CN114806762B - A method to reduce and control the production of isoamyl alcohol during liquor fermentation by regulating sugar consumption rate - Google Patents

Abstract

The invention discloses a method for reducing and controlling the production of isoamyl alcohol during the fermentation process of liquor by regulating the sugar consumption rate, and belongs to the technical field of liquor processing. The present invention proves that reducing the sugar consumption rate in the fermentation process is an effective method through different means of regulating the yeast sugar consumption rate (such as increasing the initial concentration of Saccharomyces cerevisiae in the fermented grains, reducing the initial fermentation temperature or reducing the glucoamylase activity of Daqu). Method to reduce isoamyl alcohol synthesis during liquor fermentation. The present invention uses Daqu with low glucoamylase activity for fermentation, which reduces the sugar consumption rate of the fermentation system by 40.3% and the isoamyl alcohol content by 13.3%. It is of great significance for reducing the production of isoamyl alcohol during the fermentation process of liquor and improving the quality of liquor. .

Description

A method to reduce and control the production of isoamyl alcohol during liquor fermentation by regulating sugar consumption rate

Technical field

The invention relates to a method for reducing and controlling the production of isoamyl alcohol during liquor fermentation by regulating sugar consumption rate, and belongs to the technical field of liquor processing.

Background technique

Isoamyl alcohol is an important component of higher alcohols in liquor produced by microbial metabolism during the fermentation process. Isoamyl alcohol contributes to the flavor of liquor to a certain extent, but its concentration is too high, which may cause the liquor to have an off-flavor and may produce certain toxic effects. To ensure the flavor of liquor while improving the comfort of drinking liquor, it is necessary to control the isoamyl alcohol content in liquor within an appropriate range (less than 35mg/100mL).

The liquor fermentation system is an open fermentation system involving multiple bacterial species. The synthesis of isoamyl alcohol is not only related to the amino acid metabolism of yeast, but also affected by various environmental factors. At present, there are three main aspects to reduce the synthesis of isoamyl alcohol during the liquor fermentation process: 1. Breeding yeasts with low synthesis of isoamyl alcohol to reduce the synthesis of isoamyl alcohol from the source. Yeast that has a control-reducing effect in the corresponding simulated fermentation system can be obtained by means of genetic engineering, mutagenesis and breeding, isolation and purification of excellent natural strains. However, genetically engineered bacteria are currently not suitable for use in food fermentation, and the control-reducing effects of other strains obtained through breeding in mixed-bacteria fermentation systems have not yet been verified. 2. Reduce yeast proliferation. The commonly used method is to add active dry yeast, but the commercial active dry yeast commonly used for addition is alcoholic yeast, which can easily lead to uncoordinated flavors of liquor. 3. Optimize fermentation conditions. The unbalanced carbon and nitrogen sources provided by the fermentation process system and inappropriate fermentation temperature will cause a large amount of isoamyl alcohol to be synthesized. By increasing the nitrogen source, adding protease enzyme preparations, and adjusting the fermentation temperature, the reducing effect of isoamyl alcohol can be achieved. However, these Methods are all specific and will produce different effects in different fermentation systems, sometimes even leading to an increase in isoamyl alcohol content. Therefore, a new method to reduce the synthesis amount of isoamyl alcohol in fermentation systems is needed.

Contents of the invention

The purpose of the present invention is to solve the problem of excessive synthesis of isoamyl alcohol during the fermentation process of liquor and to provide a method for reducing and controlling the production of isoamyl alcohol.

The invention provides a method for reducing the synthesis amount of isoamyl alcohol in the fermented grains of liquor. The method is to regulate the sugar consumption rate during the fermentation process of the fermented grains to make the sugar consumption rate ≤ 15.4g/(kg·d).

In one embodiment, the method is to control the sugar consumption rate on the 1st to 3rd days of fermentation of the fermented grains, so that the sugar consumption rate in this time period is between 8.7 and 15.4g/(kg·d).

In one embodiment, the regulation of the sugar consumption rate of the fermented grains includes, but is not limited to, adding Saccharomyces cerevisiae to the fermented grains, lowering the tank entry temperature, gradient temperature-controlled fermentation, or Daqu fermentation with low saccharifying enzyme activity.

In one embodiment, the addition of Saccharomyces cerevisiae JP3 is to add Saccharomyces cerevisiae JP3 to the fermented grains in the tank at the beginning of fermentation, and ferment at a constant temperature of 30°C; the Saccharomyces cerevisiae JP3 has been disclosed in the paper " Analysis of the Ability and Pathway of Synthetic Isoamyl Alcohol by Yeast Sourced from Liquor Grain.

In one embodiment, the addition of Saccharomyces cerevisiae is the addition of Saccharomyces cerevisiae seed liquid; the seed liquid is obtained by inoculating Saccharomyces cerevisiae JP3 into YPD medium and culturing it with shaking at 30°C and 220 r/min.

In one embodiment, the Saccharomyces cerevisiae JP3 is inoculated into the fermented grains in the pond at a concentration of 5×10 ⁶ to 5×10 ⁷ CFU/g fermented grains.

In one embodiment, the Saccharomyces cerevisiae JP3 is inoculated into the wine grains in the pond at a concentration of 5×10 ⁷ CFU/g wine grains.

In one embodiment, the fermented wine grains that are put into the pool are Daqu and fermented wine grains that are fully mixed at a ratio of 1:16 (W/W).

In one embodiment, the liquor includes solid-state fermented liquor.

In one embodiment, reducing the initial fermentation temperature is to control the initial fermentation temperature to 16°C to 22°C.

In one embodiment, the gradient temperature-controlled fermentation adopts a gradient programmed temperature rising method to perform temperature rising fermentation, specifically: within 2 days of the start of fermentation, the control temperature is 18-22°C, and the 3rd to 6th day of fermentation is carried out every day on the previous day. The fermentation temperature was increased by 2°C; after 7 days of fermentation, the temperature was controlled to 30°C.

In one embodiment, the gradient temperature-controlled fermentation adopts a gradient programmed temperature-raising method to perform temperature-raising fermentation, specifically: within 2 days of the start of fermentation, the control temperature is 18°C, and the temperature is controlled to 20°C every day on the 3rd to 6th days of fermentation. ℃, 22℃, 24℃, 26℃; after 7 days of fermentation, the temperature is controlled to 30℃.

In one embodiment, the glucoamylase activity of Daqu with low glucoamylase activity is lower than 250 U/g.

In one embodiment, the Daqu with low glucoamylase activity is obtained by extending the storage time of Daqu, and the glucoamylase enzyme activity is 200-250 U/g.

The invention also provides the application of the method in the fermentation of wine grains or the production of alcoholic beverages with low isoamyl alcohol content.

Beneficial effects:

The present invention provides a new method for reducing the isoamyl alcohol content in the fermentation process of liquor by regulating the sugar consumption rate of yeast, reducing the sugar consumption rate during the isoamyl alcohol synthesis period from 21.4g/(kg·d) to 15.4g. /(kg·d) or less, the synthesis amount of isoamyl alcohol is reduced by more than 13.3%. The present invention proves that reducing the sugar consumption rate in the fermentation process is an effective method through different means of regulating the yeast sugar consumption rate (such as increasing the initial concentration of Saccharomyces cerevisiae in the fermented grains, reducing the initial fermentation temperature or reducing the glucoamylase activity of Daqu). A method to reduce the synthesis of isoamyl alcohol during the fermentation process of liquor is of great significance for reducing the production of isoamyl alcohol during the fermentation process of liquor and improving the quality of liquor.

Description of the drawings

Figure 1 shows the quantitative analysis results of Saccharomyces cerevisiae in fermented wine grains; a: Saccharomyces cerevisiae-specific primer verification; b: Counting yeast on a Bengal red plate; c: Analysis of the number of Saccharomyces cerevisiae in b by colony PCR method; among them, SC: Saccharomycescerevisiae , Saccharomyces cerevisiae, KH: Kazachstania humilis, NC: Naumovozymacastelli, ND: Naumovozyma dairenensis, TD: Torulaspora delbrueckii, PF: Pichia fermentans, Pichia fermentans, PK: Pichia kudriavzevii, Pichia pastoris; C: Saccharomyces cerevisiae control, "+" means Saccharomyces cerevisiae, "-" means non-Saccharomyces cerevisiae.

Figure 2 shows the effect of adding different concentrations of Saccharomyces cerevisiae JP3 on the production of isoamyl alcohol; a: the effect of adding different concentrations of Saccharomyces cerevisiae JP3 on the growth of Saccharomyces cerevisiae in fermented grains; b: the effect of adding different concentrations of Saccharomyces cerevisiae JP3 on the consumption of reducing sugar in fermented grains. Effect; c: Effect of adding different concentrations of Saccharomyces cerevisiae JP3 on the production of isoamyl alcohol; among them, SC 5×10 ⁵ , SC 5×10 ⁶ , and SC 5×10 ⁷ respectively refer to the final concentration of 5×10 ⁵ CFU·g. ^-1 , 5×10 ⁶ CFU·g ^-1 , 5×10 ⁷ CFU·g ^-1 Saccharomyces cerevisiae JP3.

Figure 3 shows the effect of initial fermentation temperature on the production of isoamyl alcohol; a: the effect of initial fermentation temperature on the growth of Saccharomyces cerevisiae in fermented grains; b: the effect of initial fermentation temperature on the consumption of reducing sugars in fermented grains; c: initial Effect of fermentation temperature on isoamyl alcohol production.

Figure 4 shows the effect of Daqu saccharifying enzyme activity on the production of isoamyl alcohol; a: The effect of Daqu saccharifying enzyme activity on the growth of Saccharomyces cerevisiae in fermented grains; b: The effect of Daqu glucoamylase activity on the consumption of reducing sugar in fermented grains; c: Daqu saccharification The effect of enzyme activity on the production of isoamyl alcohol; Daqu 1 is a Daqu with high glucoamylase activity, Daqu 2 is a Daqu with medium glucoamylase activity, and Daqu 3 is a Daqu with low glucoamylase activity.

Figure 5 shows the effect of regulating the sugar consumption rate during non-fermentation 1 to 3 days on the production of isoamyl alcohol; a: The effect of adding Daqu in batches and adding yeast after fermentation on the proliferation of Saccharomyces cerevisiae in the fermented grains; b: Adding Daqu in batches and fermentation The effect of adding yeast later on the consumption of reducing sugars in the fermented grains; c: The effect of adding Daqu in batches and adding yeast after fermentation on the production of isoamyl alcohol.

Detailed ways

YPD medium: peptone 20g/L, yeast extract 10g/L, glucose 20g/L.

Bengal solid medium: peptone 5g/L, glucose 10g/L, potassium dihydrogen phosphate 1g/L, magnesium sulfate heptahydrate 0.5 g/L, 1/3000 Bengal solution 100mL/L, chloramphenicol 0.1g/L , agar 20g/L

Put the grains (sorghum, wheat, corn, rice, glutinous rice) into the pond in a ratio of 4.5 parts sorghum, 2 parts rice, 1.5 parts glutinous rice, 1 part wheat, 1 part corn and crush them with the fermented wine grains. Mix and steam the wine together with a mass ratio of 1: (2.7~3.7), take the wine and let it cool, add slurry water, control the temperature, add 1/16 of medium-temperature Daqu (W/W) and mix well, which is the fermented rice wine. . The number of Saccharomyces cerevisiae in medium-temperature Daqu is 10 ² -10 ³ CFU/g, the total bacteria is 5×10 ⁶ -5×10 ⁷ CFU/g, and the total mold number is 1×10 ³ to 5×10 ³ CFU/g.

Determination of the viable count of Saccharomyces cerevisiae: Accurately weigh 5.0g of fermented wine and place it in a shake flask (containing glass beads) containing 95 mL of physiological saline. Place it in a shaker and shake for 30 minutes. Take the supernatant and perform gradient dilution. Apply it to a Bengal red plate and culture it at 30°C for 1 to 2 days. Saccharomyces cerevisiae populations were counted after verification by PCR on the non-Pichia colonies in Figure 1 . The specific primers used for amplification were SC2F (GGCCAGGTTCTTGTAGCCAA) and SC2R (GCTTCCCTGAGATCGCTTCT). The specific operation is as follows: pick colonies into a PCR tube containing 10 μL ddH2O, add 5 μL 50U/μL helicase and mix well, take a 37°C water bath for 10 minutes and then place it in -80°C for 30 minutes. Take the upper liquid as template DNA for PCR. The PCR amplification system contains: 12.5 μL 2×Taq PlusMaster Mix, 1 μL each of upstream and downstream primers, 3 μL template DNA and 7.5 μL ddH ₂ O. PCR conditions were as follows: denaturation at 94°C for 5 min; 30 cycles of 94°C for 30 s, 63°C for 15 s, and 72°C for 15 s; and extension at 72°C for 5 min. The product was detected by gel electrophoresis, and the colony with a PCR product of 235 bp was recorded as Saccharomyces cerevisiae.

Determination of reducing sugar in fermented grains and estimation of apparent sugar consumption rate: Accurately weigh 10g of fermented fermented grains, add 20 mL of ultrapure water, ultrasonicate in an ice bath for 30 min, centrifuge at 10 000 r/min for 5 min at 4°C, and take the supernatant for detection and analysis. . Use the DNS method to detect the reducing sugar content, and use the following formula to estimate the apparent reducing sugar consumption rate:

Sugar consumption rate (g/(kg·d))=(m ₀ +m ₁ -m ₂ )/t;

In the formula, m ₀ : the initial reducing sugar content in the fermented rice wine, g/kg; m ₁ : the highest reducing sugar content corresponding to the investigation time range, g/kg; m ₂ : the lowest reducing sugar content corresponding to the investigation time range, g/kg; t: fermentation time, d.

Determination of isoamyl alcohol content in fermented wine grains: Accurately weigh 10g of fermented wine grains, add 20 mL of ultrapure water, ultrasonicate in an ice bath for 30 min, centrifuge at 10 000 r/min for 5 min at 4°C, and take the supernatant for detection and analysis. Take 5 mL of the sample to be tested, add tert-amyl alcohol with a final concentration of 6 mg/L, and use headspace-gas chromatography-hydrogen ion flame detector to detect the isoamyl alcohol content. The chromatographic column is DB-Wax (30.0m×0.32mm×0.25μm), the equilibrium temperature is 70°C, and the equilibrium time is 35 minutes. The inlet temperature is 200°C, the detector temperature is 260°C, and the split ratio is 3:1. Temperature rising program: initial temperature is 40°C, maintained for 5 minutes, then raised to 180°C at a rate of 10°C/min and maintained for 5 minutes. Use nitrogen as carrier gas with a flow rate of 9 mL/min.

Example 1: Adding Saccharomyces cerevisiae to regulate sugar consumption rate and reduce isoamyl alcohol

Inoculate Saccharomyces cerevisiae JP3 (this strain is isolated from strong-flavor fermented grains and has been published in the paper "Analysis of the Isoamyl Alcohol Synthesis Ability and Pathway of Yeast Originated from Liquor Grain") into YPD culture medium, and inoculate it at 30°C and 220r/min. Incubate with shaking for 16 to 18 hours, then centrifuge the culture solution at 5000r/min to remove the bacterial cells, wash them twice with sterile physiological saline, and resuspend in sterile physiological saline to prepare a bacterial suspension. Absorb a certain amount of bacterial liquid to make a 4mL bacterial suspension. Inoculate the final concentration of 5×10 ⁵ , 5×10 ⁶ , and 5×10 ⁷ CFU/g to 250g into the fermented rice wine. Mix thoroughly. Put it into a 500mL wide-mouth bottle and seal it for fermentation at 30°C. The fermented grains without Saccharomyces cerevisiae JP3 and fermented under the same conditions were used as a control. On days 0, 1, 2, 3, 5, 7, and 10 days of fermentation, the fermented grains were taken to measure the number of viable Saccharomyces cerevisiae, reducing sugar content and isoamyl alcohol content of the fermented grains.

The results show that in the simulated fermentation system, the synthesis period of isoamyl alcohol is from 1st to 7th day. Compared with the control group without adding Saccharomyces cerevisiae JP3, the fermented grains with a final concentration of 5×10 ⁷ CFU/g were added with Saccharomyces cerevisiae JP3. The proliferation multiple of Saccharomyces cerevisiae decreased from 5.3 to 1.3. The apparent sugar consumption rate of fermentation for 1 to 3 days was 13.9g/(kg·d), which was 42.3% lower than the control. The synthesis amount of isoamyl alcohol in the fermented grains fermented for 7 days was similar. It was 22.9% lower than the control, and the ethanol yield in the fermented wine grains was 5.2 mL/100g, which was no significant difference compared with the control. The apparent sugar consumption rates of the fermented grains added with final concentrations of 5×10 ⁵ CFU/g and 5×10 ⁶ CFU/g Saccharomyces cerevisiae JP3 are 26.6g/(kg·d) and 21.2g/(kg·d) respectively. There was little difference with the control group (24.2g/(kg·d)), with no control reduction effect, and the ethanol yield was 5.7mL/100g, which was 10% higher than that of the control group.

Example 2: Adjust the initial fermentation temperature to regulate sugar consumption rate and reduce isoamyl alcohol.

Take 250g of fermented wine and put it into 500mL wide-mouth bottles. Using 18, 22, 26, and 30°C as the starting fermentation temperatures, static fermentation was carried out according to the gradient temperature rising program (Table 1). Natural fermentation at 30°C was used as a control. The fermented grains fermented on days 0, 1, 2, 3, 5, 7, 10, and 13 were taken to determine the number of viable Saccharomyces cerevisiae and the reducing sugar content of the fermented grains. The fermented grains fermented for 7 days were taken to determine the isoamyl alcohol content.

Using 18°C as the starting fermentation temperature can reduce the proliferation rate of Saccharomyces cerevisiae in the fermented grains from 2.1 to 1.5. The apparent sugar consumption rate within 2 days after the start of fermentation is 8.7g/(kg·d), which is higher than that starting at 26°C. The fermentation rate was reduced by 59.4%, and the amount of isoamyl alcohol synthesized at 7 days was reduced by 22.6%. Compared with the fermented grains that started fermentation at 26°C, the ethanol content in the fermented grains that started fermenting for 7 days at the other three temperatures was 6.0-6.6mL/100g, which increased by 23.7%-36.1% compared with the control.

Table 1 Fermentation temperature gradients and corresponding sugar consumption rates of different groups

Note: “-” indicates that no sampling measurement was performed.

Example 3: Using Daqu with different glucoamylase activities to regulate sugar consumption rate and reduce isoamyl alcohol

Take three kinds of Daqu with different glucoamylase activities (high, medium and low glucoamylase activities are 388.7U/g, 306.1U/g and 228.5 U/g respectively), and add them according to the addition amount of 1/16 (W/W). Mix the fermented grains, weigh 250g into a 500mL wide-mouth bottle, and leave to ferment at 30°C. The fermented grains of 0, 1, 2, 3, 5, 7, 10, and 13 days were taken to measure the viable count of Saccharomyces cerevisiae and the reducing sugar content of the fermented grains, and the fermented grains of 7 days of fermentation were taken to determine the isoamyl alcohol content.

The results showed that the apparent sugar consumption rate of Daqu with low glucoamylase activity was 15.4g/(kg·d) 2 days before fermentation, which was 40.3% lower than that of Daqu with high glucoamylase activity. The amount of isoamyl alcohol synthesized at 7 days was reduced by 13.3%. . The apparent sugar consumption rates within 2 days of fermentation using Daqu with high glucoamylase activity and Daqu with medium glucoamylase activity were 25.7 and 16.8 g/(kg·d) respectively. The apparent sugar consumption rate of Daqu with medium glucoamylase activity was 34.8 lower than the control. %, and the isoamyl alcohol content is 10.3% lower. Compared with Daqu with high glucoamylase activity, the ethanol content in the fermented wine grains fermented by Daqu with medium glucoamylase activity and Daqu with low glucoamylase activity increased by 6.2% and 0.6% respectively, and their contents ranged from 4.8 to 5.1mL/100g. time, no significant difference.

Comparative Example 1 Add low-activity Daqu to reduce isoamyl alcohol in batches

The mass ratio of low-activity Daqu (glucoamylase activity 243.1U/g) and fermented wine grains is 1:16; divide the Daqu into two parts equally by mass, and mix one part of Daqu and fermented fermented wine grains at a mass ratio of 1:32. Put 250g into a 500mL wide-mouth bottle, seal and ferment at 30°C. After fermentation for 3 days, add another portion of Daqu and mix evenly.

The results showed that the reducing sugar consumption rate of the fermented grains with low-activity Daqu added in batches was 11.3g/(kg·d) 3 days before fermentation, and the sugar consumption rate for 3 to 5 days of fermentation was 2.3g/(kg·d). The alcohol content is 20.2mg/kg, and the ethanol content in the fermented wine grains is 5.7 mL/100g.

Comparative Example 2 Add Saccharomyces cerevisiae JP3 to reduce isoamyl alcohol on the 2nd to 3rd day of fermentation.

Mix the high-activity Daqu (glucoamylase activity 523.2U/g) and fermented wine grains at a mass ratio of 1:16, then divide the mixture into wide-mouth bottles at 250g/500mL, and place it at 30°C for sealed fermentation. On the 2nd and 3rd days of fermentation, Saccharomyces cerevisiae JP3 was added to make the concentration of this strain in the fermented grains 5×10 ⁶ CFU/g. After mixing evenly, the sealed fermentation was continued at 30°C.

The results showed that the reducing sugar consumption rate was 11.5g/(kg·d) 3 days before fermentation, the sugar consumption rate from 3 to 5 days of fermentation was 12.2 g/(kg·d), and the isoamyl alcohol content was 25.8 mg/kg. This shows that adding Saccharomyces cerevisiae on the 2nd to 3rd day of fermentation has no effect on isoamyl alcohol reduction, and the ethanol content in the fermented wine grains is 5.8mL/100g.

Comparative Example 3 Application of Daqu Fermentation with High Glucoamylase Activity

Mix high-activity Daqu (glucoamylase activity 523.2U/g) and fermented grains at a mass ratio of 1:16 as fermented fermented grains. The fermented grains were taken on the 0th, 1st, 2nd, 3rd, 5th, 7th, and 10th days of fermentation to determine the number of viable Saccharomyces cerevisiae, the reducing sugar content of the fermented grains, and the isoamyl alcohol content on the 7th day of fermentation. The results showed that the reducing sugar consumption rate 3 days before fermentation was 12.7g/(kg·d), the sugar consumption rate for 3 to 5 days of fermentation was 16.2g/(kg·d), and the isoamyl alcohol content was 20.2mg/kg. The fermented wine The ethanol content in the fermented grains is 5.6mL/100g.

Although the present invention has been disclosed above in terms of preferred embodiments, they are not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, The protection scope of the present invention should be defined by the claims.

Claims (4)

1. A method for reducing the synthesis amount of isoamyl alcohol in the fermented grains of liquor, which is characterized in that the sugar consumption rate on the 1st to 3rd day of the fermentation process of the fermented grains is controlled so that the sugar consumption rate is 8.7~15.4g/(kg·d ); the regulation of sugar consumption rate in the fermentation process of fermented grains includes adding Saccharomyces cerevisiae to the fermented grains, lowering the temperature of entering the tank, gradient temperature control fermentation, or using Daqu fermentation with low glucoamylase activity; the adding of Saccharomyces cerevisiae means adding Saccharomyces cerevisiae to the fermented grains. Yeast JP3; The gradient temperature-controlled fermentation is within 2 days of the start of fermentation, and the control temperature is 18~22°C. On the 3rd to 6th days of fermentation, the fermentation temperature is increased by 2°C every day based on the fermentation temperature of the previous day; after 7 days of fermentation, the control temperature is 30℃; The addition of Saccharomyces cerevisiae is to add Saccharomyces cerevisiae JP3 at a concentration of 5×10 ⁶ to 5×10 ⁷ CFU/g of fermented grains at the beginning of fermentation; The glucoamylase activity of the low glucoamylase activity Daqu is lower than 250 U/g; The lowering of the temperature into the pool is to control the initial fermentation temperature to 18~22°C. 2. The method according to claim 1, characterized in that the Daqu with low glucoamylase activity and fermented wine grains are mixed at a mass ratio of 1:16. 3. Application of the method of claim 1 or 2 in fermentation of fermented wine grains. 4. Application of the method according to any one of claims 1 to 3 in the production of alcoholic beverages with low isoamyl alcohol content.