CN114806909B

CN114806909B - Strain for producing beta-carotene and application thereof

Info

Publication number: CN114806909B
Application number: CN202111633494.3A
Authority: CN
Inventors: 刘龙; 石训; 陈坚; 孙晓瑞; 吕雪芹; 段小果; 堵国成; 李江华; 刘延峰; 王青霞; 王璇; 裴彤彤; 刘家恒
Original assignee: Haoxiangni Health Food Co ltd; Jiangnan University
Current assignee: Haoxiangni Health Food Co ltd; Jiangnan University
Priority date: 2021-12-28
Filing date: 2021-12-28
Publication date: 2023-08-08
Anticipated expiration: 2041-12-28
Also published as: CN114806909A

Abstract

The invention relates to a strain for producing beta-carotene, which expresses a beta-carotene synthesis gene, overexpresses a mevalonate pathway related gene and knocks out an acetyl coenzyme A metabolism related gene, thereby constructing a beta-carrot synthesis pathway in the strain, strengthening an endogenous Mevalonate (MVA) pathway synthesized by Saccharomyces cerevisiae vitamin A and improving the yield of beta-carotene. The strain of the invention realizes the synthesis of beta-carotene from the head and has good performance in shake flask fermentation.

Description

Strain for producing beta-carotene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a strain for producing beta-carotene and application thereof.

Background

Beta-carotene has various different cis-trans spatial configurations. The cis-isomer has anticancer and antiaging biological characteristics, and the higher the content is, the stronger the efficacy, and the all-trans configuration is caused by the lack of various mechanisms like biosynthesis to form isomers during the chemical synthesis of beta-carotene. Therefore, the natural beta-carotene has higher nutrition and health care value and safety, and the beta-carotene extracted from plants is limited by the raw materials of the products, climate and transportation conditions, and has high cost and lower yield. Therefore, in order to meet the increasing demands of the market on BC and solve the pressure of industrial production on the environment, the cross subjects of the synthesis biology, the metabolic engineering, the fermentation engineering and the like are utilized to provide a new idea for the environment-friendly and efficient synthesis of BC. Wang Rui et al (design and construction of high-yield beta-carotene Saccharomyces cerevisiae strains) construct a beta-carotene producing strain library by integrating beta-carotene synthesis genes (crtE, crtI, crtYB) derived from Phaffia rhodozyma at the Delta site, knock out the endogenous genes ypl062w of the strain, and overexpress tHMG1 and BTS1-ERG20 fusion proteins at the site to increase precursor supply, thereby finally improving the yield of beta-carotene by 1.65 times and reaching 162.1mg/L; zhang Qi (construction of high-yield carotenoid Pichia pastoris expression host bacteria) by constructing pPICZ alpha A-idi-crtE-crtYB-crtI and pPICZ alpha A-idi-crtE-crtYB-crtI-crtS-crt recombinant vectors and transforming the vectors into GS115 strains, respectively screening to obtain recombinant bacteria GS115-CARO capable of efficiently synthesizing beta-carotene in cells (the beta-carotene yield is 28mg/g cell dry weight after 72h of culture) and an astaxanthin-producing strain; chinese patent CN103865817a provides a method for constructing recombinant bacteria producing β -carotene, which co-converts crtE, crtI and crtbb derived from rhodotorula, a promoter upstream of the above-mentioned gene derived from saccharomyces cerevisiae, and a terminator downstream of the above-mentioned gene derived from saccharomyces cerevisiae into saccharomyces cerevisiae, with a yield of 6mg/gDCW.

The main bottleneck faced in the production of carotenoids by Saccharomyces cerevisiae is the natural synthesis route of prenyl pyrophosphates, the precursor of isoprenoids, which limits the increase in beta-carotene production. For the above reasons, the present inventors have actively studied and innovated to construct a strain for efficiently producing β -carotene by a biosynthesis method, so that it has more industrial utility value, and theoretical and practical references are provided for the biosynthesis carotenoid industry.

Disclosure of Invention

In order to solve the technical problems, the invention provides a strain for producing beta-carotene, which takes Saccharomyces cerevisiae CEN.PK102 as an original strain, constructs a beta-carrot synthesis path, and overexpresses a Mevalonate (MVA) path of synthesizing a precursor isoprene pyrophosphoric acid by using Saccharomyces cerevisiae endogenous vitamin A so as to improve the yield of the beta-carotene.

The first object of the present invention is to provide a beta-carotene-producing strain that expresses a beta-carotene synthesis gene, overexpresses a mevalonate pathway-related gene, and knocks out an acetyl-CoA metabolism-related gene;

the beta-carotene synthesis genes are a gene crtE encoding geranylgeranyl diphosphate synthase, a gene crtB encoding phytoene synthase, a gene crtI encoding phytoene desaturase and a gene crtYB encoding lycopene cyclase;

mevalonate pathway-related genes are gene tHMG1 encoding 3-hydroxy-3-methylglutaryl-CoA reductase, gene IDI encoding isopentenyl pyrophosphate isomerase, and gene ERG20 encoding farnesyl pyrophosphate synthase;

the acetyl-CoA metabolism-related gene is the gene MLS1 encoding malate synthase.

Further, the above strain producing beta-carotene also down-regulates the expression of a squalene synthesis pathway-related gene, which is the gene ERG9 encoding squalene synthase.

Further, the above-mentioned strain producing β -carotene also overexpresses endoplasmic reticulum size regulatory factor-related gene INO2, gene OLE1 encoding fatty acid desaturase.

Further, the above-mentioned beta-carotene producing strain also overexpresses the gene crtE encoding geranylgeranyl diphosphate synthase, the gene crtI encoding phytoene desaturase and the gene crtYB encoding lycopene cyclase, and specifically, the crtE, crtI and crtYB are expressed in multiple copies.

As mentioned above, the main bottlenecks faced in the production of carotenoids using Saccharomyces cerevisiae are the natural synthesis of prenyl pyrophosphate, a precursor of isoprenoids, that is, mevalonate (MVA) pathway, which is strictly regulated by metabolism, the low expression level of rate-limiting enzymes associated with the synthesis of exogenous carotenoids, and the limited storage capacity of Saccharomyces cerevisiae itself for lipid substances. The invention is characterized in that:

(1) Exogenous genes geranylgeranyl diphosphate synthase (GGPP synthase, crtE), phytoene synthase (crtB), phytoene desaturase (crtI) and lycopene cyclase (crtYB) are introduced, a beta-carrot synthesis pathway is constructed in yeast cells, and shake flask fermentation yield reaches 74.05mg/L;

(2) The supply of precursor substances for synthesizing terpenes is effectively enhanced, the synthesis path and heterologous path flux of endogenous precursor substances are balanced, key genes tHMG1, IDI and ERG20 of the endogenous MVA path of saccharomyces cerevisiae are up-regulated, and the metabolic flux from IPP and DMAPP of five-carbon precursors to GGPP is improved; knocking out MLS1 gene, and reducing consumption of acetyl coenzyme A by knocking out key genes participating in acetyl coenzyme A in glyoxylate circulation, thereby increasing synthesis of substrate acetyl coenzyme A in MVA pathway, and achieving 530.67mg/L of shake flask fermentation yield;

(3) Strengthening endoplasmic reticulum size regulating factor related gene INO2 and fatty acid desaturase OLE1, and accumulating lipophilic product beta-carotene in saccharomyces cerevisiae to the greatest extent; downregulating ERG9, weakening endogenous FPP competition pathway, reducing diversion of precursor substances by squalene synthesis pathway, and achieving 900.77mg/L of shake flask fermentation yield;

(4) The synthesis and accumulation of the target product beta-carotene are improved by the multi-copy exogenous carotenoid synthesis pathway speed-limiting enzyme crtE, crtI, crtYB, and the shake flask fermentation yield reaches 1535.35mg/L.

Further, the strain for producing beta-carotene takes Saccharomyces cerevisiae CEN.PK102 as a host and PY26-Cre as an expression vector. The saccharomyces cerevisiae CEN.PK102 can adapt to different environmental conditions, has lower cost and higher growth speed, and can reduce the production time on an industrial scale; yeast is a single-cell organism, fermentation is easy to control, thallus is nontoxic, and the yeast is often used as a production strain of various chemicals and functional nutrition.

Further, the gene crtE encoding geranylgeranyl diphosphate synthase is derived from Taxus media, the gene crtB encoding phytoene synthase is derived from Pantoea agglomerans, the gene crtI encoding phytoene desaturase is derived from Blakeslea trispora, and the gene crtYB encoding lycopene cyclase is derived from Phaffia rhodozyma.

Further, the nucleotide sequence of the gene crtE encoding geranylgeranyl diphosphate synthase is shown in SEQ ID NO. 1.

Further, the nucleotide sequence of the gene crtB encoding phytoene synthase is shown in SEQ ID NO. 2.

Further, the nucleotide sequence of the gene crtI encoding phytoene desaturase is shown in SEQ ID NO. 3.

Further, the nucleotide sequence of the gene crtYB encoding lycopene cyclase is shown as SEQ ID NO. 4.

Further, the nucleotide sequence of gene tHMG1 encoding 3-hydroxy-3-methylglutaryl-CoA reductase is shown in SEQ ID NO. 5.

Further, the nucleotide sequence of the gene IDI encoding isopentenyl pyrophosphate isomerase is shown in SEQ ID NO. 6.

Further, the nucleotide sequence of the gene ERG20 for encoding farnesyl pyrophosphate synthase is shown in SEQ ID NO. 7.

Further, the nucleotide sequence of the gene MLS1 encoding malate synthase is shown in SEQ ID NO. 8.

Further, the nucleotide sequence of the gene ERG9 encoding squalene synthase is shown as SEQ ID NO. 9.

Further, the nucleotide sequence of the gene INO2 related to the endoplasmic reticulum size regulating factor is shown as SEQ ID NO. 10.

Further, the nucleotide sequence of the gene OLE1 encoding the fatty acid desaturase is shown in SEQ ID NO. 11.

A second object of the present invention is to provide a method for constructing the above strain producing β -carotene, comprising the steps of:

constructing fusion genes of crtE and crtI, fusion genes of crtB and crtYB, fusion genes of tHMG1 and IDI and fusion genes of tHMG1 and ERG20 and fusion genes of INO2 and OLE1, expressing crtE, crtI and crtYB in multiple copies, inserting the fusion genes and the multiple copies into PY26-Cre vector, transforming into Saccharomyces cerevisiae CEN.PK102 with the functions of knockdown ERG9 and knockdown MLS1, and constructing the strain for producing beta-carotene.

The construction method of the strain specifically comprises the following steps:

s1, constructing a beta-carrot synthesis path in the strain:

construction of fusion Gene 106a-U-T _ADH1 -crtE-P _GAL10 -crtI-T _AOXI -106a-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid delta 106a-T _ADH1 -crtE-P _GAL10 -crtI-T _AOXI ；

Construction of fusion Gene 805a-U-P _GAL7 -crtB-T _AOX1 -P _GAL1 -crtYB-T _CYC1 -805a-D, inserted into a PY26-Cre expression vector to obtain a recombinant plasmid Δ805a-P _GAL7 -crtB-T _AOX1 -P _GAL1 - crtYB-T _CYC1 ；

The recombinant plasmid delta 106a-T was subjected to the above-described procedures _ADH1 -crtE-P _GAL10 -crtI-T _AOXI And recombinant plasmid Δ805a-P _GAL7 -crtB-T _AOX1 -P _GAL1 -crtYB-T _CYC1 Transforming into a host;

s2, overexpressing a Mevalonate (MVA) pathway of a vitamin A synthesis precursor isoprene pyrophosphoric acid and knocking out an acetyl coenzyme A metabolism related gene:

construction of fusion Gene MLS1-U-P _GPD -tHMG1-T _ADH1 -P _TEF1 -IDI-T _AOX1 -MLS1-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid DeltaMLS 1-P _GPD -tHMG1-T _ADH1 - P _TEF1 -IDI-T _AOX1 ；

Construction of fusion Gene 1622b-U-P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 -1622b-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid delta 1622b-P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 ；

The recombinant plasmid DeltaMLS 1-P was subjected to the above-described procedure _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 And recombinant plasmid Δ1622b-P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 Transferring into a host to obtain the strain for producing the beta-carotene.

Further, the above construction method further includes at least one step of:

(1) Construction of fusion Gene 208a-U-P _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 -208a-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid delta 208a-P _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 Transferring into a host;

(2) Construction of fusion Gene ERG9-U-Phxt ₁ -ERG9-T _AOX1 Inserting ERG9-D into PY26-Cre expression vector to obtain recombinant plasmid delta ERG9-U-Phxt ₁ -ERG9-T _AOX1 Transferring into a host;

(3) Construction of fusionGene 416d-U-T _ADH1 -crtE-P _GAL10 -crtI-T _cyc1 -416D-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid 416D-U-T _ADH1 -crtE-P _GAL10 -crtI-T _cyc1 - 416d-D；

Construction of fusion Gene 720a-U-P _GAL7 -crtYB-T _AOX1 -720a-D, inserted into PY26-Cre expression vector to obtain recombinant plasmid 720a-U-P _GAL7 -crtYB-T _AOX1 -720a-D；

Recombinant plasmid 416d-U-T _ADH1 -crtE-P _GAL10 -crtI-T _cyc1 -416D-D and recombinant plasmid 720a-U-P _GAL7 -crtYB-T _AOX1 -720a-D into the host.

A third object of the present invention is to provide a process for producing beta-carotene by fermentation using the strain described above.

Further, acetyl-CoA is used as a substrate.

Further, the fermentation condition is 30-35 ℃,200-220rpm, the inoculation amount is 1-5%, and the fermentation time is 12-120h.

The strain for producing the beta-carotene provided by the invention has great potential in the fields of biology, pharmacy, food or chemical industry, such as being used for preparing the beta-carotene or products containing the beta-carotene, preparing target proteins and the like.

By means of the scheme, the invention has at least the following advantages:

the invention takes Saccharomyces cerevisiae CEN.PK102 as an original strain, and the yield is improved by 6.17 times by constructing and strengthening an exogenous MVA path, and reaches 530.67mg/L; the storage capacity of saccharomyces cerevisiae on lipid substances is improved, the endogenous FPP competition path is weakened, the diversion of squalene synthesis path on precursor substances is reduced, the yield is improved by 0.7 times, and 900.77mg/L is reached; through over-expressing exogenous carotenoid key genes, the yield is improved by 0.7 times, and 1535.35mg/L is achieved. Solves the problems of precursor deficiency and low expression level of the related speed-limiting enzyme of the exogenous carotenoid synthesis pathway caused by strict metabolic regulation of the precursor isopentenyl pyrophosphate in the synthesis of the beta-carrot.

The foregoing description is only an overview of the present invention, and is presented in terms of preferred embodiments of the present invention and the following detailed description of the invention in conjunction with the accompanying drawings.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings.

FIG. 1 is a schematic diagram of the production route of beta-carotene;

FIG. 2 is a graph showing the variation of beta-carotene production by different recombinant bacteria in shake flask fermentation.

Detailed Description

The present invention will be further described with reference to the accompanying drawings and specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the invention and practice it.

The materials and methods involved in the following examples are as follows:

(1) Culture medium:

the seed culture medium comprises the following components: 10g/L yeast extract, 20g/L peptone and 20g/L glucose.

The components of the fermentation medium include: 25g/L glucose, 25g/L glycerol, 50g/L soybean peptone, 0.6g/L dipotassium hydrogen phosphate and 25g/L sucrose, and dodecane is required to be added into a fermentation medium, wherein the ratio of the fermentation medium to the dodecane is 1:1.

SDTrp plates: YNB culture medium 6.7g/L, glucose 20g/L, L-leucine 50mg/L, L-histidine 50mg/L, uracil 50mg/L, agar powder 20g/L.

SDLeu plates: YNB culture medium 6.7g/L, glucose 20g/L, L-tryptophan 50mg/L, L-histidine 50mg/L, uracil 50mg/L, agar powder 20g/L.

SDTrpLeu plate: YNB culture medium 6.7g/L, glucose 20g/L, L-histidine 50mg/L, uracil 50mg/L, agar powder 20g/L.

YPD solid plates: 1% of yeast powder, 2% of peptone, 2% of glucose and 1.5% of agar powder.

(2) Beta-carotene extractant: extraction of the intracellular product was performed using ethyl acetate and extraction of the extracellular product was performed using dodecane.

(3) And (3) fermentation liquid treatment: centrifuging the Saccharomyces cerevisiae liquid fermented for 96h under 12000r/min for 10min, sucking supernatant dodecane, and packaging in a liquid phase bottle for measuring extracellular products; and (3) collecting thalli after centrifugation, washing twice with sterilized ultrapure water with the same volume as the fermentation broth, sucking 600uL of the water-washed resuspension bacteria liquid and 600uL of ethyl acetate, adding the mixture into a crushing pipe, crushing yeast cells by using a wall breaking machine, performing vortex oscillation extraction for 15min, wherein an intracellular product is basically dissolved in the ethyl acetate, centrifuging for 10min at 12000r/min, sucking the supernatant, and filling the supernatant into a liquid phase bottle for measuring the intracellular product.

(4) HPLC detection of β -carrot yield: using a Agilent ZORBAX EclipseXDB-C18 separation column (5 μm, 250X 4.6 mm), the temperature was measured at 40℃and acetonitrile was used as the mobile phase: methanol: isopropanol=5: 3:2, the flow rate is 1mL/min, the detection wavelength is 450nm, and the sample injection amount is 10 mu L.

(5) Strain growth detection: the absorbance OD600 of the fermentation broth was measured periodically using an ultraviolet-visible spectrophotometer.

EXAMPLE 1 construction of recombinant bacterium C1

Based on the preference of Saccharomyces cerevisiae expression, the artificially synthesized gene fragments geranylgeranyl diphosphate synthase (GGPP synthase, crtE), phytoene synthase (crtB), phytoene desaturase (crtI), lycopene cyclase (crtYB) and beta-carotene 15,15' -monooxygenase (BCMO), wherein CrtE derived from Taxus media (Taxus x media), crtB derived from Pantoea agglomerans (Pantoea agglomerans), crtI derived from Blakeslea trispora (Blakeslea trispora) and crtYB derived from Phaffia rhodozyma (Xanthophyllomyces Dendrorhous) have higher expression levels in Saccharomyces cerevisiae, and are more favorable for the synthesis of beta-carotene.

The specific construction process is as follows:

(1) Artificial synthetic gene fragment T _ADH1 -crtE-P _GAL10 -crtI—T _AOXI The Saccharomyces cerevisiae BY4741 genome is used as a template, the primers 106a-U-F and 106a-U-R are used for amplification to obtain genes 106a-U, the primers 106a-D-F and 106a-D-R are used for amplification to obtain genes 106a-D, the pMHyLp-Trp plasmid is used as a template, and the primer loxT-1F, loxT-1R is used for amplification to obtain a loxT-1 gene fragment.

(2) The three gene fragments T obtained in step (1) are subjected to _ADH1 -crtE-P _GAL10 -crtI--T _AOXI Overlapping extension PCR is carried out on 106a-U and 106a-D, the PCR condition is 98 ℃,5min is pre-denatured, then 98 ℃, 10s is denatured, 55 ℃, 5s is annealed, 7 ℃ is extended for 2min, 30 cycles are taken in total, 1% agarose gel electrophoresis is carried out to verify correctness, and then the fragment is cut and recovered, thus obtaining the fusion gene fragment 106a-U-T _ADH1 -crtE-P _GAL10 -crtI--T _AOXI -106a-D gene fragment.

(3) Preparing Saccharomyces cerevisiae engineering bacteria competence and constructing a fusion gene fragment 106a-U-T _ADH1 -crtE-P _GAL10 -crtI--T _AOXI The transformation of 106a-D into the competence of Saccharomyces cerevisiae CEN.PK102 strain, plating on SDTrp plate, culturing at 30deg.C for 2-3 days, and colony PCR verification using primer V-EI-1F, V-EI-1R.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDTrp, YPD solid plates, and only the single colony grown on YPD medium was the correct Saccharomyces cerevisiae strain Δ106a-T _ADH1 -crtE-P _GAL10 - crtI--T _AOXI The recombinant strain is named as Saccharomyces cerevisiae recombinant strain C1.

Primer sequence:

106a-U-F:aagagggtctgtccagcgaata

106a-U-R:cccggatcgtcggttgtgccttcgagcgtcccaaacct

106a-D-F:cactggccgtcgttttacaatggtcaaacttcagaactaaaaaaataataaggaagaaaaa

106a-D-R:tccaagtgatttcctttccttcccat

loxT-1F:aggtatagcatgaggtcgctccaggaaacagctatgaccatgattacgc

loxT-1R:gcactggccgtcgttttacaacttcagaactaaaaaaataataaggaagaaaaa

V-EI-1F:cagagcatgtagtatgggac

V-EI-1R:caagaagtacggtgctgaat

EXAMPLE 2 construction of recombinant bacterium C2

The specific construction process is as follows:

(1) Artificial synthesis of Gene fragment P _GAL7 -crtB-T _AOX1 -P _GAL1 -crtYB-T _CYC1 . The Saccharomyces cerevisiae BY4741 genome is used as a template, the primers 805a-U-F and 805a-U-R are used for amplification to obtain genes 805a-U, the primers 805a-D-F and 805a-D-R are used for amplification to obtain genes 805a-D, the pMHyLp-His plasmid is used as a template, and the primer loxH-1F, loxH-1R is used for amplification to obtain a loxH-1 gene fragment.

(2) The three gene fragments P obtained in step (1) are subjected to _GAL7 -crtB-T _AOX1 -P _GAL1 - crtYB-T _CYC1 Overlapping extension PCR is carried out on the two parts of 805a-U and 805a-D, the PCR condition is that the temperature is 98 ℃, the pre-denaturation is carried out for 5min, then the temperature is 98 ℃, the denaturation is 10s, the temperature is 55 ℃, the annealing is 5s, the annealing is 7 ℃ and the extension is carried out for 2min, 30 cycles are total, after 1% agarose gel electrophoresis verifies that the two parts are correct, the gel is cut, and the fragment is recovered, thus obtaining the fusion gene fragment 805a-U-P _GAL7 -crtB-T _AOX1 -P _GAL1 -crtYB-T _CYC1 -805a-D gene fragment.

(3) Preparing Saccharomyces cerevisiae engineering bacteria competence and constructing a fusion gene segment 805a-U-P _GAL7 -crtB-T _AOX1 -P _GAL1 -crtYB-T _CYC1 -805a-D conversion into Saccharomyces cerevisiae C1 of example 1; in the competence of the strain, the strain is coated on an SDHis plate and cultured for 2-3 days at 30 ℃, and colony PCR verification is carried out by using a primer V-BYB-1F, V-BYB-1R to obtain the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. The single colonies are grown on SDUra, SDHis, YPD solid platesSpot plate verification was performed and only single colonies grown on YPD medium were the correct saccharomyces cerevisiae strain Δ805a-P _GAL7 -crtB-T _AOX1 -P _GAL1 - crtYB-T _CYC1 Named Saccharomyces cerevisiae recombinant C2.

Primer sequence:

805a-U-F:acgtccagccactggact

805a-U-R:atcttaagggtgaagacaaatatgtgaggtccttttggaaagctatacttcgga

805aD-F:aggctttaatttgcggcctggatataatcactaaataaagtagattttccttgggt

805a-D-R:ttagttttgctggggtggtaattaaattcaag

loxH-1F:aggctttaatttgcggcccaggaaacagctatgaccatgattacgc

loxH-1R:ggcactggccgtcgttttattagttttgctggggtg

V-BYB-1F:ggtgaagacagcttctttttccactat

V-BYB-1R:aagacaatctacttctactccta

EXAMPLE 3 construction of recombinant bacterium C3

The specific construction process is as follows:

(1) Artificial synthesis of Gene fragment P _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 The Saccharomyces cerevisiae BY4741 genome is used as a template, a primer MLS1-U-F, MLS1-U-R is adopted for amplification to obtain a gene fragment MLS1-U, a primer MLS1-D-F, MLS-D-R is adopted for amplification to obtain a gene fragment MLS1-D, a plasmid pMHyLp-Leu is used as a template, and a primer loxL-1F, loxL-1R is adopted for amplification to obtain a loxL-1 fragment.

(2) The four fragments P in step (1) are divided into four segments _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 Performing overlap extension PCR on MLS1-U, MLS1-D, loxL-1 under the conditions of 98 ℃ for 5min for pre-denaturation, then 98 ℃ for 10s for denaturation, 55 ℃ for 5s for annealing, 7 ℃ for 2min for extension, performing total 30 cycles, and after 1% agarose gel electrophoresis verification is correct, cutting gel and recovering fragments to obtain fusion gene fragments MLS1-U-P _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 -MLS1-D gene fragment.

(3) The fusion gene fragment MLS1-U-P obtained in the step (2) is subjected to _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 MLS1-D was transformed into the competence of the C2 strain prepared in example 2, spread on SDLeu plates and incubated at 30℃for 2-3 days, and single colony PCR was performed using the primer V-tI-1F, V-tI-1R to verify the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDLeu, YPD solid plates, and only the single colony grown on YPD medium was the correct Saccharomyces cerevisiae strain ΔMLS1-P _GPD -tHMG1-T _ADH1- P _TEF1 -IDI-T _AOX1 Named Saccharomyces cerevisiae recombinant C3.

Primer sequence:

MLS1-U-F:ttccattgggccgatgaagttagtc

MLS1-U-R:ttttgaactaaacaaagtagtaaaagcacataaaagaattaagaaa

MLS1-D-F:cactggccgtcgttttaatctcccttgccccagtgt

MLS1-D-R:ggtatcagttcgtttttgaataccttcggaa

loxL-1F:caggaaacagctatgaccatgattacgc

loxL-1R:taaaacgacggccagtgcctaatctcccttgccccagtgt

V-tI-1F:caaagcaatattatttagac

V-tI-1R:catctgctctgctcatggta

EXAMPLE 4 construction of recombinant bacterium C4

The specific construction process is as follows:

(1) Artificial synthesis of Gene fragment P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 The Saccharomyces cerevisiae BY4741 genome is used as a template, primers 1622b-U-F and 1622b-U-R are used for amplification to obtain a gene fragment 1622b-U, primers 1622b-D-F and 1622b-D-R are used for amplification to obtain a gene fragment 1622b-D, a plasmid pMHyLp-Trp is used as a template, and a primer loxT-2F, loxT-2R is used for amplification to obtain a loxT-2 fragment.

(2) Four of the steps (1)Fragment P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 Overlapping extension PCR is carried out on 1622b-U and 1622b-D, loxT-2, the PCR condition is that the temperature is 98 ℃, the denaturation is carried out for 5min, then the temperature is 98 ℃, the denaturation is carried out for 10s, the temperature is 55 ℃, the annealing is carried out for 5s, the temperature is 7 ℃, the extension is carried out for 2min, 30 cycles are total, after 1% agarose gel electrophoresis verifies correctness, the fragment is recovered after gel cutting, and the fusion gene fragment 1622b-U-P is obtained _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 -1622b-D gene fragment.

(3) The fusion gene fragment 1622b-U-P obtained in step (2) was then used _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 The transformation of 1622b-D into the competence of the C3 strain prepared in example 3 was performed by plating on SDTrp plates and incubating at 30℃for 2-3 days, and single colony PCR was performed using the primer V-tE-1F, V-tE-1R to verify the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDTrp, YPD solid plates, and only single colonies grown on YPD medium were the correct Saccharomyces cerevisiae strain Δ1622b-P _GPD -tHMG1-T _ADH1 -P _TEF1 -ERG20-T _CYC1 Named Saccharomyces cerevisiae recombinant C4.

Primer sequence:

1622b-U-F:tgtcatttatagatacattgacaaggtaaataaagacatt

1622b-U-R:cagaaggtaacagcaaaaacaaatagttcac

1622b-D-F:tggaactttatgtcgcctggc

1622b-D-R:gatagaaataccatatctgtgttttaaattaaatttcatggaaataa

loxT-2F:caggaaacagctatgaccatgattacgc

loxT-2R:gcactggccgtcgttttacaatggaactttatg

V-tE-1F:taaataaagtattggacataaa

V-tE-1R:catctgatcgtactggtaatgtg

EXAMPLE 5 construction of recombinant bacterium C5

The specific construction process is as follows:

(1) Artificial synthesis of Gene fragment P _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 The Saccharomyces cerevisiae BY4741 genome is used as a template, the primers 208a-U-F and 208a-U-R are adopted for amplification to obtain a gene fragment 208a-U, the primers 208a-D-F and 208a-D-R are adopted for amplification to obtain a gene fragment 208a-D, the plasmid pMHyLp-His is used as a template, and the primer loxH-2F, loxH-2R is adopted for amplification to obtain a loxH-2 fragment.

(2) Four P in step (1) _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 Carrying out overlap extension PCR on 208a-U and 208a-D, loxH-2 under the conditions of 98 ℃ and 5min for pre-denaturation, then carrying out denaturation for 10s and 55 ℃ and annealing for 5s and 7 ℃ for 2min, carrying out extension for 30 cycles in total, and after 1% agarose gel electrophoresis is verified to be correct, cutting gel and recovering fragments to obtain fusion gene fragments 208a-U-P _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 -208a-D gene fragment.

(3) The fusion gene fragment 208a-U-P obtained in the step (2) is subjected to _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 208a-D was transformed into the competence of the C4 strain prepared in example 4, spread on SDHis plates and incubated at 30℃for 2-3 days, and single colony PCR was performed using the primer V-IO-1F, V-IO-1R to verify the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDHis, YPD solid plates, and only single colonies grown on YPD medium were the correct Saccharomyces cerevisiae strain Δ208a-P _GPD -INO2-T _ADH1 -P _TEF1 -OLE1-T _CYC1 Named Saccharomyces cerevisiae recombinant C5.

Primer sequence:

208a-U-F:tggcattttttatatattgtaacattagggttctgttac

208a-U-R:tgccaatagggaccatacacac

208a-D-F:tgggcattttctaaacttgtagtttatgtgc

208ab-D-R:ccaacaggttggcaaaccagaatg

loxH-2F:ttaagtggactacctttgacgccaggaaacagctatgaccatgattacgc

loxH-2R:cactggccgtcgttttacaaaacgacggccagtgcca

V-IO-1F:tctttgaaagaattgctactg

V-IO-1R:cgttgggtagatacgttgacac

EXAMPLE 6 construction of recombinant bacterium C6

The specific construction process is as follows:

(1) Artificial synthetic gene fragment Phxt ₁ -ERG9-T _AOX1 The Saccharomyces cerevisiae BY4741 genome is used as a template, a primer ERG9-U-F, ERG9-U-R is adopted for amplification to obtain a gene fragment ERG9-U, a primer ERG9-D-F, ERG-D-R is adopted for amplification to obtain a gene fragment ERG9-D, a plasmid pMHyLp-Leu is used as a template, and a primer loxL-2F, loxL-2R is adopted for amplification to obtain a loxL-2 fragment.

(2) The four fragments Phxt in step (1) are combined ₁ -ERG9-T _AOX1 Performing overlap extension PCR on ERG9-U, ERG9-R, loxL-2 under the conditions of 98 ℃ for 5min, pre-denaturing at 98 ℃, denaturing for 10s,55 ℃ for 5s, annealing at 7 ℃ for 2min, performing extension for 30 cycles, and after 1% agarose gel electrophoresis verification is correct, cutting gel and recovering fragments to obtain fusion gene fragments ERG9-U-Phxt ₁ -ERG9-T _AOX1 -ERG9-D gene fragment.

(3) The fusion gene fragment ERG9-U-Phxt obtained in the step (2) is used for preparing the recombinant DNA ₁ -ERG9-T _AOX1 ERG9-D was transformed into the competence of the C5 strain prepared in example 5, spread on SDLeu plates and incubated at 30℃for 2-3 days, and single colony PCR was performed using the primers V-E9-1F, V-E9-1R to verify the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. The single colonies were fixed at SDUra, SDLeu, YPDSpot plate verification on body plates, single colony grown on YPD medium alone was the correct Saccharomyces cerevisiae strain ΔERG9-U-Phxt ₁ -ERG9-T _AOX1 Named Saccharomyces cerevisiae recombinant C6.

Primer sequence:

ERG9-U-F:aaaagtgcagctcagagccc

ERG9-U-R:acgtcacatatcacacacacacagtaaatgtccacttaa

ERG9-D-F:tgctttctcaggtaagtctgcgccaaataacataaacaaacaa

ERG9-D-R:ttgggctgaatgatagtgataattcttttttctatca

loxL-2F:gcagtggtagtagcattagtgccaggaaacagctatgaccatgattacgc

loxL-2R:taaaacgacggccagtgccacggccaactca

V-E9-1F:tggcactagcgttggtatttt

V-E9-1F:ccaagccatgttgtctcttac

EXAMPLE 7 construction of recombinant bacterium C7

The specific construction process is as follows:

(1) Artificial synthetic gene fragment T _ADH1 -crtE-P _GAL10 -crtI--T _cyc1 . The Saccharomyces cerevisiae BY4741 genome is used as a template, the primers 416D-U-F and 416D-U-R are adopted for amplification to obtain the gene 416D-U, the primers 416D-D-F and 416D-D-R are adopted for amplification to obtain the gene 416D-D, the pMHyLp-Trp plasmid is used as a template, and the primer loxT-3F, loxT-3R is adopted for amplification to obtain the loxT-3 gene fragment.

(2) The three gene fragments T obtained in step (1) are subjected to _ADH1 -crtE-P _GAL10 -crtI--T _cyc1 Carrying out overlap extension PCR on 416D-U and 416D-D under the conditions of 98 ℃ and 5min of pre-denaturation, then 98 ℃ and 10s of denaturation, 55 ℃ and 5s of annealing, 7 ℃ and 2min of extension, 30 cycles in total, and after 1% agarose gel electrophoresis verification is correct, cutting gel and recovering fragments to obtain fusion gene fragments 416D-U-T _ADH1 -crtE-P _GAL10 -crtI--T _cyc1 -416D-D gene fragment.

(3) Preparing saccharomyces cerevisiae engineering bacteria competence and constructing a fusion gene segment 416d-U-T _ADH1 -crtE-P _GAL10 -crtI--T _cyc1 -416D-D conversionThe strain was obtained by plating the competent Saccharomyces cerevisiae C6 strain of example 6 on SDTrp plates, culturing at 30℃for 2-3 days, and performing colony PCR using the primer V-EI-2F, V-EI-2R.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDTrp, YPD solid plates, and only the single colony grown on YPD medium was the correct Saccharomyces cerevisiae strain Δ416d-T _ADH1 -crtE-P _GAL10 - crtI--T _cyc1 Named Saccharomyces cerevisiae recombinant C7.

Primer sequences

416d-U-F:gtaaagataatgctaaatcatttggctttttgattgat

416d-U-R:gagatccgtttaaccggaccccttcgagcgtcccaaaaccttc

416d-D-F:gacggccagtgccggtccactgtgtgcc

416d-D-R:atgtggatatgctttgcgcagtt

loxT-3F:caggaaacagctatgaccatgattacgc

loxT-3R:ttgtaaaacgacggccagtgc

V-EI-2F:ttctgactgggttggaaggcaa

V-EI-2R:gtattttttttgagaatcttgcaac

EXAMPLE 8 construction of recombinant bacterium C8

The specific construction process is as follows:

(1) Artificial synthesis of Gene fragment P _GAL7 -crtYB-T _AOX1 The Saccharomyces cerevisiae BY4741 genome is used as a template, the primers 720a-U-F and 720a-U-R are adopted for amplification to obtain genes 720a-U, the primers 720a-D-F and 720a-D-R are adopted for amplification to obtain genes 720a-D, the pMHyLp-Leu plasmid is used as a template, and the primer loxL-3F, loxL-3R is adopted for amplification to obtain a loxL-3 gene fragment.

(2) The three gene fragments P obtained in step (1) are subjected to _GAL7 -crtYB-T _AOX1 Overlapping extension PCR was performed at 98℃for 5min, followed by 98℃for 10s and 55℃for 720a-U and 720a-DAnnealing for 5s at 7 ℃ and extending for 2min, carrying out total 30 cycles, and cutting gel and recovering fragments after 1% agarose gel electrophoresis verifies correctness to obtain fusion gene fragments 720a-U-P _GAL7 - crtYB-T _AOX1 -720a-D gene fragment.

(3) The fusion gene fragment 720a-U-P obtained in the step (2) is subjected to _GAL7 -crtYB-T _AOX1 -720a-D was transformed into the competence of the C7 strain prepared in example 7, spread on SDLeu plates and incubated at 30℃for 2-3 days, and single colony PCR was performed using the primer V-YB-2F, V-YB-2R to verify the strain.

(4) Preparing the strain obtained in the step (3) into competence, transforming into PY26-Cre plasmid, culturing on an SDUra plate at 30 ℃ for 2-3 days, taking single colony, inoculating into YPD culture medium, culturing for 15-24 h, streaking on a YPD plate containing 5-FOA, and culturing at 30 ℃ for 2-3 days. Spot plate verification was performed on each of the single colonies grown on SDUra, SDLeu, YPD solid plates, and only the single colony grown on YPD medium was the correct Saccharomyces cerevisiae strain Δ720a—P _GAL7 -crtYB-T _AOX1 Named Saccharomyces cerevisiae recombinant C8.

Primer sequence:

720a-U-F:taaacaaatgttgaaaacttcttcgaacgtaaat

720a-U-R:tgttactgttgattgttcgtttatttgtataattgagtttaca

720a-D-F:tgggtaattagggccaagagagt

720a-D-R:tatcaatgtctttttctttacttatttgtctttgctc

loxL-3F:aggtatagcatgaggtcgctccaggaaacagctatgaccatgattacgc

loxL-3R:taaaacgacggccagtgcctggaactttatgtcgcctggtgggtaatt

V-YB-2F:ttactcgagtaccattatgacg

V-YB-2R:aaaattttgtcttctccatt

EXAMPLE 9 shake flask fermentation

The method comprises the following specific steps:

(1) Preparation of culture Medium

The components of the fermentation medium include: 25g/L glucose, 25g/L glycerol, 50g/L soybean peptone, 0.6g/L dipotassium hydrogen phosphate and 25g/L sucrose, and dodecane is required to be added into a fermentation medium, wherein the ratio of the fermentation medium to the dodecane is 1:10.

(2) Parameters of Strain fermentation

The recombinant saccharomyces cerevisiae strain is respectively cultivated for 16-24 hours at 30 ℃ and 220rpm to prepare seed liquid, the prepared seed liquid is inoculated into a 250mL conical flask filled with 25mL fermentation medium and 25mL dodecane according to the inoculum size of 2% (v/v), and the seed liquid is cultivated for 96 hours at 30 ℃ and 220rpm to prepare the fermentation liquor.

(3) Calculating the yield of the recombinant strain beta-carotene:

the yield of the recombinant strain comprises two parts, one part is the yield of the product contained in the cells and the other part is the product content secreted outside the cells, and for fat-soluble beta-carotene, most of the product exists in the cells, and a small part of the product is extracted into the upper organic phase dodecane.

Centrifuging the Saccharomyces cerevisiae liquid fermented for 96h under 12000r/min for 10min, sucking supernatant dodecane, and packaging in a liquid phase bottle for measuring extracellular products; and (3) collecting thalli after centrifugation, washing twice with sterilized ultrapure water with the same volume as the fermentation broth, sucking 600uL of the water-washed resuspension bacteria liquid and 600uL of ethyl acetate, adding the mixture into a crushing pipe, crushing yeast cells by using a wall breaking machine, performing vortex oscillation extraction for 15min, wherein an intracellular product is basically dissolved in the ethyl acetate, centrifuging for 10min at 12000r/min, sucking the supernatant, and filling the supernatant into a liquid phase bottle for measuring the intracellular product. And obtaining the fermentation yield of the engineering strain by converting the peak area of the beta-carotene standard product. Resuspension of the fermentation broth after sucking dodecane, diluting the fermentation broth 100 times, and measuring OD with ultraviolet spectrophotometer ₆₀₀ 。

As shown in Table 1, tHMG1, IDI, ERG20, INO2, OLE1 and crtE, crtI, crtYB genes were overexpressed, MLS1 gene was knocked out, ERG9 gene was down-regulated, and the strain beta-carotene production reached 1535.35mg/L, OD ₆₀₀ Reaching 107.75.

TABLE 1 yields and OD of different recombinant bacteria ₆₀₀

Comparative example 1 substitution of crtI Source

The crtI gene from Blakeslea trispora is replaced by Pantoea. Aggolomerans source, and the beta-carotene yield of the C2 recombinant strain is reduced from 74.05mg/L to 41.74mg/L after replacement.

TABLE 2 beta-carotene production and OD of C2 recombinant bacteria of different sources ₆₀₀

From the above data, it can be seen that the crtI gene of Blakeslea trispora source is used to increase the amount and yield of the crtI gene, which is more favorable for synthesizing carotenoid from Saccharomyces cerevisiae.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations and modifications of the present invention will be apparent to those of ordinary skill in the art in light of the foregoing description. It is not necessary here nor is it exhaustive of all embodiments. And obvious variations or modifications thereof are contemplated as falling within the scope of the present invention.

Sequence listing

<110> university of Jiangnan, miss you health food stock Co., ltd

<120> a strain for producing beta-carotene and use thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1194

<212> DNA

<213> (Artificial sequence)

<400> 1

gaattcatgg cttacactgc tatggccgca ggtactcaat ctttgcaatt gagaaccgtt 60

gcttcttacc aagaatgtaa ctccatgaga tcttgtttca agttgactcc attcaagtct 120

ttccacggtg ttaacttcaa cgttccatcc ttgggcgctg ctaactgtga aattatggga 180

cacttgaagt tgggttcttt accatacaag caatgttctg tctcctccaa gtctactaag 240

accatggccc aattggttga tttggctgaa accgaaaagg ctgaaggtaa ggatattgaa 300

tttgacttca acgaatacat gaagtccaaa gccgtcgccg tcgatgctgc tttggacaag 360

gctattccat tggaatatcc agaaaagatc cacgaatcca tgcgttactc tttgttggct 420

ggtggtaaga gagttagacc agctttatgt atcgctgcct gtgaattggt tggtggttcc 480

caagatttgg ccatgccaac tgcttgtgct atggaaatga tccataccat gtctttgatt 540

catgatgact tgccatgcat ggacaacgat gatttccgta gaggtaagcc aaccaaccac 600

aaggtttttg gtgaagacac tgccgttttg gcaggtgacg ctttgttgtc atttgctttc 660

gaacacatcg ctgttgctac ctctaagact gtcccatctg accgtacttt gagagtcatc 720

tctgaattag gtaaaaccat tggttcacaa ggtctagtgg gtggtcaagt tgttgacatc 780

acttctgaag gtgatgctaa tgttgacttg aagacattgg aatggattca cattcacaag 840

accgctgtac tcctggagtg ctccgtcgtt tccggtggta tcttgggtgg tgctactgaa 900

gatgaaattg ccagaatcag aagatacgct agatgtgttg gtttattatt ccaagtcgtt 960

gacgacatct tggatgttac caagtcttct gaagaactag gtaaaaccgc cggtaaggac 1020

ttgctaactg acaaagctac ttacccaaag ttgatgggtt tggaaaaagc taaggaattt 1080

gctgctgaat tggctaccag agccaaggaa gaattgtctt ctttcgacca aattaaggct 1140

gctcctttat tgggtttggc tgactacatc gccttcagac aaaactgaga gctc 1194

<210> 2

<211> 891

<212> DNA

<213> (Artificial sequence)

<400> 2

ttaaacaggt ctttgccaca aatcagcaga tcttggagcg tgtcttgcaa ctcttgaagt 60

aacagcttga ccagaagcag caaccaacaa agccaatttt tcaggagtag aagtagattg 120

tctttgttcc caagcttgag aaccagcttg aacaactttc ataccaattt ttctataaac 180

ttgttgagca gtagcaatag cccaagcaga tctcaatggc aaaccaggca aaccagcaga 240

agcagatcta taatatggtt cagcagtttc aactaatctt ctagcaactc tagacaaagc 300

ttttctattt tgtggatcag ccaaattttc tctagtcaaa ccttcttcag ccaaccaagc 360

agcaggcaaa taacatctac cagcttcagc atcttcaaca atatctctag caatattagt 420

caattgaaaa gccaaaccca aatcacaagc tctatccaaa gtagcattat ctctaacacc 480

cataatttga gccatcatca aaccaacaac accagcaaca tgataacaat atctcaaagt 540

atcatccaaa gtttgatatc tagtttcatg aacatccata gcaaaaccag ccaaatgatc 600

aaaagcataa gcaggcaaaa tatcatgagc catagcaact tcttgaaaag cagcaaaagc 660

aggttcgtgc atttgagaac cagcataagc ttgtctagtt ttcatttcca attgagccaa 720

tctttgttca gcagattgca aagatggagt atcattagaa aaacccaaaa cttgatcatc 780

aataacatca tcacaatgtc tacaccaagc atacaacatc aaaacagatc ttctagtttt 840

agcatcaaac aatttagaag cagtagcaaa agatttagaa ccaacttcca t 891

<210> 3

<211> 1761

<212> DNA

<213> (Artificial sequence)

<400> 3

gtcgactcag attctgatgt cgttggagtt ttgaacttgg aaaacgtttg gcaacaattg 60

gttaatgaag gaagcaggag tggtagtgtc atcacgtggg aagaaataaa agaaaaggaa 120

agtgacgaag taacaagcca aacagtagta aatccagtga gactcagtct ttctggtttg 180

ttctggggcg tatttttttt gagaatcttg caactttctt ggcaatgggt tttgaccgaa 240

agacttacag acttggtcag aagtcaactt agaaccagcc aagacgattg ggacacctgt 300

acctgggtgg gtggaagcac caacaaagaa caagttgtcg tatctgttag tagagtcctt 360

ggtagatggt ctgaaccata acacttggaa gacatcatgt gataaaccca agatggaacc 420

acgccagaga ttgaacttag attgccagac agatgggtcg ttaacttctt cgtgttcaat 480

caagttagcg aagttgttga cgcctaatct tctttcgatg acttccaaaa ccatctttct 540

agctctgtta accaattctg gataattttc ttcagcagag ttaccggttt ttgatttcat 600

gtgaccaatc gggaccaaaa cgatgatgga atccttgttt ggtggagcgg cggattcgtc 660

aattctggaa ggaacattga catagaagga agcttcagat ggcaaaccga aatcgttgaa 720

aatttcatcg aagctttcct tgtaggcttc agccaagaag atgttgtgga catccaattg 780

tggaacctta gtggacatgg accagtagaa agaaatagag gaactggtca attttttaga 840

ggctaaggtc ttcttcgtcc agttacatgg aggcaacaaa tgatggtaag cgtaaaccag 900

atcagcattg cacacaacgg catcagcttc aatgacttca ccagattcca aagtaacacc 960

agtaactctc ttgtccttgt caacagtgtt gatcttagca actggagatt ggtatctaaa 1020

ttcagcaccg tacttcttgg aagcaataga ttccaacttt tggacgacca tgttgaaacc 1080

acctcttggg taccagatac cttcggcaaa ttcggtgtat tgcaatagag agtagacagc 1140

tggagcatcg tatggagaca tacccatgta catggtttgg aaagtgaaag ccattctcat 1200

cttcttagtt tggaagtact tggaagctct gtcgtaaatc ttaccaaaca agtgcaatct 1260

aaagatttct ggaacgtatt gtaatctgat caaatcccag atggtttcaa agtttctctt 1320

gatagcgatg aaggtacctt gttcgtagtg aacgtgagtt tccttcatga agtccaagaa 1380

tctaccgaaa cccaatggac cttcgatacg gtctaattca cccttcatct tggtcaagtc 1440

agaagataat tgaacagcgt caccatcgtc gaagtggacc ttgtagttgt tatcacatct 1500

cagtaagtct agatgatcac caattctttc gtccaagtca gcgaaagcat cttcgaacaa 1560

ctttggcatc aagtacaagg atggcccttg gtcaaatctg tgaccgtcgt ggtgaataaa 1620

agaacaacga ccaccggaga agtcgttctt ttcaacgacg gtaactctga aaccttctct 1680

ggccaatcta gcagcagtgg cagtaccacc aataccggca ccgataacaa ctatgtgctt 1740

cttttgatcg gacatggatc c 1761

<210> 4

<211> 2022

<212> DNA

<213> (Artificial sequence)

<400> 4

ttattgacct tcccaaccag acataacaac agacaaaact tttctaactc ttctccaacc 60

agcaacagtt cttctttcac caacatcacc tttccaaaca actttaattt ctctaccaat 120

caacaaataa gaagcacaag cagctctcat accagcttga acttcagttg gcaatctatc 180

aataccttta taagaatgtt tagccaaatc ttcagcataa gcaaccaatg gcaaagaata 240

agttttccat tcaaatctaa aagattcaga agcattagaa gatggcaaag ttgaagatgg 300

tgacaaagac aacaatttat caaaatcttg tggtcttggt tcagtccaat cagttggaat 360

agccaattta gattcatctc tcaaaccaaa aaaagacaat ggcaaataaa atctaccttc 420

agtagcatca cctttaatat ctctagcaat attaaccaat tgcaaagcag tacccatttc 480

tctagaagca accaaaacag cttctctttc ttcaatagta gcaggaactt gagatggagc 540

agaagcccaa gaaacataaa ccaacaattc agcaacagaa ccagcaacac acaaaccata 600

atccaacaaa tcagcagtag tttcaattgg agtttttcta gcttgaacag cttcagtaga 660

caatggaaaa atcaaatcag tagtataacc tctcaacaat tcatccaatg gatatcttgg 720

aatcaaacct tgcaatttag ccaacaatct aaaagcaaaa tgatattgaa caggaactct 780

ttcagtcaaa aattgaacca attcagcagg agacaaagat ggtggaggtg gcaatggata 840

cataccagtt ggtctagatg gatgagatgg tggcaacaat ggagaagaca aaattttatc 900

aggttgagat ggatgcaatg gtggaccaaa caacaaagtc aaaaaatcag aaaccatatc 960

aatagtagca tgtggattag aagaaacttc aggagaatca atcaaatcat cagtaactct 1020

acaaaaagca tacaaaccaa ccaatctttc tctaacttca gatggaaaac cagcagatgc 1080

aacaaaaaaa gatctagatt tttcttccaa caatttaaca gccaattcca aatctctttt 1140

tggttgagaa gaatatggtc ttgaagaaaa gaataaagac aaaacaggtg gtgtaattaa 1200

tggaaaagaa gatggcattt ttttattacc atagatagtt ctaccatgca ataaatataa 1260

tgcttgagta tgatcacatg cagacaaacc caaaacaatc atcaaattag tcaacaaaaa 1320

aaacatagct tcttcaattg gcaaaacacc acccaatctc caaccaacaa ttttttcatc 1380

attaatagac caagaatctt gaccaacagc aacataatca acccaaatca aataaacagt 1440

tggaatcata atagcagcaa tagtagattt agctctacca gatttccaat caaaagcata 1500

ctcaccagac aaagcagcca acaacatagt tggtggagta atcaacaaag ataaagctct 1560

catataaaaa taatgatcag taaccaatgg atcaggagat ggagatggat gagcagtaaa 1620

caaataaata attggcaatg gaatcaaagc cttcaaagcc aaagacaaag cagaagatct 1680

agtttttggc aatgctaaag atggcaacaa atgtctagta gctaagacat aaaccaaacc 1740

agtaataaca gtttggataa caaaaaaagc gtattcttca tatggaacat ccaagaaagt 1800

accgaaaaca ccttgaccag attcagcaga tggataagtc caagcaccat ttctaataat 1860

ccaagaatcc catggagtag tagcagaaaa agcaataaaa accaaaattg agatcttgta 1920

gatgtcgaac ttagttaaga ttggagaagt caataatcct aacaaaccta aaattggcaa 1980

agtataaatc aaatgaattt gataataagc caaagcagtc at 2022

<210> 5

<211> 1575

<212> DNA

<213> (Artificial sequence)

<400> 5

gaccaattgg tgaaaactga agtcaccaag aagtctttta ctgctcctgt acaaaaggct 60

tctacaccag ttttaaccaa taaaacagtc atttctggat cgaaagtcaa aagtttatca 120

tctgcgcaat cgagctcatc aggaccttca tcatctagtg aggaagatga ttcccgcgat 180

attgaaagct tggataagaa aatacgtcct ttagaagaat tagaagcatt attaagtagt 240

ggaaatacaa aacaattgaa gaacaaagag gtcgctgcct tggttattca cggtaagtta 300

cctttgtacg ctttggagaa aaaattaggt gatactacga gagcggttgc ggtacgtagg 360

aaggctcttt caattttggc agaagctcct gtattagcat ctgatcgttt accatataaa 420

aattatgact acgaccgcgt atttggcgct tgttgtgaaa atgttatagg ttacatgcct 480

ttgcccgttg gtgttatagg ccccttggtt atcgatggta catcttatca tataccaatg 540

gcaactacag agggttgttt ggtagcttct gccatgcgtg gctgtaaggc aatcaatgct 600

ggcggtggtg caacaactgt tttaactaag gatggtatga caagaggccc agtagtccgt 660

ttcccaactt tgaaaagatc tggtgcctgt aagatatggt tagactcaga agagggacaa 720

aacgcaatta aaaaagcttt taactctaca tcaagatttg cacgtctgca acatattcaa 780

acttgtctag caggagattt actcttcatg agatttagaa caactactgg tgacgcaatg 840

ggtatgaata tgatttctaa aggtgtcgaa tactcattaa agcaaatggt agaagagtat 900

ggctgggaag atatggaggt tgtctccgtt tctggtaact actgtaccga caaaaaacca 960

gctgccatca actggatcga aggtcgtggt aagagtgtcg tcgcagaagc tactattcct 1020

ggtgatgttg tcagaaaagt gttaaaaagt gatgtttccg cattggttga gttgaacatt 1080

gctaagaatt tggttggatc tgcaatggct gggtctgttg gtggatttaa cgcacatgca 1140

gctaatttag tgacagctgt tttcttggca ttaggacaag atcctgcaca aaatgttgaa 1200

agttccaact gtataacatt gatgaaagaa gtggacggtg atttgagaat ttccgtatcc 1260

atgccatcca tcgaagtagg taccatcggt ggtggtactg ttctagaacc acaaggtgcc 1320

atgttggact tattaggtgt aagaggcccg catgctaccg ctcctggtac caacgcacgt 1380

caattagcaa gaatagttgc ctgtgccgtc ttggcaggtg aattatcctt atgtgctgcc 1440

ctagcagccg gccatttggt tcaaagtcat atgacccaca acaggaaacc tgctgaacca 1500

acaaaaccta acaatttgga cgccactgat ataaatcgtt tgaaagatgg gtccgtcacc 1560

tgcattaaat cctaa 1575

<210> 6

<211> 867

<212> DNA

<213> (Artificial sequence)

<400> 6

ttatagcatt ctatgaattt gcctgtcatt ttccacttca gaaaggtcat ctaattgctc 60

ccaccagttg aataagtaat tctcgcaaat aatcttaaac caaggcgtaa acttgtaact 120

tgggtcagca aacatagttt tcaaatcatt tggtgaaacc catttgaagt ctctaacttc 180

attgacgttt gggttgacag tcaagttttc tttagcgttg atcttataaa ataggatgta 240

atcaatttca tgttcacccc atggttcatt gcttggtgcc atgtaatgga ttctgtttaa 300

aaagtgaaac ttaccccttg tcttagtttc atcttctgga atacctaatt catgatctag 360

ttttctcacc gccgcagtaa tagcgccctt aatcttatcg tctagcttac ccttcaaacc 420

taattcgtca tcaatacata gtggatgaga gcagcatgtg ttagtccaaa gatcagggaa 480

agttattttt tcagtggctc tttgttgtaa aagtaattca ccttgttcat tgaaaataaa 540

gacggagaat gcacgatgta gtaaaccctt ttcaatattt tccattaaat gacaaacttt 600

cttggtaccg gcaccaatag cattatcgtc ccaatccaaa acaatacaat tttcattcat 660

taacttaatt tgctcctcat catgaccaga aaaacatgtt tctccgcttt cgtcatttga 720

cgtctcacta gatcgggtat taggtctttg ttgtaatgga ataatttcag gaaactcttc 780

caaaatgtct tcaggtgttt ggttttgcac taatttggcg taactagata ctgcaccatg 840

gggcatacta ttgttgtcgg cagtcat 867

<210> 7

<211> 1059

<212> DNA

<213> (Artificial sequence)

<400> 7

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttacttctt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatcaa tgacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatag 1059

<210> 8

<211> 1665

<212> DNA

<213> (Artificial sequence)

<400> 8

atggttaagg tcagtttgga taacgtcaaa ttactggtgg atgttgataa ggagcctttc 60

tttaaaccat ctagtactac agtgggagat attcttacca aggatgctct agagttcatt 120

gttcttttac acagaacttt caacaacaag agaaaacaat tattggaaaa cagacaagtt 180

gttcagaaga aattagactc gggctcctat catctggatt tcctgcctga aactgcaaat 240

attagaaatg atcccacttg gcaaggtcca attttggcac cggggttaat taataggtca 300

acggaaatca cagggcctcc attgagaaat atgctgatca acgctttgaa tgctcctgtg 360

aacacctata tgactgattt tgaagattca gcttcaccta cttggaacaa catggtttac 420

ggtcaagtta atctctacga cgcgatcaga aatcaaatcg attttgacac accaagaaaa 480

tcgtacaaat tgaatggaaa tgtggccaac ttgcccacta ttatcgtgag accccgtggt 540

tggcacatgg tggaaaagca cctttatgta gatgatgaac caatcagcgc ttccatcttt 600

gattttggtt tatatttcta ccataatgcc aaagaattaa tcaaattggg caaaggtcct 660

tacttctatt tgccaaagat ggagcaccac ttggaagcta aactatggaa cgacgtcttc 720

tgtgtagctc aagattacat tgggatccca aggggtacaa tcagagctac tgtgttgatt 780

gaaactttgc ctgctgcttt ccaaatggaa gagatcatct atcaattaag acaacattct 840

agtgggttga attgcggacg ttgggactat attttctcta caatcaagag attaagaaat 900

gatcctaatc acattttgcc caatagaaat caagtgacta tgacttcccc attcatggat 960

gcatacgtga aaagattaat caatacctgt catcggaggg gtgttcatgc catgggtggt 1020

atggctgcgc aaatccctat caaagacgac ccggcagcca atgaaaaggc catgactaaa 1080

gtccgtaatg ataagattag agagctgaca aatggacatg atgggtcatg ggttgcacac 1140

ccagcactgg cccctatttg taatgaagtt ttcattaata tgggaacacc aaaccaaatc 1200

tatttcattc ctgaaaacgt tgtaacggct gctaatctgc tggaaaccaa aattccaaat 1260

ggtgagatta ctaccgaggg aattgtacaa aacttggata tcgggttgca gtacatggaa 1320

gcttggctca gaggctctgg atgtgtgccc atcaacaact tgatggaaga cgccgccact 1380

gctgaagtgt ctcgttgtca attgtatcaa tgggtgaaac acggtgttac tctaaaggac 1440

acgggagaaa aggtcacccc agaattaacc gaaaagattc taaaagaaca agtggaaaga 1500

ctgtctaagg caagtccatt gggtgacaag aacaaattcg cgctggccgc taagtatttc 1560

ttgccagaaa tcagaggcga gaaattcagt gaatttttga ctacattgtt gtacgacgaa 1620

attgtgtcca ctaaggcgac gcccactgat ttgagcaaat tgtga 1665

<210> 9

<211> 1335

<212> DNA

<213> (Artificial sequence)

<400> 9

atgggaaagc tattacaatt ggcattgcat ccggtcgaga tgaaggcagc tttgaagctg 60

aagttttgca gaacaccgct attctccatc tatgatcagt ccacgtctcc atatctcttg 120

cactgtttcg aactgttgaa cttgacctcc agatcgtttg ctgctgtgat cagagagctg 180

catccagaat tgagaaactg tgttactctc ttttatttga ttttaagggc tttggatacc 240

atcgaagacg atatgtccat cgaacacgat ttgaaaattg acttgttgcg tcacttccac 300

gagaaattgt tgttaactaa atggagtttc gacggaaatg cccccgatgt gaaggacaga 360

gccgttttga cagatttcga atcgattctt attgaattcc acaaattgaa accagaatat 420

caagaagtca tcaaggagat caccgagaaa atgggtaatg gtatggccga ctacatctta 480

gatgaaaatt acaacttgaa tgggttgcaa accgtccacg actacgacgt gtactgtcac 540

tacgtagctg gtttggtcgg tgatggtttg acccgtttga ttgtcattgc caagtttgcc 600

aacgaatctt tgtattctaa tgagcaattg tatgaaagca tgggtctttt cctacaaaaa 660

accaacatca tcagagatta caatgaagat ttggtcgatg gtagatcctt ctggcccaag 720

gaaatctggt cacaatacgc tcctcagttg aaggacttca tgaaacctga aaacgaacaa 780

ctggggttgg actgtataaa ccacctcgtc ttaaacgcat tgagtcatgt tatcgatgtg 840

ttgacttatt tggccggtat ccacgagcaa tccactttcc aattttgtgc cattccccaa 900

gttatggcca ttgcaacctt ggctttggta ttcaacaacc gtgaagtgct acatggcaat 960

gtaaagattc gtaagggtac tacctgctat ttaattttga aatcaaggac tttgcgtggc 1020

tgtgtcgaga tttttgacta ttacttacgt gatatcaaat ctaaattggc tgtgcaagat 1080

ccaaatttct taaaattgaa cattcaaatc tccaagatcg aacagtttat ggaagaaatg 1140

taccaggata aattacctcc taacgtgaag ccaaatgaaa ctccaatttt cttgaaagtt 1200

aaagaaagat ccagatacga tgatgaattg gttccaaccc aacaagaaga agagtacaag 1260

ttcaatatgg ttttatctat catcttgtcc gttcttcttg ggttttatta tatatacact 1320

ttacacagag cgtga 1335

<210> 10

<211> 915

<212> DNA

<213> (Artificial sequence)

<400> 10

tcaggaatca tccagtatgt gctgtagtgc ttcatttgcg cttctaatgg acttgatatc 60

gttcattaca caagttaaaa gaatatgctt gggaattctt ttcccgtttt ccttcggtgg 120

ggtccttact gatttaatga gcctttcaaa ggcttctttg gtgtttattc ttcgtatctt 180

ctccatttga acgtgtttcc atttccgtac cttcacaggg tcgtcctcga tattggctgg 240

aatatcagag tctgggattc gtatctcagg tactgaaaac ggtggcgggt tgtagtggtc 300

attgccgata ggctgatgag gtccttccct cgtggtgaac tcagttggca catctgctgt 360

gtttgtgggt aactcccctg tgttactgtg tggatgtgtt tcaggatatc tttgatttaa 420

ttcggtatac ctatgctgct tttttggtga tcttatatgt agatgtgatt cggagttcat 480

ggaagcgttg gaagacatca tatcctgtga tattagattg tctaaaaact gttcaatggc 540

attcgattca ttcgtgctca acaaccccga actggaagga gacaacttga gaccaagcgc 600

ttgatcaaaa cccatgcttg gttgatgagg gttgtgattt agatagtgtg catgagtatg 660

caaaggagca tgatgagttt ggttatcggc aggtatagtt tctacgtgag agggttgcac 720

ggttgctacg ttaggaatta tgccgagctc gtgtgttaac agaggagggg aagttgcact 780

aaacgtgttt tcatgtatgt gcgcagacat ttggtcgtcg aagttactgc tgagcatttg 840

gtaagcagtt tcaaagtcta tatcgttatc cagatctagg atacccagta attcgttccc 900

agttgcttgt tgcat 915

<210> 11

<211> 1533

<212> DNA

<213> (Artificial sequence)

<400> 11

atgccaactt ctggaactac tattgaattg attgacgacc aatttccaaa ggatgactct 60

gccagcagtg gcattgtcga cgaagtcgac ttaacggaag ctaatatttt ggctactggt 120

ttgaataaga aagcaccaag aattgtcaac ggttttggtt ctttaatggg ctccaaggaa 180

atggtttccg tggaattcga caagaaggga aacgaaaaga agtccaattt ggatcgtctg 240

ctagaaaagg acaaccaaga aaaagaagaa gctaaaacta aaattcacat ctccgaacaa 300

ccatggactt tgaataactg gcaccaacat ttgaactggt tgaacatggt tcttgtttgt 360

ggtatgccaa tgattggttg gtactttgct ctctctggta aagtgccttt gcatttaaac 420

gttttccttt tctccgtttt ctactacgct gtcggtggtg tttctattac tgccggttac 480

catagattat ggtctcacag atcttactcc gctcactggc cattgagatt attctacgct 540

atcttcggtt gtgcttccgt tgaagggtcc gctaaatggt ggggccactc tcacagaatt 600

caccatcgtt acactgatac cttgagagat ccttatgacg ctcgtagagg tctatggtac 660

tcccacatgg gatggatgct tttgaagcca aatccaaaat acaaggctag agctgatatt 720

accgatatga ctgatgattg gaccattaga ttccaacaca gacactacat cttgttgatg 780

ttgttaaccg ctttcgtcat tccaactctt atctgtggtt actttttcaa cgactatatg 840

ggtggtttga tctatgccgg ttttattcgt gtctttgtca ttcaacaagc taccttttgc 900

attaactcct tggctcatta catcggtacc caaccattcg atgacagaag aacccctcgt 960

gacaactgga ttactgccat tgttactttc ggtgaaggtt accataactt ccaccacgaa 1020

ttcccaactg attacagaaa cgctattaag tggtaccaat acgacccaac taaggttatc 1080

atctatttga cttctttagt tggtctagca tacgacttga agaaattctc tcaaaatgct 1140

attgaagaag ccttgattca acaagaacaa aagaagatca ataaaaagaa ggctaagatt 1200

aactggggtc cagttttgac tgatttgcca atgtgggaca aacaaacctt cttggctaag 1260

tctaaggaaa acaagggttt ggttatcatt tctggtattg ttcacgacgt atctggttat 1320

atctctgaac atccaggtgg tgaaacttta attaaaactg cattaggtaa ggacgctacc 1380

aaggctttca gtggtggtgt ctaccgtcac tcaaatgccg ctcaaaatgt cttggctgat 1440

atgagagtgg ctgttatcaa ggaaagtaag aactctgcta ttagaatggc tagtaagaga 1500

ggtgaaatct acgaaactgg taagttcttt taa 1533

Claims

1. A strain producing β -carotene, characterized in that: the strain takes saccharomyces cerevisiae as a starting strain, expresses beta-carotene synthesis genes, overexpresses mevalonate pathway related genes, and knocks out acetyl coenzyme A metabolism related genes;

the beta-carotene synthesis gene is a gene for encoding geranylgeranyl diphosphate synthasecrtEGene encoding phytoene synthasecrtBGene encoding phytoene desaturasecrtIAnd genes encoding lycopene cyclasecrtYB；

The mevalonate pathway-related gene is a gene encoding a 3-hydroxy-3-methylglutaryl-CoA reductasetHMG1Genes encoding isopentenyl pyrophosphate isomeraseIDIAnd encoding farnesylGene of pyrophosphoric acid synthaseERG20；

The related gene of acetyl-CoA metabolism is a gene for encoding malic acid synthaseMLS1；

Wherein,,

gene encoding geranylgeranyl diphosphate synthasecrtEThe nucleotide sequence of (2) is shown as SEQ ID NO.1, and the gene for coding phytoene synthasecrtBThe nucleotide sequence of (2) is shown as SEQ ID NO.2, and the gene for coding phytoene desaturasecrtIThe nucleotide sequence of (2) is shown as SEQ ID NO.3, and the gene for coding lycopene cyclasecrtYBThe nucleotide sequence of (2) is shown as SEQ ID NO.4, and the gene for encoding 3-hydroxy-3-methylglutaryl coenzyme A reductasetHMG1The nucleotide sequence of (2) is shown as SEQ ID NO.5, and the gene for coding isopentenyl pyrophosphate isomeraseIDIThe nucleotide sequence of (2) is shown as SEQ ID NO.6, and the gene for encoding farnesyl pyrophosphate synthaseERG20The nucleotide sequence of (2) is shown as SEQ ID NO.7, and the gene for coding the malic acid synthaseMLS1The nucleotide sequence of (2) is shown as SEQ ID NO. 8.

2. A strain according to claim 1, characterized in that: the strain down-regulates a gene encoding squalene synthaseERG9The method comprises the steps of carrying out a first treatment on the surface of the Genes encoding squalene synthaseERG9The nucleotide sequence of (2) is shown as SEQ ID NO. 9.

3. A strain according to claim 1, characterized in that: the strain over-expresses endoplasmic reticulum size regulating factor related geneINO2And genes encoding fatty acid desaturasesOLE1The method comprises the steps of carrying out a first treatment on the surface of the Genes encoding endoplasmic reticulum size regulatory factorsINO2The nucleotide sequence of (2) is shown as SEQ ID NO.10, and the gene for encoding fatty acid desaturaseOLE1The nucleotide sequence of (2) is shown as SEQ ID NO. 11.

4. A strain according to claim 1, characterized in that: the strain overexpresses a gene encoding geranylgeranyl diphosphate synthasecrtEGene encoding phytoene desaturasecrtIAnd a group encoding lycopene cyclaseBecause ofcrtYB。

5. The strain according to claim 4, wherein: the strain expresses genes encoding geranylgeranyl diphosphate synthase in multiple copiescrtEGene encoding phytoene desaturasecrtIAnd genes encoding lycopene cyclasecrtYB。

6. A strain according to claim 1, characterized in that: the strain takes Saccharomyces cerevisiae CEN.PK102 as a host and PY26-Cre as a vector.

7. A process for producing β -carotene, characterized by: fermenting beta-carotene using acetyl-coa as a substrate with the strain of any one of claims 1-6.

8. The method according to claim 7, wherein: the fermentation condition is 30-35 ℃,200-220rpm, the inoculation amount is 1-5%, and the fermentation time is 12-120h.

9. Use of a strain according to any one of claims 1-6 for the preparation of β -carotene or a β -carotene containing product.