CN114807000A

CN114807000A - Application of sodium selenite in reducing helicobacter pylori virulence factor

Info

Publication number: CN114807000A
Application number: CN202210633132.2A
Authority: CN
Inventors: 黄衍强; 黄赞松; 覃春; 廖丽娟; 黄干荣
Original assignee: Youjiang Medical University for Nationalities
Current assignee: Youjiang Medical University for Nationalities
Priority date: 2022-06-06
Filing date: 2022-06-06
Publication date: 2022-07-29
Anticipated expiration: 2042-06-06
Also published as: CN114807000B

Abstract

Application of sodium selenite in reducing helicobacter pylori virulence factor comprises inducing helicobacter pylori with brain heart infusion culture medium containing sodium selenite at concentration of 4-16 μmol/L, wherein the concentration of initial bacterial liquid is 1 × 10 ⁵ CFU/mL, inducing for 2-3 days for 1 cycle; repeating the induction after replacing the new culture medium for 4-5 weeks to reduce the expression of the virulence factor CagA of the helicobacter pylori. The helicobacter pylori prepared by the invention has obviously weakened strain virulence factors CagA and VacA, obviously reduced expression of IL-6, IL-8 and TNF-alpha inflammatory factors of infected GES-1 cells and obviously reduced cell adhesion capabilityObviously weakens, and obviously lightens the damage of the infection to the gastric mucosa of the mouse in vivo.

Description

Application of sodium selenite in reducing helicobacter pylori virulence factor

Technical Field

The invention belongs to the field of medicines, and particularly relates to application of sodium selenite in reduction of helicobacter pylori virulence factors.

Background

Helicobacter pylori (Hp) has high infection rate, can be continuously planted on the gastric mucosa of human, and can cause various gastrointestinal diseases. Helicobacter pylori has been classified as a first class of bio-carcinogenic factor by the international center for cancer research (IARC) of the world health organization in 1994; it was first identified as a human carcinogen in the united states at 1 month 2022. At present, the eradication treatment of Hp is recommended at home and abroad, and the eradication method is a new quadruple therapy, namely 'an acid inhibitor, a bismuth agent and two antibiotics'. The method has the highest effective rate of about 95 percent for patients who receive antibiotic treatment for the first time, the successful eradication rate of drug-resistant patients is obviously reduced, in recent years, the drug-resistant rate is increased year by year, and the world health organization has published that the development of novel antibiotics for clarithromycin-resistant helicobacter pylori is urgently needed in 2017. The development of new antibiotics is one of the effective methods for improving the eradication rate, but antibiotics and drug resistance are inevitable contradictions, and it is unrealistic for humans to completely eradicate or eliminate helicobacter pylori. Therefore, by taking the research and development experience of BCG vaccine as a reference, the method for attenuating helicobacter pylori is explored, so that the attenuated helicobacter pylori becomes a 'live vaccine' which can coexist in vivo for a long time without causing diseases, and the method is an effective method for preventing and treating the helicobacter pylori.

The invention of BCG provides the experience that some characteristics of strains are lost by continuous passage, but how to find a proper subculture method to quickly weaken the virulence has different characteristic requirements on different microorganisms. Hp has two major virulence determinants, vacuolar toxin A (VacA) and cytotoxicity-related protein A (CagA), and high-virulence Hp strains, both VacA and CagA, are positive. Shorea and seguine show that selenium is closely related to Hp, and selenium can inhibit the growth of Hp, change the form and structure of Hp, inhibit the growth of engineering bacteria and reduce the expression level of recombinant VacA, but does not describe that selenium can reduce the expression level of CagA. CagA is currently the only well-defined Hp carcinogen that can be incorporated into host cells. Shore and Tummuru consider: CagA and VacA are two independent proteins which are related, and Cac A can not directly mediate Vac A activity but can play a role in processing and transportation (Shore A and research on the correlation between selenium and helicobacter pylori, Jilin university, 2004), can influence the secretion of Vac A, and is a more important and more critical pathogenic factor. Therefore, the key point of preparing attenuated live vaccines is to inhibit key pathogenic factors and control the source of pathogenic substance synthesis.

The sodium selenite is used for preparing a selenium-rich culture medium, high-toxicity Hp is induced in a selenium-rich environment, the fact that the expression of energy genes such as CagE is reduced firstly 4 days after the induction is started is found, and the expression quantity of key virulence genes such as VacA and CagA is reduced successively after 9 days and 12 days; in addition, after induction of sodium selenite, the adhesion capacity of the Hp strain to cells is reduced, the colonization amount of gastric mucosa of a C57BL/6J mouse is increased, and the inflammatory reaction is obviously relieved, so that the cell and animal level proves that the Hp toxicity can be effectively reduced by the method.

The invention relates to a method for preparing a selenium-rich culture medium and inducing Hp to reduce CagA attenuation, which is not reported; the attenuation method is rapid, stable, effective and economical, can be used for preventing and treating helicobacter pylori infection related diseases, and the application of the attenuation method is disclosed for the first time.

Disclosure of Invention

The technical problem to be solved is as follows: in order to effectively reduce the toxicity of helicobacter pylori and reduce the incidence rate of infection, the invention provides the application of sodium selenite in reducing the virulence factor of the helicobacter pylori, the application can effectively reduce the toxicity of the helicobacter pylori and obviously reduce the inflammatory reaction.

The technical scheme is as follows: application of sodium selenite in preparing product for reducing helicobacter pylori virulence factor CagA expression.

The concentration of sodium selenite is 4-16 μmol/L.

The concentration of the sodium selenite is 4 mu mol/L.

Application of sodium selenite in reducing expression of helicobacter pylori virulence factor CagA.

The application steps are as follows: inducing helicobacter pylori with brain heart infusion culture medium containing sodium selenite at concentration of 4-16 μmol/L, wherein the concentration of the initial bacteria liquid is 1 × 10 ⁵ CFU/mL, inducing for 2-3 days for 1 cycle; will be renewedAfter repeated induction of the culture medium for 4-5 weeks, the expression of the virulence factor CagA of the helicobacter pylori can be reduced.

The attenuated CagA strain is prepared by the application.

The CagA attenuated strain is applied to preparing the anti-helicobacter pylori vaccine.

Has the advantages that: firstly, the present invention successfully prepares attenuated helicobacter pylori; secondly, the attenuated helicobacter pylori CagA, VacA and other virulence gene expressions prepared by the invention are obviously attenuated, the inflammatory response in cells and mice is obviously reduced, the pathological damage in animal bodies can be reduced, and the incidence rate of helicobacter pylori infection is reduced.

Drawings

FIG. 1 shows the cytotoxic effect of sodium selenite;

FIG. 2 is a growth curve of Hp G27 and NSH 57;

FIG. 3 shows detection of virulence genes of Hp strains after induction with sodium selenite;

FIG. 4 shows the inflammatory effect of Hp strain on cells following sodium selenite induction;

FIG. 5 shows the adhesion of Hp strains to cells following sodium selenite induction;

FIG. 6 shows the colonization of mouse gastric mucosa by Hp strain induced by sodium selenite;

FIG. 7 shows the inflammatory effects of Hp strain on mice following sodium selenite induction;

FIG. 8 shows the effect of sodium selenite-induced Hp strain on the gastric mucosa of mice.

Detailed Description

Example 1

1. Materials and methods

1.1 Experimental strains, cells and experimental animals

GES-1 cell line (cat # CC4026) was purchased from Guangzhou Kusai Biotechnology GmbH, and human gastric cancer cell line (BGC823) cell line was purchased from Nanjing Kaojian Biotechnology GmbH; hp159 strain, Hp26695 strain, Hp G27 strain, and NSH57 strain were given from BihongKai laboratory, university of medical, Nanjing, and C57BL/6J mice were purchased from Changsha Tianjiu Biotechnology Co., Ltd.

1.2 Experimental reagent and consumables

Sodium selenite (Sodium selenate) (Sigma, Cat.: S526-10G), incomplete RPMI-1640 medium (without double antibody) (Jiangsu Kai-based Biotech GmbH, Cat.: KGM31800N-500), incomplete DMEM (high-sugar) medium (without double antibody) (Jiangsu Kai-based Biotechnology GmbH, Cat.: KGM12800N-500), fetal bovine serum (Biotech (Shanghai) GmbH, Cat.: E600001-0500), dimethyl sulfoxide (DMSO), brain heart infusion medium (OxOID, Cat.: CM1135), Columbia basal medium (OxOID, Cat.: CM0331), standard calf serum (Pingyi Biotech), FastPase/Tissue Total RNA Isolation Kilate V2 (Netzian Biotech, Cat.: Tokyo, Cat.: 112-01), third generation DNA Biotech) (DND Biotech), the goods number is: MR05101M), MonAmp SYBR Green qPCR Mix (monatin biotechnology limited, cat #: MQ10301S), 0.1mL flat-covered eight-row tube (with cover) white tube (screening, cat No.: PST-0108-FT-W). CCK8 kit (Shanghai Bin Yun Tian Kun, Inc., cat # C0038), and Alma blue kit (Solebao Biotechnology Co., Ltd., cat # A7631).

1.3 helicobacter pylori virulence gene primers

Primers CagA (F: ACCCCTAGTCGGTAATG, R: GCTTTAGCTTCTGATACTGC), 16sRNA (F: CTGGAGAGACTAAGCCCTCC, R: AGGATCAAGGTTTAAGGATT) were purchased from Shanghai Weitiji Yongji, Inc., VacAs1a (F: GTCAGCATCACACCGCAAC, R: CTGCTTGAATGCGCCAAAC) was purchased from Shanghai Jie-Jie bioengineering, Inc., TNF-alpha (F: TCTTCTCGAACCCCGAGTGA, R: CCTCTGATGGCACCACCAG), IL-6 (F: GCAGAAAAAGGCAAAGAATC, R: CTACATTTGCCGAAGAGC), IL-8 (F: CACCGGAAGGAACCATCTCA, R: TGGCAAAACTGCACCTTCACA), GAPDH (F: GGACCTGACCTGCCGTCTAG, R: GTAGCCCAGGATGCCCTTGA) were purchased from Wuhan King Kerui bioengineering, Inc.

1.4 Experimental instrumentation

A biological safety cabinet (model: AC2-6S8-CN), a three-gas incubator (model: Huaxi YCP-100S), a high-precision numerical control shaking table (model: MF-05D), a carbon dioxide incubator (model: BB150), a fine balance (ten thousand) (model: PX224ZH/E), an ultra-low temperature refrigerator (model: Haier DW-86L388A), a refrigerator (model: Haier BCD-601 PR), an electric heating constant temperature water tank (limit: DK-8D), an ultraviolet visible spectrophotometer (model: UH5300), a high-speed refrigerated centrifuge fixed angle rotation (model: Thermo 75003602), a desk type low-speed automatic balancing centrifuge (model: SC-04), a binocular inverted microscope (model: AE2000), a multifunctional enzyme linked immunosorbent assay (model: Synergy H1), an ultrasonic cell crusher (model: VOSHIN92-II), a multi-sample tissue grinder (model: tissue-FEII), PCR instrument (model: Light Cycler 96, Roche Ltd., USA), micro-spectrophotometer (model: TGEM Plus), electrothermal blowing dry box (model: DGT-G135S), pure water system (model: UPH-II-20 TN).

2. Method and results

2.1 cell and bacterial culture

The cells were cultured in RPMI 1640 incomplete medium containing 10% fetal bovine serum or DMEM (high-sugar) incomplete medium at 37 deg.C and 5% CO ₂ The carbon dioxide incubator of (1) is used for culturing. Bacteria are cultured in Columbia solid culture medium or brain heart infusion solution containing 10% standard calf serum at 37 deg.C and 10% CO respectively ₂ 、5％O ₂ The three-gas incubator is used for cultivation in a shaking table.

2.2 microdilution assay for minimum inhibitory concentration of sodium selenite on Hp (MIC90)

(1) Preparing a medicament: weighing a certain mass of sodium selenite, and preparing the sodium selenite into a 4mg/mL sodium selenite solution by using sterilized UP water for later use.

(2) Preparing bacteria: selecting appropriate amount of thallus from solid plate with Hp26695, Hp G27, Hp159 and NSH57 growth, culturing in liquid culture medium for 2-3 days until Hp growth logarithmic phase, and detecting OD value of Hp bacterial liquid with ultraviolet-visible spectrophotometer (OD600 is 0.3, Hp concentration is 1x 10) ⁸ CFU/mL), and diluting the bacterial liquid to 1x10 according to the detection value ⁷ CFU/mL, spare.

(3) Preparing a drug sensitive 96-well plate: taking bacteria 96-well plate, using A-D4 rows as Hp four strains and drug action holes, respectively, using E1-6 rows as Hp26695, HpG27, Hp159, NSH57, sodium selenite positive hole and culture mediumNutrient blank control wells; pipetting 90. mu.L of liquid medium into the wells, adding 12.8. mu.L of 4mg/mL sodium selenite solution into the 1 st well and the sodium selenite positive control well of the A-D rows, and supplementing the volume of the medium to 180. mu.L (excluding the drug positive control wells); respectively carrying out double dilution from the 1 st hole of the A-D row to the 12 th hole of the A-D row by using a loading and discharging gun, wherein each hole after the dilution is finished retains 90 mu L of liquid, and the drug concentration of the 1-12 holes is respectively 256 mu g/mL, 128 mu g/mL, 64 mu g/mL, 32 mu g/mL, 16 mu g/mL, 8 mu g/mL, 4 mu g/mL, 2 mu g/mL, 1 mu g/mL, 0.5 mu g/mL, 0.25 mu g/mL and 0.125 mu g/mL; adding the prepared Hp bacterial liquid into the corresponding bacterial drug action hole and the positive control hole respectively according to the volume of 10 mu L, and not processing the blank control hole; standing at 37 deg.C and 10% CO ₂ 、5％O ₂ The cells were cultured for 72 hours in a shaker.

(4) And (5) judging a result: and (3) judging results on the premise that the Hp positive control holes grow in a germ-free manner, the sodium selenite positive holes and the culture medium blank control holes grow in a germ-free manner, and repeating the results for 3 times by taking the hole with the lowest drug bacteriostatic concentration as a result.

(5) As a result: the sodium selenite has similar bacteriostatic action on different Hp strains, the minimum bacteriostatic concentration is 0.185 mu mol/mL, and the results are shown in Table 1.

Table 1 bacteriostatic effects of sodium selenite on different h

2.3 CCK8 method for detecting sodium selenite cytotoxicity

(1) 96-well plate cell plating: GES-1 and BGC823 cells in logarithmic growth phase are taken, trypsinized, centrifuged, resuspended and mixed uniformly, a small amount of cells are mixed with trypan blue, 10 mu L of the cells are taken to a cell counting plate to be counted under a microscope, 2 times of counting is carried out, the average value is calculated, and the formula is used for calculating the cell concentration (per mL) ═ average value multiplied by 10 ⁴ X dilution multiple "calculation, dilution to 1X10 ⁵ Spreading 100 μ L/mL of the suspension in a 96-well cell plate, designing a culture medium blank control well and a cell blank control well, shaking the wells at all times to uniformly spread the cells, and placing CO ₂ Culturing in an incubator for 18-24 h.

(2) Intervention of sodium selenite: adding corresponding sodium selenite solution 10 μ L to make final acting concentration of sodium selenite be 1 μmol/L, 2 μmol/L, 4 μmol/L, 5 μmol/L, 8 μmol/L, respectively, adding PBS solution 10 μ L into negative control wells, and culturing for 24 h.

(3) CCK8 detection: adding a CCK8 reagent according to a CCK8 kit specification method, incubating for 4h, detecting by using a multifunctional microplate reader at a wavelength of 460nm, and calculating according to a formula of cell survival rate (drug-action cell hole-culture medium blank control hole)/(cell blank control hole-culture medium blank control hole), wherein each type of hole is provided with 3 multiple holes.

(4) As a result: the toxic effect of sodium selenite on GES-1 and BGC823 cells is different, less than 5. mu. mol/L of sodium selenite is less toxic to cells, and 8. mu. mol/L of sodium selenite has already produced obvious toxicity to GES-1. The results are shown in FIG. 1.

2.4 ultraviolet-visible Spectrophotometer detection of Hp growth Curve

(1) Taking Hp G27 and NSH57 bacterial liquids in logarithmic phase, detecting the bacterial concentration by an ultraviolet-visible spectrophotometer in the same calculation mode of 2.2, and preparing the bacterial concentrations into 10 ⁵ And (3) placing 10mL of CFU/mL bacterial liquid into a three-gas shaking table for culture, detecting the OD value of the bacterial liquid every 8h, and recording until the OD is in a descending trend, and stopping detection.

(2) As a result: initial concentration of 10 ⁵ CFU/mL Hp G27 and NSH57 are cultured for 0h-24h as growth slow phase, 24h-56h as growth logarithmic phase, 56h-64h as growth stationary phase and 64h-80h as death phase. The results are shown in FIG. 2.

2.5 Induction of Hp by sodium selenite and detection of CagA and VacA virulence genes

(1) In combination with the cytotoxicity and drug sensitivity results on Hp, Hp G27 and NSH57 strains were used for induction experiments, and the concentrations of 0. mu. mol/L, 4. mu. mol/L, 8. mu. mol/L and 16. mu. mol/L sodium selenite were selected as the induction concentrations of Hp. Taking Hp in logarithmic phase of growth, and setting the Hp concentration as 10 ⁵ CFU/mL was used as the initial concentration for induction, and the culture was induced in the above liquid medium containing sodium selenite at various concentrations. The duration of the induction 1 cycle was determined by culturing to log phase at initial Hp concentration for 2-3 days. Continuously inducing for 6 cycles, respectivelyAnd detecting the relative expression quantity of CagA and VacA virulence genes in each period.

(2) As a result: the relative expression of Hp CagA and VacA genes induced by sodium selenite is reduced in a fluctuation way, the CagA and VacA gene expression is reduced when the Hp CagA and VacA genes are induced to 5 and 6 periods, and the reduction degree of virulence factors between 4 mu mol/L, 8 mu mol/L and 16 mu mol/L sodium selenite concentrations is not obviously regular. The results are shown in FIG. 3.

2.6 cell adhesion assay to detect changes in Hp adhesion induced

2.6.1 cell adhesion experiment-fluorescent microscope Observation method

(1) Cell plating: BGC823 cells in log phase of growth were taken at 5 × 10 ⁴ Putting each cell into a 24-well plate, supplementing complete culture medium to about 1.5mL, gently shaking front and back and left and right to enable the cells to be tiled, and culturing for 18-24h until the cells are attached to the wall.

(2) And (3) carrying out fluorescence staining on bacteria: taking Hp G27 in logarithmic growth phase, and adjusting the concentration of the bacterial liquid to 1x10 ⁸ After CFU/mL, SYTO9 reagent was used as V _{Bacterial liquid} /V _SYTO9 Incubating at a ratio of 1000/1.5 for 15min, H.pyrori staining, and diluting the bacterial solution by 10 times to obtain 1 × 10 ⁷ CFU/mL, spare.

(3) Cells infected with fluorescent Hp: and (3) putting 500 mu L of the standby bacterial liquid into a sterile EP tube, centrifuging at 12000rpm for 2min, carefully absorbing and removing the supernatant after the centrifugation is finished, keeping H.pyrori precipitate, uniformly mixing the precipitate with a corresponding cell culture medium, infecting cells, slightly shaking a cell culture plate with an MOI (mean of 100: 1), placing the cell culture plate in a cell culture box for 3h, observing the condition of Hp adhered cells under a fluorescence inverted microscope, and photographing and storing. Wherein the Hp +4 μmol/L sodium selenite group is prepared by adding sodium selenite into the culture medium to make the concentration be 4 μmol/L during infection,

2.6.2 cell adhesion experiment-Alma blue assay

And (2) carrying out 96-picture-hole 3-plate cell plating on GES-1 cells in a logarithmic growth phase, carrying out 2.3, culturing for 18-24h, carrying out cell adherence, infecting the cells by logarithmic Hp and induced Hp, keeping the MOI (average molecular weight) of 300:1 in a cell culture box for 1h, then sucking out the culture solution, adding 100 mu L of Hp liquid culture medium, slowly washing for 1 time, completely sucking out the culture solution, adding 50 mu L of 0.4% saponin solution, carrying out lysis for 5min, sucking out, adding 100 mu L of Hp culture medium, then adding 10 mu L of Amara blue, placing in the Hp culture box for 4-6h, then detecting by using a multifunctional microplate reader, and reading.

2.6.3 results: the adhesion of the Hp strain to cells after 6-week induction with 4. mu. mol/L sodium selenite was reduced compared to the Hp strain without induction, and the results are shown in FIG. 4.

2.7 real-time fluorescent quantitative PCR (qPCR) for detecting the expression level of mRNA of inflammatory factor of Hp-infected cells

(1) Cell plating and Hp infection: taking GES-1 cells in logarithmic growth phase at 3X 10 ⁵ Cells/well were plated in 6-well cell plates in the same manner as 2.3, in 5 groups: and after culturing the GES-1 group, the GES-1+ Hp group, the GES-1+ induced Hp group, the GES-1+ Hp + Se group and the GES-1+ Se group for 18-24h, infecting the Hp infected group for 24h by using MOI (100: 1).

(2) Total RNA extraction and reverse transcription: the method for extracting Total RNA of cells by using a FastPure Cell/Tissue Total RNA Isolation Kit V2 Kit is indicated, the concentration and the purity of the extracted Total RNA are detected by a micro spectrophotometer, and the RNA quality is better when the ratio 260/280 and the ratio 260/230 are respectively about 1.8-2.1 and about 2.0. Reverse transcription of RNA was performed using the three-generation reverse transcription premix (containing dsDNase) protocol.

(3) qPCR experiments and calculations: configuring a qPCR system by using a MonAmp SYBR Green qPCR Mix reagent, detecting 3 complex holes of each gene, detecting on a PCR instrument by using a three-step method (pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 10s, annealing at 60 ℃ for 10s, extension at 72 ℃ for 30s, and annealing by using an instrument default acquisition program), wherein a dissolving curve corresponding to an obtained amplification curve is in a single peak, the gene amplification is successful, and the obtained result is obtained according to a formula 2 ^{-△CT(test)-△CT(calibrator)} The expression amount ratio is calculated.

(4) As a result: the relative expression quantity of Hp-infected cell inflammatory factors IL-6, IL-8 and TNF-alpha genes after the induction of 4 mu mol/L sodium selenite for 6 weeks is reduced compared with that of the genes without inducing Hp, so that the inflammation causing capability is reduced, and the result is shown in figure 5.

2.8 construction of mouse gastritis model to detect the virulence of Hp in animal bodies before and after induction

2.8.1 construction of mouse gastritis model

(1) Grouping: the experiments were carried out by dividing 30C 57BL/6J mice into 5 groups, 6 mice each of PBS group, Hp G27 group, Hp G27 group after induction, Hp G27+ Se group and Se group.

(2) Preparing bacterial liquid: culturing NSH57 strain and NSH57 strain induced by 4 μmol/L sodium selenite for 6 cycles in liquid to logarithmic phase, detecting OD value, centrifuging each bacterial liquid at 12000rmp for 2min, discarding supernatant, retaining complete precipitate, adding fresh or culture medium containing 4 μmol/L sodium selenite, and resuspending to obtain bacterial liquid with concentration of 3 × 10 ⁸ CFU/mL, spare.

(3) And (3) gastric lavage: mice are fasted for 12h before gavage, and are subjected to the NSH57 group, the induced NSH57 group and the NSH57+ Se group which are subjected to the gavage by using the corresponding bacterial liquid, wherein each mouse is subjected to the gavage by 0.5mL, 1 time every other day, the gavage is continuously carried out for 5 times, and the diet is recovered for 4h after the gavage; the PBS group and Se group mice were gazed with the same volume of PBS and 4. mu. mol/L sodium selenite solution in the same manner.

2.8.2 grinding dilution plate-coating method for detecting intragastric Hp colonization condition of gastritis mice

(1) Preparation before dissection: a predetermined amount of Columbia medium was weighed, and a solid plate containing bacitracin at a concentration of 100. mu.g/mL and selective antibiotic at a concentration of 25. mu.g/mL was prepared for use. Sterilizing 1.5mL of EP tube and magnetic beads, subpackaging 17 particles/tube of magnetic beads into the EP tube, accounting for 1/4-1/3 of the tube volume, adding 1mL of Hp liquid culture medium, weighing and recording on a fine balance, and preparing for later experiments.

(2) Dissection and sample processing: after completion of 5 times of gavage, the mice were further raised for 3 weeks and dissected. The method comprises the steps of 'eyeball blood collection → cervical vertebra dislocation and sacrifice → 75% ethanol disinfection of a whole mouse → abdominal dissection for taking stomach, liver, spleen and kidney tissues', taking the tissues in an ultra-clean workbench by aseptic operation, wherein the liver, spleen and right kidney tissues are placed in 10% formalin for fixing and preparing pathological sections, the whole stomach tissues are divided into two parts along the large and small curves of the stomach, the stomach contents are slightly scraped off, one part is placed in 10% formalin for fixing and preparing pathological sections, the other part is placed in the prepared EP tube with magnetic beads, weighing and recording are carried out again, a multi-sample tissue grinding instrument is used for crushing, 50 Hz is set for 3 min/time and 9min for 3 min/time, the stomach tissues are uniformly ground, grinding liquid is diluted by 10 times, 100 times and 1000 times, 100 mu L of each dilution liquid is respectively taken and coated on the prepared flat plate, and after the flat plate is cultured in a three-gas culture box for 3 to 4 days, the number of Hp colonies was counted.

(3) Counting and calculating: the Hp bacterial colony has the characteristics of colorless transparency or grey white translucency, smooth surface and full appearance, the Hp bacterial colony is counted according to the characteristics, the concentration of the original stomach grinding fluid Hp is calculated, and finally the number of Hp (CFU/g) contained in each g of stomach tissue is calculated according to the weight of the stomach tissue, namely the planting amount of Hp in the stomach.

(4) As a result: the colonization amount of the mouse gastric mucosa infected by Hp induced by 4 mu mol/L sodium selenite is more than that of the mouse gastric mucosa not induced by Hp, which indicates that the clearance rate of the Hp in the mouse body after induction is reduced. The results are shown in FIG. 6.

2.8.3 detection of gastric mucosal and serological inflammation in mouse gastritis model

(1) The gastric mucosa histopathology of PBS group, Hp group and induced Hp group of the mice for producing the gastritis model is subjected to immunofluorescence detection for IL-1 beta, IL-6 and TNF-alpha inflammatory factor expression, and serum is subjected to inflammatory factor content detection.

(2) As a result: the inflammation effect of the mice infected by Hp induced by 4 mu mol/L sodium selenite is weaker than that of the mice not induced by Hp, which indicates that the induced Hp has lower toxicity. The results are shown in FIG. 7.

2.8.3HE staining method for detecting gastric mucosal injury of gastritis mice

(1) And (3) carrying out paraffin embedding and slicing on the fixed tissues, staining the slices according to the HE conventional staining procedure, observing under a microscope, and judging the gastric mucositis condition according to the inflammatory cell infiltration degree.

(2) As a result: the pathological changes of gastric mucosa caused by Hp infection of mice induced by 4. mu. mol/L sodium selenite were lighter than those caused by non-induced Hp, and the results are shown in FIG. 8.

Sequence listing

<110> Youjiang national medical college

Application of <120> sodium selenite in reducing helicobacter pylori virulence factor

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acccctagtc ggtaatg 17

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gctttagctt ctgatactgc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctggagagac taagccctcc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aggatcaagg tttaaggatt 20

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtcagcatca caccgcaac 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ctgcttgaat gcgccaaac 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcttctcgaa ccccgagtga 20

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cctctgatgg caccaccag 19

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcagaaaaag gcaaagaatc 20

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctacatttgc cgaagagc 18

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

caccggaagg aaccatctca 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tggcaaaact gcaccttcac a 21

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ggacctgacc tgccgtctag 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gtagcccagg atgcccttga 20

Claims

1. Application of sodium selenite in preparing product for reducing helicobacter pylori virulence factor CagA expression.

2. The use according to claim 1, wherein the concentration of sodium selenite is 4 μmol/L to 16 μmol/L.

3. The use according to claim 2, wherein the concentration of sodium selenite is 4 μmol/L.

4. Application of sodium selenite in reducing expression of helicobacter pylori virulence factor CagA.

5. The use according to claim 4, characterized by the steps of: inducing helicobacter pylori with brain heart infusion culture medium containing sodium selenite at concentration of 4-16 μmol/L, wherein the concentration of the initial bacteria liquid is 1 × 10 ⁵ CFU/mL, inducing for 2-3 days for 1 cycle; repeating the induction after replacing the new culture medium for 4-5 weeks to reduce the expression of the virulence factor CagA of the helicobacter pylori.

6. An attenuated strain of CagA produced by the use of claim 4 or 5.

7. Use of the attenuated CagA strain according to claim 6 for the preparation of a vaccine against helicobacter pylori.