CN114790430A

CN114790430A - Lactobacillus rhamnosus E2 for producing hyaluronic acid and application thereof

Info

Publication number: CN114790430A
Application number: CN202210394834.XA
Authority: CN
Inventors: 郑康帝; 马燕; 刘彦; 陈涛; 张召
Original assignee: Guangdong Longsee Medical Technology Co ltd; Foshan Langxin Biotechnology Co ltd
Current assignee: Guangdong Longsee Medical Technology Co ltd; Foshan Langxin Biotechnology Co ltd
Priority date: 2022-04-14
Filing date: 2022-04-14
Publication date: 2022-07-26
Anticipated expiration: 2042-04-14
Also published as: CN114790430B

Abstract

The invention discloses a lactobacillus rhamnosus E2 strain for producing hyaluronic acid and application thereof, belonging to the technical field of microorganisms. The lactobacillus rhamnosus E2 for producing hyaluronic acid disclosed by the invention has the preservation number of CGMCC No.21770, and can produce hyaluronic acid under the fermentation condition. The fermentation supernatant and bacterial suspension of the lactobacillus rhamnosus E2 disclosed by the invention can obviously reduce the level of active oxygen in the zebra fish body and obviously improve the activity of superoxide dismutase in the zebra fish body in an in vivo oxidative stress model, and have the potential of resisting oxidation and delaying senescence when being applied to the body; and the zebra fish tail fin damage repair can be remarkably promoted in a zebra fish damage model, and the potential of promoting tissue damage repair is shown. The lactobacillus rhamnosus E2 disclosed by the invention has great potential application prospects in the aspects of resisting oxidation, delaying senescence and promoting tissue damage repair.

Description

Lactobacillus rhamnosus E2 for producing hyaluronic acid and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a lactobacillus rhamnosus E2 strain for producing hyaluronic acid and application thereof.

Background

Hyaluronic Acid (HA), also known as hyaluronic acid, is a linear acidic mucopolysaccharide formed by alternating connection of acetylglucosamine and glucuronic acid disaccharide units. Hyaluronic acid is a substance owned by the human body and widely exists in tissues of the human body, such as joint cavities, skin, vitreous eye bodies, cartilage, umbilical cord and the like. With the age, the content of hyaluronic acid in human body is gradually reduced. This is one of the main causes of many problems such as joint stiffness, skin aging, increased wrinkles, and eye puffiness. A plurality of researches prove that the oral administration of the hyaluronic acid can promote the human body to synthesize new hyaluronic acid, increase the content of the hyaluronic acid in the body, further improve the moisture of the skin of the human body, and has the effects of resisting oxidation in the body, improving the joint function, repairing gastric mucosa injury and the like. Therefore, the hyaluronic acid is a functional biochemical substance with extremely wide application and excellent performance in the fields of daily chemicals, medicines, biochemistry, health-care foods and the like.

At present, the edible hyaluronic acid is mainly obtained from fermentation of cockscomb and group C streptococcus. Hyaluronic acid extracted from cockscomb is suspected of virus infection of common diseases of human and livestock in terms of edible safety. Meanwhile, hyaluronic acid is decomposed by enzymes after passing through gastric digestive juice, and thus a significant effect cannot be achieved by directly ingesting hyaluronic acid food. Therefore, the bacterial strain capable of secreting hyaluronic acid is eaten to colonize in intestinal tracts and continuously secrete hyaluronic acid, so that the degradation effect of gastric digestive juice on hyaluronic acid is avoided. Group C streptococci, however, are species that are not useful in food products. To date, only a few edible strains are known to have the ability to secrete hyaluronic acid, such as streptococcus thermophilus YIT2084 and lactobacillus gasseri FTDC 8131. In addition, at present, probiotics have less research and application in anti-aging and promoting tissue repair. Probiotic strains used by domestic production enterprises depend on import for a long time, and foreign strains are not necessarily suitable for the gastrointestinal tract physiological conditions of residents in China. In addition, the function of the probiotics lacks strong scientific research evidence, and the popularization of the probiotics and the products thereof is seriously influenced. Based on the method, aiming at the deep excavation of the functions of the strain resources, the novel probiotic strain which has independent intellectual property rights, has specific functional properties and is suitable for the physiological characteristics of Chinese people is screened out, and the method is particularly important for improving the core competitiveness of probiotic production enterprises in China and promoting the development of probiotic products in China.

Therefore, the problem to be solved by the technical personnel in the field is to provide a lactobacillus rhamnosus E2 for producing hyaluronic acid and the application thereof.

Disclosure of Invention

In view of this, the invention provides a lactobacillus rhamnosus E2 strain for producing hyaluronic acid and an application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

a strain of Lactobacillus rhamnosus E2 has a preservation number of CGMCC No.21770, is preserved in China general microbiological culture Collection center (CGMCC) for short, and is deposited in China academy of sciences institute of microbiology No.3, North Cheng Xilu No. 1, the area of the facing sun, Beijing, with a preservation date of 2021 year, 01 month, 29 days, and is classified and named as Lactobacillus rhamnosus E2.

Further, the lactobacillus rhamnosus E2 is applied to preparation of products for resisting aging and promoting tissue injury repair.

The lactobacillus rhamnosus E2 capable of producing the hyaluronic acid has the effects of reducing the ROS level in zebra fish bodies and improving the SOD activity in the zebra fish bodies in an in-vivo oxidative stress model, and shows good anti-oxidation and anti-aging probiotic effects.

The lactobacillus rhamnosus E2 capable of producing hyaluronic acid can remarkably promote the repair of the tail fin damage of the zebra fish in a zebra fish damage model, and shows good potential for promoting the repair of tissue damage.

Further, the product is food, cosmetic, or medicine.

Further, the Lactobacillus rhamnosus E2 is applied to the production of hyaluronic acid.

Further, the Lactobacillus rhamnosus E2 can be applied to preparation of fermented dairy products and other fermented foods.

Further, the lactobacillus rhamnosus E2 is a bacterial suspension or a fermentation supernatant.

The strain E2 can obviously reduce the ROS level in zebra fish bodies, obviously improve the SOD activity in the zebra fish bodies and obviously promote the repair of the tail fin damage of the zebra fish in a zebra fish damage model, and comprises fermentation supernatant (extracellular secretion) and bacterial suspension (thallus) of the strain E12.

According to the technical scheme, compared with the prior art, the invention discloses and provides the lactobacillus rhamnosus E2 for producing the hyaluronic acid and the application thereof, the lactobacillus rhamnosus E2 is obtained by separating and screening excrements of the elderly with a long life in mountain county of Banana, City, Guangdong, has the effects of obviously reducing the ROS level in zebra fish bodies, obviously improving the SOD activity in the zebra fish bodies and also obviously promoting the repair of the tail fin damage of the zebra fish in a zebra fish damage model; has the potential of resisting aging and promoting tissue repair in vivo, and provides theoretical reference and guidance basis for developing a probiotic preparation for resisting oxidation, delaying aging, relieving skin aging and promoting tissue damage repair by using lactobacillus rhamnosus E2.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a drawing showing the colony morphology of Lactobacillus rhamnosus E2 on MRS agar plate;

FIG. 2 is a drawing showing the microscopic morphology observation of Lactobacillus rhamnosus E2 after gram staining;

FIG. 3 is a diagram showing the hyaluronic acid-producing ability of Lactobacillus rhamnosus E2 according to the present invention;

FIG. 4 is a visual chart of the influence of fermentation supernatant and bacterial suspension of Lactobacillus rhamnosus E2 on the ROS level in a menadione-induced zebra fish oxidative stress model;

FIG. 5 is a statistical graph of the influence of fermentation supernatant and bacterial suspension of Lactobacillus rhamnosus E2 on the ROS level in a menadione-induced zebrafish oxidative stress model;

FIG. 6 is the effect of fermentation supernatant and bacterial suspension of Lactobacillus rhamnosus E2 on SOD activity in oxidative stress model of menadione-induced zebrafish;

FIG. 7 is a visual chart of the influence of fermentation supernatant and bacterial suspension of Lactobacillus rhamnosus E2 on the repair of the tail fin injury of zebra fish;

FIG. 8 is a statistical chart of the influence of fermentation supernatant and bacterial suspension of Lactobacillus rhamnosus E2 on the repair of zebra fish tail fin injury.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.

Example 1 isolation, identification and preservation of Lactobacillus rhamnosus E2

(1) Separation: the excrement of the elderly with long life is respectively inoculated in an anaerobic blood agar culture medium and an MRS solid culture medium after being diluted in a gradient manner, the anaerobic culture is carried out for 48 hours at 37 ℃, and a single colony on a flat plate is picked and streaked to obtain a pure colony. Inoculating pure bacterial colonies on the plate into an MRS liquid culture medium, carrying out anaerobic culture at 37 ℃ for 12-16 h, adding 20% glycerol, and storing in a refrigerator at-80 ℃.

(2) And (3) identifying the strain morphology: when the screened strains are observed under a microscope after gram staining, gram-positive bacteria are purple, and gram-negative bacteria are red.

(3) Molecular biological identification of the strain: extracting genome DNA of the obtained strain, amplifying a 16S rDNA full-length fragment by utilizing a 16S rDNA universal primer 27F and a 1492R through a PCR technology, and then sequencing to identify the species of the strain.

Wherein, the primer sequences of the universal primers 27F and 1492R are as follows:

27F：5’-AGAGTTTGATCCTGGCTCAG-3’；SEQ ID NO.1；

1492R：5’-GGTTACCTTGTTACGACTT-3’；SEQ ID NO.2。

the experimental results are as follows: the strain screened from feces of longevity elders in Ridge county of Musa city, Guangdong province is identified as lactobacillus rhamnosus through morphological observation and 16S rDNA identification, wherein the strain E2 is identified as lactobacillus rhamnosus, and the 16S rDNA sequence of the strain is shown as SEQ ID NO. 3.

CTGGGCGTGTGCTACAATGCAAGTCGAACGAGTTCCGTTTATTTTT GCTTGTTGCATCTTGATTTAATTTTGAACGAAATGCGTGCCGACCTGTA ACCGCTCCGAACCTGCCCTTGAAAGCGGGAGAACATGTGGAAACAGAT GCTTATACCGCTGAAATCCAAGAACCGCATGGATCTTGGTTGAATGATG GCGTAAGCTATCGCTTTTGGATGGACCCGCGGCGTATTAAATAGTTGGA GAGGTAACCGCTCACCAAAGGAATGATACGCACATTGAACTGAAGGAC GATCCACCACATTGCGACTGAGACACGGGCCAAACTCCTACCAAAGGC AGCAAGACTGAATCTTCCACAATGGACGAAGTCTGATGGAGCAACGCC GCGTGACTGATTTGGCTTTCGGAACGCAAAACTCTGTTGTTGCTTAAGA ATGGTCGCCGAGTAACTGTTGCCAGCGTGACGCGATCCAACCAAAAAG CCACGCGTAACTACGAGCCATTGGCCGCGAAAATA；SEQ ID NO.3。

A single colony of the strain E2 is inoculated on an MRS solid culture medium, the anaerobic growth is good at 37 ℃, the colony is white, round, convex, smooth in surface, opaque and neat in edge (figure 1), and gram staining is positive (figure 2). The strain E2 has been preserved in China general microbiological culture Collection center (CGMCC), CGMCC for short, the microbiological research institute of China academy of sciences No.3, Xilu No. 1, North Cheng, the area of the south facing the Yangtze, Beijing, the preservation date is 29 days at 01.01.29 years in 2021, and the strain is classified and named as Lactobacillus rhamnosus with the preservation number of CGMCC No. 21770.

Example 2 determination of hyaluronic acid-producing ability of Lactobacillus rhamnosus E2

Inoculating Lactobacillus rhamnosus E2 into MRS liquid culture medium, culturing at 37 deg.C for 14 hr in anaerobic workstation, and adjusting strain concentration to 1 × 10 ⁶ CFU/mL is inoculated in fresh MRS liquid culture medium according to the volume fraction of 5 percent, and after being cultured in a full-temperature oscillator at 37 ℃ and 150r/min for 0, 6, 12, 24, 48 and 72 hours, the hyaluronic acid concentration in the strain fermentation supernatant is detected by an ELISA kit (Nanjing herbaceous source biotechnology limited). Each time point was tested 3 times. The experimental data are all expressed as x + -SEM data,

the results are shown in FIG. 3. As can be seen from FIG. 3, the lactobacillus rhamnosus E2 can be fermented to produce hyaluronic acid after being inoculated in the culture medium for 6h, and the hyaluronic acid almost reaches the saturated concentration after 72h, so that the final yield of the hyaluronic acid reaches 46.4 +/-2.1 ng/mL.

Example 3 preparation of fermentation supernatant (extracellular secretion) and bacterial suspension (thallus) of Lactobacillus rhamnosus E2

Activating and culturing Lactobacillus rhamnosus E2, inoculating in MRS liquid culture medium, culturing at 37 deg.C for 15 hr, and adjusting the concentration of fermentation bacteria to 1 × 10 ⁷ CFU/mL，4℃，6000r/minCentrifuging for 10min to obtain culture supernatant and thallus precipitate, and filtering the supernatant with 0.22 μm filter membrane to obtain fermentation supernatant (extracellular secretion); after the cell pellet was washed twice with PBS, the cell pellet was resuspended in PBS to adjust the cell concentration to 1X 10 ⁷ CFU/mL gave a suspension (thallus).

Example 4 Effect of Lactobacillus rhamnosus E2 on ROS levels in a Zebra Fish oxidative stress model

Reduced Glutathione (GSH), menadione, and dimethyl sulfoxide (DMSO) were obtained from Shanghai-derived leaf Biotechnology, Inc.; 2',7' -dichlorodihydrofluorescein diacetate (DCFH-DA) was purchased from Sigma-Aldrich.

Healthy wild-type AB line zebrafish that developed to 4dpf (days post fertilization) were picked and placed in 6-well cell culture plates, 20 fish per well. The experiment set up blank control group, model group, positive control group, sample (bacterial suspension, fermentation supernatant) intervention group, each group 20 fish. Adding PBS into a blank control group, adding PBS into a model group, adding GSH solution (100 mu M) into a positive control group, adding bacterial suspension into a bacterial suspension group, and adding fermentation supernatant into a fermentation supernatant group, wherein each hole is 2.5 mL; after incubation for 24h at 28 ℃, 2.5mL of PBS (1% DMSO) is added to the blank control group, and 6 μ M of menadione (menadione is prepared into 600 μ M stock solution by DMSO and then diluted into 6 μ M by PBS) is added to the model group, the positive control group, the bacterial suspension group and the fermentation supernatant group respectively, 2.5mL of each well; after incubation for 24h at 28 ℃, the solution is discarded, the zebra fish is washed for 3 times by PBS, 20 mu g/mL DCFH-DA solution is added, 3mL of the solution is added into each hole, after incubation for 1h at 28 ℃ in a dark place, the zebra fish is washed for 3 times by PBS, and the zebra fish is placed under a fluorescence microscope to observe the fluorescence intensity in vivo and take a picture for recording. The fluorescence intensity (S) in zebra fish bodies was quantitatively analyzed using Image J software. ROS levels in zebrafish were calculated as follows:

statistical processing of data and experimental data by using SPSS 19.0 software

Data are presented using one-way analysis of variance. Compared to the blank control group: ^### p<0.005; compared to the model group: p<0.01， ***P<0.005。

The results are shown in FIGS. 4 and 5; as can be seen from FIGS. 4 and 5, the intensity of green fluorescence in zebra fish body reflects the level of ROS; compared with a blank control group, the intensity of green fluorescence in the zebra fish body of the model group is enhanced, which shows that the ROS level in the zebra fish body of the model group is increased; meanwhile, compared with a blank control group (100.00 +/-4.14%), the ROS level (172.30 +/-8.38%) in the zebra fish body of the model group is remarkably increased (p is less than 0.005), and the establishment of the zebra fish oxidative stress model is successful.

Compared with the model group, the green fluorescence intensity of the positive control Group (GSH) zebra fish in vivo is weakened, which indicates that the GSH can reduce the ROS level in the zebra fish in the menadione-induced zebra fish oxidative stress model; meanwhile, the ROS level in the zebra fish of the positive control group is 108.23 +/-6.18%, and the difference is obvious compared with that of a model group (172.30 +/-8.38%) (P is less than 0.005); therefore, GSH has an obvious antioxidant effect, consistent with clinical results. Compared with the model group, the green fluorescence intensity in the zebra fish body of the fermentation supernatant group and the bacterial suspension group of the lactobacillus rhamnosus E2 is also weakened, which shows that the ROS level in the zebra fish body can be reduced when the fermentation supernatant and the bacterial suspension of the lactobacillus rhamnosus E2 are in a menadione-induced zebra fish oxidative stress model; meanwhile, the ROS levels in zebra fish bodies of a fermentation supernatant group and a bacterial suspension group of the lactobacillus rhamnosus E2 are 117.39 +/-5.45% and 128.16 +/-7.89%, respectively, and the differences are obvious (P is less than 0.01) compared with the model group (172.30 +/-8.38%). Therefore, the results show that the fermentation supernatant and the bacterial suspension of the lactobacillus rhamnosus E2 can obviously reduce the ROS level in zebra fish bodies in an in-vivo oxidative stress model, and show good effects of resisting oxidation and delaying aging.

Example 5 Effect of Lactobacillus rhamnosus E2 on SOD Activity in Zebra Fish oxidative stress model

Healthy wild-type AB line zebrafish that developed to 4dpf (days post fertilization) were picked and placed in 6-well cell culture plates, 20 fish per well. The experiment set up blank control group, model group, positive control group, sample (bacterial suspension, fermentation supernatant) intervention group, each group 20 fish. Adding PBS into a blank control group, adding PBS into a model group, adding GSH solution (100 mu M) into a positive control group, adding bacterial suspension into a bacterial suspension group, and adding fermentation supernatant into a fermentation supernatant group, wherein each hole is 2.5 mL; after incubation for 24h at 28 ℃, 2.5mL of PBS (1% DMSO) is added to the blank control group, and 6 μ M of menadione (menadione is prepared into 600 μ M stock solution by DMSO and then diluted into 6 μ M by PBS) is added to the model group, the positive control group, the bacterial suspension group and the fermentation supernatant group respectively, 2.5mL of each well; after incubation for 24h at 28 ℃, discarding the solution, washing the zebra fish for 3 times by using PBS, collecting the zebra fish to a 1.5mL centrifuge tube, wherein each tube contains 50mg of zebra fish, and each experimental group contains 6 tubes; after the water in the centrifuge tube was blotted dry, 250. mu.L of buffer solution (buffer solution of superoxide dismutase (SOD) detection kit) was added. Treating the centrifuge tube with ultrasonicator in ice bath at an interval of 8s for 5s, ultrasonicating for 10 times, centrifuging at 12000 Xg for 10min at 4 deg.C, and collecting supernatant. SOD activity of each group was detected using a superoxide dismutase (SOD) detection kit (Sigma-Aldrich Co.).

Data are presented using one-way analysis of variance. Compared to the blank control group: ^### p<0.005; compared to the model group: p<0.05， **P<0.01，***P<0.005。

The results are shown in FIG. 6; as can be seen from FIG. 6, compared with the blank control group (3.32 + -0.40U/mg), the in vivo SOD activity (0.81 + -0.13U/mg) of the zebra fish in the model group is significantly reduced (p is less than 0.005), which indicates that the establishment of the oxidative stress model of the zebra fish is successful.

The SOD activity in the zebra fish body of the positive control group is 2.66 +/-0.47U/mg, and the difference is obvious (P is less than 0.005) compared with that of a model group (0.81 +/-0.13U/mg), which indicates that the GSH has obvious antioxidation and is consistent with clinical results. SOD activities in a fermentation supernatant group and a bacterial suspension group of the lactobacillus rhamnosus E2 and zebra fish are respectively 2.31 +/-0.20U/mg and 1.96 +/-0.09U/mg, and the differences are obvious (P is less than 0.05) compared with a model group (0.81 +/-0.13U/mg). Therefore, the results show that the fermentation supernatant and the bacterial suspension of the lactobacillus rhamnosus E2 can obviously improve the SOD activity in the zebra fish body in an in-vivo oxidative stress model, enhance the free radical scavenging capability of the body and show good effects of resisting oxidation and delaying aging.

Example 6 Effect of Lactobacillus rhamnosus E2 on the repair of injury to the tail fin of Zebra fish

Selecting normal-developing wild type AB line zebra fish (3dpf) and placing the zebra fish in a 6-hole cell culture plate, cutting tail fins of the zebra fish by using a scalpel under a stereoscopic microscope, taking a picture for recording at 0dpa (daylight) time, then transferring the zebra fish to a 96-hole cell culture plate, adding PBS into a model group, adding bacterial suspension into a bacterial suspension group, adding fermentation supernatant into a fermentation supernatant group, carrying out incubation to 3dpa for 15 strips in each hole by 200 mu L, anaesthetizing the zebra fish by using tricaine, and placing the zebra fish under the stereoscopic microscope for taking a picture for recording. The zebrafish tail fin lengths at 0dpa and 3dpa were counted as D1 and D2 using Image J software, respectively. The difference between D1 and D2 is the zebrafish tail fin regrowth length. Statistical processing of data and experimental data by using SPSS 19.0 software

Data are presented using one-way analysis of variance. Each experimental group was compared to the model group: p<0.01，***P<0.005。

The results are shown in FIGS. 7 and 8; as can be seen from FIGS. 7 and 8, the tail fins of the zebra fish in the model group are not completely long, and the regeneration length of the tail fins is 60.92 +/-2.09 μm. The tail fins of the zebra fish in the lactobacillus rhamnosus E2 bacterial suspension group and the fermented supernatant group are almost completely grown, the regeneration lengths of the tail fins are 75.38 +/-2.20 micrometers and 88.60 +/-3.03 micrometers respectively, and the difference is obvious (P is less than 0.01) compared with that of a model group (60.92 +/-2.09 micrometers). Therefore, the results show that the bacterial suspension and the fermentation supernatant of the lactobacillus rhamnosus E2 can promote the injury repair of the tail fin of the zebra fish and have the potential of enhancing the self-repair capability of the injured tissue.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Guandong Nanxin medical science and technology Co., Ltd, Lanzhou, Chaishan, Inc

<120> lactobacillus rhamnosus E2 for producing hyaluronic acid and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 1

agagtttgat cctggctcag 20

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 2

ggttaccttg ttacgactt 19

<210> 3

<211> 517

<212> DNA

<213> Artificial Sequence

<400> 3

ctgggcgtgt gctacaatgc aagtcgaacg agttccgttt atttttgctt gttgcatctt 60

gatttaattt tgaacgaaat gcgtgccgac ctgtaaccgc tccgaacctg cccttgaaag 120

cgggagaaca tgtggaaaca gatgcttata ccgctgaaat ccaagaaccg catggatctt 180

ggttgaatga tggcgtaagc tatcgctttt ggatggaccc gcggcgtatt aaatagttgg 240

agaggtaacc gctcaccaaa ggaatgatac gcacattgaa ctgaaggacg atccaccaca 300

ttgcgactga gacacgggcc aaactcctac caaaggcagc aagactgaat cttccacaat 360

ggacgaagtc tgatggagca acgccgcgtg actgatttgg ctttcggaac gcaaaactct 420

gttgttgctt aagaatggtc gccgagtaac tgttgccagc gtgacgcgat ccaaccaaaa 480

agccacgcgt aactacgagc cattggccgc gaaaata 517

Claims

1. A strain of Lactobacillus rhamnosus E2 is characterized in that the preservation number is CGMCC No. 21770.

2. The application of the lactobacillus rhamnosus E2 strain of claim 1 in preparing products for resisting aging and promoting tissue injury repair.

3. The application of the lactobacillus rhamnosus E2 strain in preparing products for resisting aging and promoting tissue injury repair according to claim 2, wherein the lactobacillus rhamnosus E2 strain is bacterial suspension or fermentation supernatant.

4. The application of the lactobacillus rhamnosus E2 in preparing the product for resisting aging and promoting tissue damage repair according to claim 2, wherein the product is food, cosmetics or medicine.

5. The use of a lactobacillus rhamnosus E2 strain of claim 1 for the production of hyaluronic acid.

6. The use of the lactobacillus rhamnosus E2 of claim 1 in preparing fermented dairy products and other fermented food.

7. The use of the lactobacillus rhamnosus E2 strain of claim 6 in preparing fermented dairy products and other fermented food products, wherein the lactobacillus rhamnosus E2 strain is a bacterial suspension or a fermented supernatant.