acid sequence comprising SEQ ID NO 52;

preferably, the nucleic acid fragment of the intracellular activation signaling domain comprises at least one of the nucleic acid sequence comprising SEQ ID NO 43, the nucleic acid sequence comprising SEQ ID NO 45, the nucleic acid sequence comprising SEQ ID NO 47, the nucleic acid sequence comprising SEQ ID NO 49, the nucleic acid sequence comprising SEQ ID NO 51, the nucleic acid sequence comprising SEQ ID NO 53;

preferably, the intracellular detection signaling domain comprises at least one immunoreceptor tyrosine-based activation motif;

preferably, the intracellular detection signalling domain comprises at least one of the signalling domains of a molecule selected from the group consisting of: CD3 delta, CD3 gamma, CD3 epsilon, CD3 zeta, CD3, CD229, CEACAM-19, CEACAM-20, SIRPa, SLAM, CLEC-1, CLEC-2, CRACCC, CTLA-4, 2B 3, CD244, BTLA, DCAR, DCIR, Dectin-1, CEACAM-1, CD300 3, CEACAM-1, CEACAM-3, CEACAM-4, Fc epsilon RI alpha, Fc epsilon beta, Fc gamma RIB, Fc gamma RIRI, Fc gamma RIIA, Fc gamma RIIB, DAP gamma RIIC, Fc gamma RIDAP, 3, K3, G6 3, KIR2DL3, KILILIDL 3, KIR2DL3, KIDL 3, KIR2, KIDL 3, KIRL 2, KIRL 3, CTRL 2, KLDL 6852, KLDL 3, CD 6852 3, CD 6852 3, CD 3-3, CECLC 3-3, CETRLCR 3-3, CEC-3-C-3-S, CETRLR-3, 3-3, K-3-6853-3, K-3-K-3, K-3-C-3-S, K-3-K-S, KILRR 3-K-S, K-S, K-3-K-D, K-D, CTLRR 3-D, K-D, K-3-D, K-3-D, K-D, CTR 3-D, CTLRR 3-3, 3-3, K-3-D, K-3-K-D, CTR 3-K-3-D, K-3-D, K-D, K-3-S, K-3-S, CTR 3, K-S, 3-S, K-3-D, K-S, K-3-S, CTR 3-K-3-K-3, CTR 3-3, CTR 3-S, CTR 3-3, Siglec-8, PDCD6, PILR-alpha, Siglec-9, Siglec-10, Siglec-11, Siglec-12, Siglec-14, Siglec-15, Siglec-16;

preferably, the intracellular detection signaling domain comprises at least one of an amino acid sequence comprising SEQ ID NO 20, an amino acid sequence comprising SEQ ID NO 22, an amino acid sequence comprising SEQ ID NO 24, an amino acid sequence comprising SEQ ID NO 26, an amino acid sequence comprising SEQ ID NO 28, an amino acid sequence comprising SEQ ID NO 30, an amino acid sequence comprising SEQ ID NO 32, an amino acid sequence comprising SEQ ID NO 34, an amino acid sequence comprising SEQ ID NO 36, an amino acid sequence comprising SEQ ID NO 38, an amino acid sequence comprising SEQ ID NO 40;

preferably, the nucleic acid fragment of the intracellular detection signaling domain comprises at least one of the nucleic acid sequence comprising SEQ ID NO 21, the nucleic acid sequence comprising SEQ ID NO 23, the nucleic acid sequence comprising SEQ ID NO 25, the nucleic acid sequence comprising SEQ ID NO 27, the nucleic acid sequence comprising SEQ ID NO 29, the nucleic acid sequence comprising SEQ ID NO 31, the nucleic acid sequence comprising SEQ ID NO 33, the nucleic acid sequence comprising SEQ ID NO 35, the nucleic acid sequence comprising SEQ ID NO 37, the nucleic acid sequence comprising SEQ ID NO 39, the nucleic acid sequence comprising SEQ ID NO 41;

preferably, the transmembrane domain is selected from the group consisting of transmembrane domains of transmembrane proteins comprising 4-1BB, 4-1BBL, ICOS, GITR, GITRL, VSIG-3, DD190347I-4

VISTA, SIRP alpha, OX40, CD, PD-1, PD-L, CD, B-DC, B-H, Siglec-1, Siglec-2, Siglec-3, Siglec-4, LILRB, 2B, BTLA, CD160, LAG-3, Siglec-5, Siglec-6, Siglec-7, Siglec-8, CD226, TIM-1, TIM-3, Siglec-4, Siglec-9, Siglec-10, Siglec-11, Siglec-12, Siglec-14, Siglec-15, TIM-16, LIR, KIR2DL, KIR 5, LR-14, KIR-DS, KIR-5, KIR-Rdl-5, KIR2 Rdl, KIR3, KIR2 Rdl, KIDS, KIR3, KIR2 Rdl, TARG-3, TARG-4, TAg-4, TAg-4, TAg-4, TAg-4, TAg-4, TAg-4, TAg, TA, NKG2D, LILRA5, LILRB1, LILRB2, LILRB3, LILRB4, CTLA-4, CD155, CD112, CD113, TIGIT, Galectin-9, CEACAM-1, CD8a, CD8B, CD4, merk, AXL, Tyro3, BAI1, MRC1, fcyr 1, fcyr 2A, fcyr 2B1, fcyr 2B2, fcyr 3A, fcyr 3B, fcyr 2, fcyr 1, FcRn, fcoc/μ R, or fcar 1;

preferably, the transmembrane region comprises at least one of an amino acid sequence comprising SEQ ID NO 12, an amino acid sequence comprising SEQ ID NO 14;

preferably, the nucleic acid fragment of the transmembrane region comprises at least one of the nucleic acid sequence comprising SEQ ID NO 13, the nucleic acid sequence comprising SEQ ID NO 15.

4. The chimeric antigen receptor-engineered NK cell according to claim 2, characterized in that the extracellular spacer domain comprises at least one of an amino acid sequence comprising SEQ ID NO. 16, an amino acid sequence comprising SEQ ID NO. 18;

preferably, the nucleic acid fragment of the extracellular spacer domain comprises at least one of the nucleic acid sequence comprising SEQ ID NO 17, the nucleic acid sequence comprising SEQ ID NO 19;

preferably, said intracellular spacer domain is an extension of the transmembrane domain and comprises at least one molecule selected from the group consisting of: PD-1, PD-L, CD8, CD, ICOS, GITR, GITRL, OX40, B-DC, B-H, CD40, CD, B-H, VSIG-3, VISTA, SIRP α, KIR2DS, Siglec-1, Siglec-2, Siglec-3, Siglec-4, CD155, CD112, CD113, TIGIT, CD226, Siglec-5, Siglec-6, Siglec-7, Siglec-8, Siglec-9, LRlec-10, LILRB, LILRDL, LIB, Sigdl-11, Siglec-12, LRlec-12, DAP-5, DAP-KIR-2, DAP-3, KIR-3, DAP-2, DAP-3, DADL-4, DADL-D-2, DADL-5, DADL-2, DADL-6, DADL-DL-6, DADL-2, DADL-3, DADL-DL-2, DADL-3, DADL-D, DADL-2, DADL-3, DADL-4, DADL-2, DADL-3, DADL-4, DADL-6, DADL-4, DADL-2, DADL-4, DADL-1, DADL-2, DADL-4, DADL-1, DADL-6, DADL-1, DADL-2, DADL-4, DADL-1, DADL-4, DADL-2, DADL-4, DADL-1, DADL-2, DADL-4, DADL-1, DADL-2, DADL-D, DADL-1, DADL-2, and DADL-1, DADL-2, DADL-1, DADL-2, DADL-1, DADL-2, DADL-1, DADL-D, DADL-2, DADL-1, DADL-2, DADL-D, DADL-4, DADL-1, DADL-2, and DADL-1, DA, TIM-3, TIM-4, KLRG1, KLRG2, LAIR1, LAIR2, LILRA3, LILRA4, LILRA5, 2B4, BTLA, CD160, LAG-3, CTLA-4, Galectin-9, CEACAM-1, merk, AXL, Tyro3, BAI1, 4-1BB, 4-1BBL, MRC1, fcyr 1, fcyr 2A, fcyr 2B1, fcyr 2B2, fcyr 3A, fcyr 3B, fcyr 2, fcyr 1, FcRn, fcoc/μ R, or fcar R1;

preferably, the intracellular spacer domain comprises at least one of an amino acid sequence comprising SEQ ID NO 54, an amino acid sequence comprising SEQ ID NO 56;

preferably, the intracellular spacer domain nucleic acid fragment comprises at least one of a nucleic acid sequence comprising SEQ ID NO:55, a nucleic acid sequence comprising SEQ ID NO: 57;

preferably, the intracellular hinge domain comprises at least one of an amino acid sequence comprising SEQ ID NO 58, an amino acid sequence comprising SEQ ID NO 60, an amino acid sequence comprising SEQ ID NO 62, an amino acid sequence comprising SEQ ID NO 64, an amino acid sequence comprising SEQ ID NO 66;

preferably, the intracellular hinge domain fragment comprises at least one of a nucleic acid sequence comprising SEQ ID NO 59, a nucleic acid sequence comprising SEQ ID NO 61, a nucleic acid sequence comprising SEQ ID NO 63, a nucleic acid sequence comprising SEQ ID NO 65.

5. The chimeric antigen receptor-engineered NK cell of claim 1, wherein the NK cell comprises at least one of an endogenous NK cell subpopulation and/or an exogenous NK cell;

preferably, said endogenous NK cell subpopulation comprises adaptive NK cells, memory NK cells, CD56 ^dim NK cells, CD56 ^bright At least one of NK cells;

the exogenous NK cells comprise at least one of an NK cell strain, embryonic stem cells, or induced pluripotent stem cell-derived NK cells;

preferably, the NK cell line is at least one selected from the group consisting of NK-92 cell line, haNK cell line, IMC-1 cell line, NK-YS cell line, KHYG-1 cell line, NKL cell line, NKG cell line, SNK-6 cell line, YTS cell line and HANK-1 cell line.

6. The method for producing a chimeric antigen receptor-modified NK cell according to any one of claims 1 to 5, characterized in that the production method comprises the steps of:

1) respectively obtaining human NK cells and chimeric antigen receptors;

7. A pharmaceutical composition comprising at least one of the chimeric antigen receptor-modified NK cell according to any one of claims 1 to 5 or the chimeric antigen receptor-modified NK cell prepared by the preparation method of claim 6.

8. The composition of claim 7, wherein the pharmaceutical composition further comprises a monoclonal antibody;

the monoclonal antibody is selected from at least one of cetuximab, alemtuzumab, ipilimumab and ofatumumab;

preferably, the pharmaceutical composition further comprises a cytokine;

the cytokine is at least one selected from gamma interferon and interleukin.

9. Use of at least one of the chimeric antigen receptor-modified NK cell of any one of claims 1 to 5, or the chimeric antigen receptor-modified NK cell prepared by the preparation method of claim 6, or the pharmaceutical composition of any one of claims 7 to 8, for the preparation of a medicament for the treatment of:

10. The use of claim 9, wherein the tumor is a tumor positive for PD-L1 or that upregulates the expression level of PD-L1 in response to gamma interferon;

preferably, the tumor comprises a solid tumor and/or a hematologic cancer;

preferably, the solid tumor comprises at least one of breast cancer, skin cancer, liver cancer, ovarian cancer, prostate cancer, brain cancer, kidney cancer, lung cancer.