CN114806885B - Spodoptera frugiperda microsporidian CT-WB2022 and application thereof - Google Patents
Spodoptera frugiperda microsporidian CT-WB2022 and application thereof Download PDFInfo
- Publication number
- CN114806885B CN114806885B CN202210552495.3A CN202210552495A CN114806885B CN 114806885 B CN114806885 B CN 114806885B CN 202210552495 A CN202210552495 A CN 202210552495A CN 114806885 B CN114806885 B CN 114806885B
- Authority
- CN
- China
- Prior art keywords
- spodoptera frugiperda
- microsporidian
- larvae
- insecticide
- spodoptera
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/10—Animals; Substances produced thereby or obtained therefrom
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Dentistry (AREA)
- Wood Science & Technology (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention belongs to the technical field of microorganisms, and particularly relates to spodoptera frugiperda CT-WB2022 and application thereof. The invention relates to Spodoptera frugiperda CT-WB2022. In the invention, spodoptera frugiperda larvae are collected in corn fields in Tang county in Hebei province, are subjected to indoor feeding for 2 generations, and are separated into spodoptera frugiperda microsporidian CT-WB2022 in the bodies of the larvae in abnormal growth states, and the biological preservation is carried out, wherein the preservation number is CGMCC No.24464. The Spodoptera frugiperda microsporidian CT-WB2022 has a strong pathogenic effect on Spodoptera frugiperda larvae, and can be applied to biological control of Spodoptera frugiperda.
Description
Technical Field
The invention belongs to the technical field of microorganisms, and particularly relates to spodoptera frugiperda CT-WB2022 and application thereof.
Background
Spodoptera frugiperda (Spodoptera frugiperda) belongs to the family of Lepidoptera, is native to tropical and subtropical areas of america, has the characteristics of large food intake, strong reproductive capacity, wide range of hazard, high speed of diffusion and migration, sudden heavy pests and the like, and is an important pest on crops.
The method for preventing and controlling spodoptera frugiperda mainly uses chemical prevention and control, such as spraying with organic phosphorus chemical agents, and the like, but chemical pesticides are easy to produce residues, and the method is contrary to the concept of environmental protection and is easy to increase the resistance of spodoptera frugiperda to the chemical pesticides. Biological control has the advantages of no harm to human and livestock health, no environmental pollution, no drug resistance, effective inhibition or elimination of target organisms and the like, and has become an important means for controlling harmful organisms. The search for microorganisms that control the population of spodoptera frugiperda is an effective way to reduce its harm.
Microsporidia are a single-cell eukaryotic organism with obligate intracellular parasitism, have two modes of transmission, horizontal and vertical, in host populations, and are important biological factors for controlling the number of many insect populations. As a biological control resource, there has been registered a microsporidian of locust in the U.S. environmental protection agency, and as an example of mass production application of a biological control product in controlling locust. In addition, microsporidian also has pathogenicity to various lepidoptera insects such as silkworm, tussah, spodoptera exigua, corn borer, asparagus caterpillar and the like. With the advent of new hosts, more and more microsporidia were found. At present, biological control resources of spodoptera frugiperda mainly comprise polyhedra virus, parasitic wasps, beauveria bassiana, metarhizium anisopliae, bt and the like, and no report of pathogenicity of microsporidian on spodoptera frugiperda exists.
Disclosure of Invention
The invention aims to provide spodoptera frugiperda CT-WB2022 and application thereof, which are used for preventing spodoptera frugiperda and enriching biological prevention and treatment resources.
The invention provides spodoptera frugiperda CT-WB2022 with a preservation number of CGMCC No.24464.
The invention also provides an insecticide comprising the Spodoptera frugiperda CT-WB2022.
Preferably, the dosage form of the insecticide comprises a suspension.
Preferably, the spore concentration of Spodoptera frugiperda CT-WB2022 in the suspension is 6.25X10 6 ～1.0×10 8 Individual spores/mL.
The invention also provides a preparation method of the pesticide, which comprises the following steps:
by using the spodoptera frugiperda microsporidian CT-WB2022 to infect spodoptera frugiperda larvae, grinding to obtain spodoptera frugiperda homogenate, and filtering to obtain spodoptera frugiperda tissue fluid; the spodoptera frugiperda tissue fluid contains the pesticide.
Preferably, the means for infecting spodoptera frugiperda microsporidian CT-WB2022 with spodoptera frugiperda larvae comprises: spraying the suspension of the Spodoptera frugiperda microsporidian CT-WB2022 on leaves for feeding or stirring with feed for feeding the Spodoptera frugiperda larvae; the spore number of Spodoptera frugiperda microsporidian CT-WB2022 in the suspension is 1.0X10 7 individual/mL; four layers of gauze are used for filtering;
preferably, the method further comprises: separating the spodoptera frugiperda tissue fluid to obtain an insecticide; the separation includes differential centrifugation and density gradient centrifugation.
The invention also provides application of the microsporidian or the pesticide in plant pest control.
Preferably, the plant comprises maize.
Preferably, the pest comprises spodoptera frugiperda.
The invention provides spodoptera frugiperda CT-WB2022 with a preservation number of CGMCC No.24464. In the invention, spodoptera frugiperda larvae are collected in corn fields in Tang county in Hebei province, are subjected to indoor breeding for 2 generations, and are separated into spodoptera frugiperda microsporidian CT-WB2022 in the bodies of the larvae in abnormal growth states, and the microsporidian has a strong pathogenic effect on the spodoptera frugiperda larvae. Example results show that the Spodoptera frugiperda microsporidian CT-WB2022 of the present invention has high insecticidal activity against 1-year, 2-year, 3-year and 4-year larvae of Spodoptera frugiperda and LC for 5 days on 1-year and 2-year Spodoptera frugiperda larvae 50 2.51X10 respectively 7 Spores and 2.48×10 7 Spores; LC for 10 days on spodoptera 3-instar larvae 50 Is 3.79×10 7 Spores; LC against 4-instar greedy larvae for 15 days 50 Is 3.98X10 7 Spores.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments will be briefly described below.
FIG. 1 is a morphology of Spodoptera frugiperda CT-WB 2022;
FIG. 2 is a Spodoptera frugiperda CT-WB2022 phylogenetic tree;
FIG. 3 is a graph showing the symptoms of death of Spodoptera frugiperda CT-WB2022 by infection of Spodoptera frugiperda larvae;
FIG. 4 is a graph showing the symptoms of death of Spodoptera frugiperda CT-WB2022 by Spodoptera frugiperda infection at other ages;
FIGS. 5 1-4 mortality results of Spodoptera frugiperda larvae infected with different concentrations of Spodoptera frugiperda microsporidian CT-WB 2022;
FIG. 6 shows the growth of corn in the different treatments of example 3.
Biological preservation information
Spodoptera frugiperda (Microsporidia) CT-WB2022 was deposited at the China general microbiological culture Collection center, address: the preservation number of the Beijing city Chaoyang area North Chen Xili No.1 and 3 is CGMCC No.24464.
Detailed Description
The invention provides spodoptera frugiperda CT-WB2022 with a preservation number of CGMCC No.24464.
In the invention, spodoptera frugiperda larvae are collected in corn fields in Tang county in Hebei province, and are subjected to indoor feeding for 2 generations, and are separated into spodoptera frugiperda microsporidian CT-WB2022 in the larvae in abnormal growth states. The ITS gene sequence of the Spodoptera frugiperda microsporidian CT-WB2022 is preferably shown in SEQ ID NO. 1: 5'-CGTTCCCAAGTGGTCTCCCTTCTTAGTACTGATTAAGCTCATACTGGTTTAACTTCGGAGTTCTGATGGGTTCCGGTGGGTTTCAGTAGATATGACCGTATCTGTTGAAATAAGTGTGTTGTTACAAGTATACCTACTTGATTTTATGAACATAAAAACTTCCCAAAACCACTTAGATTACATCTCTAAATATTAATTCTCTACACCTAGCCACACACACCTTTATAATCAATCAACTCATTTACCACATACATAAATTTAGCTAATAAACTTCCTTATATCACTCATTCTAAACCTCGTGAAGGTATTTTATATTTAGAACATAGACAAGATCATTATAATGTCAGCATACACTTTCATTATAATAATCCCATCTTTTTTTATTTATGATCCTGCTAATGGTTCTCCAACAGCAACCATGTTACGACTTATATCAGATCTAGTACTATCTATTCACTTTATAAATTTGTTCATAGATAATACCATCTTAGATAGCGACGGGCGGTGTGTACAAAGAACAGGGACTCATTCAATTCTACTTATTAAATAAAATTTACTAGCAATTCCATGTTCAAATATATCTTACATTATATTATCCCTTATAATATCAAATATTATTGTATTGCGCGTGCAACCCAGATTATCTTAGGGCATAACGGACCTGTTTT-3'. The Spodoptera frugiperda microsporidian CT-WB2022 has an oval shape, smooth surface and strong refraction, and the mature spore size is (3.20+/-0.24) mu m multiplied by (1.79+/-0.18) mu m. The low-age larva of spodoptera frugiperda is easy to be infected by the spodoptera frugiperda microsporidian CT-WB2022, the tail ends of the abdomen are slightly hooked after the larva dies, and the abdomen of some larva has blackening phenomenon, so that the body is soft; the abdomen of the older larva is swollen and enlarged after the Spodoptera frugiperda microsporidian CT-WB2022 is infected by the Spodoptera frugiperda, molting can not be completed or the molting is incomplete, the tail part has lesions, pupation can not be formed and the like; after the larvae pupate, the width of the pupae is large, the coating is incomplete, the pupae is exposed, bent, blackened, deformed and the like, and some larvae cannot emerge after pupae formation; the adults after pupa emergence cannot be completely separated from the pupa crust, wing deformity and the like. Through morphological and ITS sequence comparison analysis, a phylogenetic tree is constructed, and the microsporidian belongs to microsporidia, family of corpuscles and genus of corpuscles, has a relatively close relationship with the microsporidian of bombyx mori, and the similarity reaches more than 90%.
In the embodiment of the invention, the Spodoptera frugiperda microsporidian CT-WB2022 has a strong pathogenic effect on Spodoptera frugiperda larvae. LC for 5 days in 1-and 2-instar greedy larvae 50 2.51X10 respectively 7 spores/mL, 2.48X10 7 spores/mL; LC for 10 days on spodoptera 3-instar larvae 50 Is 3.79×10 7 spores/mL; LC against 4-instar greedy larvae for 15 days 50 Is 3.98X10 7 spores/mL; when the concentration of microsporidian is 1.0X10 8 spore/mL, 1-to 4-instar larvae were lethal (LT 50 ) 3.042d,3.858d,7.473d,10.428d, respectively.
The application of the Spodoptera frugiperda CT-WB2022 in controlling plant pests according to the physiological and biochemical characteristics of the Spodoptera frugiperda CT-WB2022 is also within the protection scope of the invention. The plants of the invention preferably comprise maize; the pest preferably comprises spodoptera frugiperda.
The invention also provides an insecticide comprising the Spodoptera frugiperda CT-WB2022. The book is provided withThe dosage form of the insecticide of the invention preferably comprises a suspension; the spore concentration of Spodoptera frugiperda microsporidian CT-WB2022 in the suspension is preferably 6.25X10 6 ～1.0×10 8 spores/mL, more preferably 7X 10 6 ～8×10 7 spores/mL, more preferably 1X 10 7 ～5×10 7 spores/mL. In the implementation process, the invention can be implemented in a range of 6.25X10 6 ～1.0×10 8 Any value within the spore/mL range, e.g., 1.0X10 8 spores/mL, 5X 10 7 spores/mL, 2.5X10 7 spores/mL, 1.25X10 7 spores/mL or 6.25X10 6 spores/mL.
The invention also provides a preparation method of the pesticide, which comprises the following steps:
and (3) infecting spodoptera frugiperda larvae by utilizing the spodoptera frugiperda microsporidian CT-WB2022, grinding to obtain spodoptera frugiperda homogenate, filtering to obtain spodoptera frugiperda tissue fluid, and separating to obtain the pesticide.
In the present invention, the means for infecting spodoptera frugiperda microsporidian CT-WB2022 with spodoptera frugiperda larvae preferably comprises: spraying the suspension of the Spodoptera frugiperda microsporidian CT-WB2022 on leaves for feeding or stirring with feed for feeding the Spodoptera frugiperda larvae; the spore number of Spodoptera frugiperda microsporidian CT-WB2022 in the suspension is 1.0X10 7 And each. The invention has no strict requirement on the source of the spodoptera frugiperda, and is obtained by routine purchase or laboratory preservation. In the implementation process of the invention, the spodoptera frugiperda is derived from a comprehensive protection laboratory of corn at the institute of plant protection, academy of sciences of agriculture and forestry in Hebei province.
In the present invention, the grinding is preferably performed using a mortar. The invention has no strict requirements on grinding strength and time, ensures that the grinding fluid is uniform and consistent, and has no large particles. After grinding, the spodoptera frugiperda homogenate is filtered. The filtering method of the invention preferably uses four layers of gauze, and the filtrate is collected to obtain spodoptera frugiperda tissue fluid.
The pesticide is obtained by separating spodoptera frugiperda tissue fluid. The separation mode according to the present invention preferably includes differential centrifugation and density gradient centrifugation which are sequentially performed. The differential centrifugation mode of the invention is preferably as follows: centrifuging at 500r/min for 2min, collecting supernatant, centrifuging at 2500r/min for 10min, discarding supernatant, adding sterilized water to resuspend microsporidian, and repeating the steps of centrifuging to collect supernatant, centrifuging to remove supernatant, adding sterilized water to resuspend for 3-4 times to obtain crude extract;
after the crude extract is obtained, the invention preferably carries out density gradient centrifugation on the crude extract to obtain pesticide mother liquor. The density gradient centrifugation of the present invention preferably comprises a Percoll discontinuous density gradient centrifugation method. After the pesticide mother liquor is obtained, the quantity of microsporidian is calculated by using a blood cell counting plate, and dilution treatment is carried out according to the requirement to obtain the pesticide with the required concentration.
The invention uses microsporidian tieback separated from spodoptera frugiperda in vivo to infect spodoptera frugiperda, the pesticide is prepared, has stronger pathogenicity to spodoptera frugiperda larvae of 1-4 ages, gradually increases the pathogenicity to the larvae along with the increase of the microsporidian spore concentration in the pesticide, and enriches biological control resources for controlling spodoptera frugiperda.
The technical solutions provided by the present invention are described in detail below with reference to the drawings and examples for further illustrating the present invention, but they should not be construed as limiting the scope of the present invention.
Example 1
1.1 isolation and purification of microsporidia
In 2021, in 8 months, spodoptera frugiperda larvae are collected in corn fields in Tang county, hebei province, 2 generations of culture are carried out, reference is made to Jiang Yiren and the like (Jiang Yiren, deng Zhenhua, wang Bayang and the like. The method for separating and purifying microsporidian spores of tussah is applied to the method [ J ]. Application of insect theory, 2011,48 (2): 5 ]) and spodoptera frugiperda larvae growing in abnormal states are placed in a mortar to be ground into homogenate, four layers of gauze are used for filtration, filtrate is collected into a 50mL centrifuge tube, the filtrate is subjected to a differential centrifugation method (after centrifugation for 2min at a rotating speed of 500r/min, supernatant is taken, centrifugation for 10min at a rotating speed of 2500r/min, supernatant is discarded, sterilized water is added after supernatant is discarded, steps of supernatant-centrifugation and supernatant-adding sterilized water resuspension are repeated for 3-4 times), crude separation is carried out, and the crude extract is purified by a Percoll density gradient centrifugation method, so that spore liquid containing parasites is obtained.
1.2 identification of parasites
1.2.1 morphological identification
The parasite isolated and purified in step 1.1 was designated CT-WB2022, and the isolated solution was diluted to a suitable magnification and observed under a 400-fold optical microscope, photographed, and observed for morphological structure, and the results are shown in FIG. 1. As can be seen from FIG. 1, the parasite is oval in shape, smooth in surface and strong in refractive index under an optical microscope, and mature spores are (3.20.+ -. 0.24) μm× (1.79.+ -. 0.18) μm in size.
The parasite CT-WB2022 was compared with the cultivated microsporidian (Nosema bombycis), the results are shown in Table 1 below.
TABLE 1 comparison of parasite CT-WB2022 against microsporidian form of silkworm
As can be seen from the description in Table 1, the parasites isolated and purified in step 1.1 are similar in shape to the microsporidian silkworm and are oval, but the individual parasites isolated and purified in step 1.1 are smaller.
1.2.2 molecular biological identification
Taking 500 mu L of spore liquid obtained by separation and purification in the step 1.1, centrifuging in a 1.5mL centrifuge tube at 6000r for 5min, removing supernatant, re-suspending sediment with 500 mu L of lysate, sucking and beating, uniformly mixing for 2-3 min, and then preserving heat for 2h at 65 ℃; adding 25 mu L of Proteinease K (20 mg/mL), shaking for 20-30 s, and preserving heat for 4h at 50 ℃; then, microsporidian DNA is extracted according to a CTAB DNA extraction kit and is preserved at the temperature of minus 20 ℃.
The microsporidian ITS gene was PCR amplified using the universal primers F3772 (SEQ ID NO.2: 5'-AAAACAGGTCCGTTATGC-3') and R4433 (SEQ ID NO.3: 5'-CGTTCCCAAGTGGTCTCC-3') for microsporidian, as follows: the ITS gene sequence obtained by the amplification is shown as SEQ ID NO.1 after 5min pre-denaturation at 95 ℃, 30s annealing at 54 ℃, 1min extension at 72 ℃,36 cycles and 10min extension at 72 ℃. The DL2000 DNA Marker is taken as a molecular weight standard, PCR reaction products are separated, recovered and purified by electrophoresis on 1% agarose gel, connected with pMD 19-T vector and transformed into competent cells, positive cloning plasmids are selected, bacterial liquid is identified, DNA sequencing is carried out, related microsporidian ITS gene sequences (accession numbers are JN882299.1, JF443682.1, JF443715.1, JF443668.1, MF150282.1, JF443684.1, JF443716.1, MF150285.1, JF443672.1, JF443706.1, EU350379.1 and FJ 772435.1) are collected from NCBI GenBank, homology Blast comparison is carried out, and the sequence of the microsporidian reaches more than 90% with the reported sequence corresponding to the silkworm microsporidian, and the microsporidian is identified as belonging to microsporidian. Homologous sequences were selected and compared in NCBI database using MEGA7.0 to obtain sequence downloads to construct phylogenetic tree, the results of which are shown in FIG. 2. The parasite CT-WB2022 obtained by separation and purification of the invention belongs to microsporidian and is similar to silkworm microsporidian.
Example 2
Pathogenicity study of Spodoptera frugiperda CT-WB2022 obtained in example 1 on Spodoptera frugiperda
1 test material
1.1 test insects:
spodoptera frugiperda is from the maize comprehensive defense laboratory of the institute of plant protection, academy of sciences of agriculture and forestry, hebei province.
1.2 test microsporidian:
feeding with 1.0X10 7 The microspore/mL of Spodoptera frugiperda CT-WB2022 suspension is sprayed on leaves for feeding or mixed with artificial feed for feeding Spodoptera frugiperda larvae to obtain Spodoptera frugiperda larvae infected with microsporidian, refer to Jiang Yiren et al (Jiang Yiren, deng Zhenhua, wang Bayang, et al, method for separating and purifying Spodoptera frugiperda spores [ J ]]Grinding Spodoptera frugiperda larva infected with microsporidian in mortar to obtain homogenate, filtering with four layers of gauze, collecting filtrate in 50mL centrifuge tube, separating the filtrate by differential centrifugation, purifying the crude extract by Percoll density gradient centrifugation, counting with hemocytometer, and placing in a containerPreserving at 4 ℃ for standby.
The isolated and purified microsporidian suspension was formulated into different spore concentration microsporidian suspensions (1.0X10) 8 Spores per mL, 5X 10 7 Spores per mL, 2.5X10 7 spores/mL, 1.25X10 7 Individual spores/mL and 6.25X10 6 Individual spores/mL), infecting larvae of spodoptera frugiperda at each age (1-4 ages), taking sterilized water as a control, respectively adding 0.3% Tween 80, placing corn leaves into microsporidian suspension, soaking for 10s, naturally airing, placing into a sterilized culture dish, inoculating 20 heads of test insects into each dish, repeating each treatment for 3 times, placing into a biochemical incubator with illumination at (25+/-1) DEG C and 16 hours, feeding for 24 hours, changing feed, normally feeding, counting the death number of the test insects every day, and calculating the death rate.
2. Analysis of results
2.1 Convolvulus praecox symptoms of microsporidian infection are shown in FIGS. 3 and 4, wherein FIG. 3 is the first hatched larva of spodoptera praecox of microsporidian and FIG. 4 is the elderly larva of spodoptera praecox of microsporidian. As can be seen from fig. 3 and 4, the low-age larvae of spodoptera frugiperda are easily infected by microsporidian, the tail ends of the abdomen are slightly hooked after the larvae die, and the abdomen of some larvae has blackening phenomenon, so that the body is soft; the abdomen of the spodoptera frugiperda larvae is swollen after being infected by microsporidia, the larvae are enlarged, the molting can not be finished or the molting is incomplete, the tail part has lesions, the pupation can not be formed and the like; after the larvae pupate, the width of the pupae is large, the coating is incomplete, the pupae is exposed, bent, blackened, deformed and the like, and some larvae cannot emerge after pupae formation; the adults after pupa emergence cannot be completely separated from the pupa crust, wing deformity and the like.
2.2 after treatment of spodoptera frugiperda larvae of 1 to 4 years old with the 5 concentration microsporidian suspension, the spodoptera frugiperda larva mortality results are shown in fig. 5. As can be seen from the view of FIG. 5, 1.0X10 8 The death rate of the larvae of 1 to 4 ages after 6 days can reach 96.67%, 90.00%, 25.00% and 15.00% respectively after spore/mL concentration treatment, and the microsporidian has stronger disease curing effect on the low-age larvae of spodoptera frugiperda. At 5X 10 7 spore/mL concentration treatment, mortality of 1-4 instar larvae after 6d, respectively93.33%, 90.00%, 33.33% and 8.33% of the total weight of the feed can be achieved, and the microsporidian has strong curative effect on the low-age larvae of spodoptera frugiperda. At 2.5X10 7 The death rate of the larvae of 1 to 4 ages after 7 days can reach 75.00 percent, 81.67 percent, 16.67 percent and 15.00 percent respectively after the spore/mL concentration treatment, and the microsporidian has stronger disease curing effect on the low-age larvae of spodoptera frugiperda. At 1.25X10 7 spores/mL and 6.25X10 6 The pathogenic effect of microsporidian on spodoptera frugiperda gradually weakens with decreasing concentration when spore/mL concentration is treated. However, over time, the cumulative mortality rate of spodoptera frugiperda larvae of 1 to 4 years of age gradually increased, at a microsporidian concentration of 10 6 ～10 8 Within the range, the final mortality of 1-year larvae reaches 100%; at a microsporidian concentration of 10 7 ～10 8 Within the range, the final death rate of 2-year-old larvae reaches 100%, and the concentration is 6.25X10 6 When the final death rate reaches 83.33%; final mortality of 3-instar larvae at 5 concentrations was 71.67%,81.67%,100%,100%,100%, respectively; final mortality of 4-instar larvae at 5 concentrations was 25.00%,66.67%,76.67%,91.67%,96.67%, respectively.
2.3 calculation of different microsporidian suspensions (6.25X10 6 spores/mL, 1.25X10 7 spores/mL, 2.50X10 7 spores/mL, 5.00×10 7 spores/mL and 1.00×10 8 spore/mL) on the time to death (LT) 50 ) LC was calculated 5 days before 1-2 instar larvae of Spodoptera frugiperda after infection with microsporidian 50 LC 10 days before 3 years of age 50 Values, LC50 values 15 days before 4 years old, the results are shown in tables 2 and 3.
TABLE 2 time to death of microsporidia against Spodoptera frugiperda larvae of various instar stages
TABLE 3 regression equation of microsporidian pathogenicity against Spodoptera frugiperda
Note that: LC (liquid Crystal) device 50 Obtained by spss25.0probit probability regression.
As can be seen from tables 2 and 3; as the concentration of microsporidian suspension increases, the time in death of spodoptera frugiperda larvae (LT 50 ) Shortening. The higher the spore concentration, the higher the LT of the larvae 50 The smaller the value, at 6.25X10 6 ～1.0×10 8 spore/mL range, 1-instar larva LT 50 LT from 12.780d to 3.042d, 2-instar larvae 50 LT from 19.542d down to 3.858d, 3-instar larvae 50 From 22.533d down to 7.473d; at 1.25X10 7 ～1.0×10 8 LT for 4-instar larvae in spore/mL range 50 From 19.598d down to 10.428d; it can also be seen that, with increasing age, the pathogenicity of microsporidian on spodoptera frugiperda larvae gradually decreases, when the microsporidian concentration is 1.0X10 8 In this case, the most virulent, LT against spodoptera frugiperda, 1-instar larvae 50 LT for 3.042d, 2-age larvae 50 LT for 3.858d, 3-instar larvae 50 LT for 7.473d, 4-instar larvae 50 10.428d; when the spore concentration was 6.25X10 6 At spores/mL, final mortality of 4-instar larvae was 25.00%, less than 50%, and LT could not be calculated 50 A value;
the lowest concentration in death of 1-and 2-instar larvae was 2.51X10, respectively 7 ，2.48×10 7 spores/mL, 3-instar larvae were lethal at a concentration of 3.79×10 after 10 days of feeding 7 spores/mL, after feeding for 15 days, the medium concentration in death is 3.98X10 7 . As age increases, the concentration of microsporidia in killing spodoptera frugiperda larvae increases and pathogenicity gradually decreases. Spodoptera frugiperda larvae of 1-4 years are susceptible to microsporidian infection, particularly 1-and 2-year-old larvae, and have reduced pathogenicity for 3-and 4-year-old larvae.
Example 3
(1) The suspension of Spodoptera frugiperda CT-WB2022 obtained in example 1 was diluted to 1X 10 with sterile water 7 spore/mL, adding trace amount of 0.01% Tween 20 (v/v) and 1% sucrose, and compoundingIs put into microsporidian suspension preparation for spray control of low-age larva of spodoptera frugiperda in corn field.
(2) Setting a field plot test in a corn field in a spodoptera littoralis retransmission area, dividing the field plot into 2 treatment areas and a control area, spraying the microsporidian CT-WB2022 suspending agent spray (treatment 1) in the step (1) in the treatment area, and spraying the 2000-time liquid spray (treatment 2) of the chemical pesticide 20% chlorantraniliprole suspending agent in the other treatment area; the control area was a blank control, and no reagent was sprayed (treatment 3). Each treatment was repeated 3 times with each repeat cell area of 100m 2 According to the preparation and use method of the preparation in the step (1), the spodoptera frugiperda is prevented and treated in the low-age larva stage, the number of insect population before and after prevention and treatment is investigated, 5 spots are repeatedly investigated each, 20 plants are used for each spot, and the reduction rate and the prevention and treatment effect of the insect population of each treatment are calculated according to the following formula. All test data were analyzed by Duncan's new complex polar error method to compare the significance of differences using SAS8.0 statistical software to calculate mean, standard deviation and single factor analysis of variance, and the test results are shown in Table 4 and FIG. 6.
Table 4 effects of CT-WB2022 formulations on field application
| Treatment mode | Rate of reduction of insect population% | Preventing and curing effect is% |
| CT-WB2022 suspension spray | 67.18±4.68a | 78.30±2.30a |
| Chlorantraniliprole spray | 69.50±0.53a | 79.82±0.17a |
As can be seen from table 4 and fig. 6, the spraying treatment of CT-WB2022 suspension and chlorantraniliprole as chemical agent showed that corn grew well, the fall off rate of spodoptera frugiperda was 67.18% and 69.50%, the control effect was 78.30% and 79.82%, the control effect of CT-WB2022 and chlorantraniliprole spraying on spodoptera frugiperda was good and the difference was not significant.
The spodoptera frugiperda microsporidian CT-WB2022 can prolong the development and inhibit the growth of spodoptera frugiperda larvae, and has a strong pathogenic effect on spodoptera frugiperda larvae.
Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Sequence listing
<110> institute of plant protection at academy of sciences of agriculture and forestry in Hebei province
<120> a Spodoptera frugiperda microsporidian CT-WB2022 and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 668
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cgttcccaag tggtctccct tcttagtact gattaagctc atactggttt aacttcggag 60
ttctgatggg ttccggtggg tttcagtaga tatgaccgta tctgttgaaa taagtgtgtt 120
gttacaagta tacctacttg attttatgaa cataaaaact tcccaaaacc acttagatta 180
catctctaaa tattaattct ctacacctag ccacacacac ctttataatc aatcaactca 240
tttaccacat acataaattt agctaataaa cttccttata tcactcattc taaacctcgt 300
gaaggtattt tatatttaga acatagacaa gatcattata atgtcagcat acactttcat 360
tataataatc ccatcttttt ttatttatga tcctgctaat ggttctccaa cagcaaccat 420
gttacgactt atatcagatc tagtactatc tattcacttt ataaatttgt tcatagataa 480
taccatctta gatagcgacg ggcggtgtgt acaaagaaca gggactcatt caattctact 540
tattaaataa aatttactag caattccatg ttcaaatata tcttacatta tattatccct 600
tataatatca aatattattg tattgcgcgt gcaacccaga ttatcttagg gcataacgga 660
cctgtttt 668
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
aaaacaggtc cgttatgc 18
<210> 3
<211> 18
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
Claims (9)
1. Spodoptera frugiperda microsporidianMicrosporidia) CT-WB2022, characterized in that the preservation number of the Spodoptera frugiperda microsporidian CT-WB2022 is CGMCC No.24464.
2. An insecticide comprising Spodoptera frugiperda CT-WB2022 according to claim 1.
3. The insecticide of claim 2, wherein the insecticide dosage form comprises a suspension.
4. A pesticide according to claim 3, wherein the spore concentration of Spodoptera frugiperda microsporidian CT-WB2022 in the suspension is 6.25 x 10 6 ～1.0×10 8 Individual spores/mL.
5. A method of preparing an insecticide according to any one of claims 2 to 4, comprising the steps of:
infecting spodoptera frugiperda larvae with the spodoptera frugiperda microsporidian CT-WB2022 according to claim 1, grinding to obtain spodoptera frugiperda homogenate, and filtering to obtain spodoptera frugiperda tissue fluid; the spodoptera frugiperda tissue fluid contains the pesticide.
6. The method of claim 5, wherein the means for infecting spodoptera frugiperda microsporidian CT-WB2022 with spodoptera frugiperda larvae comprises: spraying the suspension of the Spodoptera frugiperda microsporidian CT-WB2022 on leaves for feeding or stirring with feed for feeding the Spodoptera frugiperda larvae; the spore number of Spodoptera frugiperda microsporidian CT-WB2022 in the suspension is 1.0X10 7 individual/mL;
four layers of gauze were used for the filtration.
7. The method of manufacturing according to claim 5, further comprising: separating the spodoptera frugiperda tissue fluid to obtain an insecticide; the separation includes differential centrifugation and density gradient centrifugation.
8. Use of the insecticide of claim 1, spodoptera frugiperda CT-WB2022 or any of claims 2-4 or the insecticide obtained by the preparation method of any of claims 5-7 in plant pest control;
the pest is spodoptera frugiperda.
9. The use of claim 8, wherein the plant comprises corn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210552495.3A CN114806885B (en) | 2022-05-19 | 2022-05-19 | Spodoptera frugiperda microsporidian CT-WB2022 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210552495.3A CN114806885B (en) | 2022-05-19 | 2022-05-19 | Spodoptera frugiperda microsporidian CT-WB2022 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114806885A CN114806885A (en) | 2022-07-29 |
| CN114806885B true CN114806885B (en) | 2023-06-23 |
Family
ID=82518212
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210552495.3A Active CN114806885B (en) | 2022-05-19 | 2022-05-19 | Spodoptera frugiperda microsporidian CT-WB2022 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114806885B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115147837B (en) * | 2022-08-16 | 2023-10-27 | 河北省农林科学院植物保护研究所 | Athetis lepigone feeding method and system based on optical image recognition |
| CN115851451B (en) * | 2022-10-08 | 2023-07-11 | 中国农业大学 | Spodoptera frugiperda microspores, application thereof and artificial propagation method |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP3458159B2 (en) * | 1997-05-14 | 2003-10-20 | 独立行政法人農業生物資源研究所 | Method for producing microsporidian spores |
| CN108913720A (en) * | 2018-08-20 | 2018-11-30 | 西南大学 | A kind of carrier and method of eukaryon soluble-expression Bm cell line pole pipe glycoprotein |
| CN115851451B (en) * | 2022-10-08 | 2023-07-11 | 中国农业大学 | Spodoptera frugiperda microspores, application thereof and artificial propagation method |
-
2022
- 2022-05-19 CN CN202210552495.3A patent/CN114806885B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114806885A (en) | 2022-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114806885B (en) | Spodoptera frugiperda microsporidian CT-WB2022 and application thereof | |
| CN114317289B (en) | Beauveria bassiana Bbsfa202007 strain and application thereof | |
| CN112342199B (en) | Spodoptera frugiperda virus-resistant pesticide production strain and preparation method and application thereof | |
| Rao et al. | Role of nucleopolyhedroviruses (NPVs) in the management of lepidopteran pests in Asia | |
| CN112746025A (en) | Beauveria bassiana preparation as well as preparation method and use method thereof | |
| CN113684136B (en) | Broad-spectrum insecticidal beauveria bassiana strain and application thereof | |
| CN112812976B (en) | Metarhizium laevigatum CDTLJ1 and application thereof | |
| CN112646735B (en) | Metarhizium anisopliae, microbial insecticide, preparation method and application | |
| CN115851451B (en) | Spodoptera frugiperda microspores, application thereof and artificial propagation method | |
| CN111662829A (en) | Metarhizium anisopliae CHMA-005 and application thereof in prevention and control of tea geometrid | |
| CN108148817B (en) | A kind of Strain with prevention and treatment beet armyworm function | |
| CN113308385B (en) | Isaria javanicus strain DMC01 and application thereof in prevention and treatment of locusta migratoria in east Asia | |
| CN109207489B (en) | Curvularia gigas strain and application thereof | |
| CN108179123B (en) | Serratia marcescens from morbid bodies of agriophloa baishanensis and application thereof | |
| CN114958622B (en) | Metarhizium anisopliae and application thereof in preventing and treating tea lissajous | |
| CN115838637B (en) | Entomogenous fungi and fermentation method and application thereof | |
| CN112358973B (en) | Baccharomycosis strain and application thereof | |
| CN114847243B (en) | Method for obtaining BmNPV disease pupae by feeding late-stage 5-year-old virus-inoculated silkworms or puncturing and virus-inoculated silkworms | |
| CN117987281B (en) | Beauveria bassiana Bbzy230628 strain and application thereof | |
| Goswami et al. | Trichogramma: An egg parasitoid in insect pest management | |
| CN109628325B (en) | Aspergillus versicolor HY12 strain | |
| CN115074258A (en) | Beauveria bassiana Bals-1722 and application thereof | |
| Pokhrel et al. | First Report of Metarhizium Rileyi Infecting Fall Army Worm Spodoptera Frugiperda (JE Smith) From Nepal | |
| JPH09215499A (en) | Production of useful protein and silkworm used therefor | |
| CN117660202A (en) | Aspergillus peak Aspergillus nomius and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |