CN114762733A - Extracochlear hair cell specific cis-form regulatory element and application thereof - Google Patents

Abstract

The invention discloses a specific cis-form regulatory element of cochlear outer hair cells and application thereof. Specifically, the invention discloses a cis-regulatory element specific to cochlear outer hair cells, which comprises the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, can be used for driving effector gene to be specifically expressed in cochlear outer hair cells. The extracochlear hair cell specific cis-regulatory element can drive Prestin specificity to be expressed in extracochlear hair cells, so that hearing impairment caused by Prestin mutation can be treated. AAV viruses constructed by using the cis-regulatory element of the present invention are expected to become a new method for clinical treatment of hearing impairment.

Description

Extracochlear hair cell specific cis-form regulatory element and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a cis-form regulatory element for specificity of cochlear outer hair cells and application thereof.

Background

The cochlea is the auditory organ of mammals, located ventrally of the inner ear, responsible for the detection of sound. The sensory receptors for sound, Hair Cells (HC), are located in the auditory epithelium of the cochlea (also known as the Organ of Corti, Organ of Corti (OC)). There are two types of hair cells, Inner Hair Cells (IHC) and Outer Hair Cells (OHC). These two cell types share many HC markers, such as Myo6, but they also differ in many ways, such as cell morphology, gene expression profile, function, ototoxin susceptibility, and the like.

Extra cochlear hair cells (OHCs) are essential for mammals to perceive sound. OHC has the function of a sound amplifier, depending on the motor protein Prestin expressed on the lateral membrane. Prestin is expressed only in OHC throughout development and adulthood. However, the mechanism of how to achieve specificity of Prestin expression in time and space is not clear.

The gene mutation of the outer hair cell can cause hearing diseases such as deafness and the like, and is closely related to the deletion of Prestin expression. Therefore, there is a need in the art to develop a method for treating hearing diseases such as deafness caused by mutation of outer hair cell gene.

Disclosure of Invention

The invention aims to provide a cis-regulatory element specific to an extracochlear hair cell and application thereof in repairing and/or regenerating the extracochlear hair cell to treat hearing loss.

In a first aspect of the invention, there is provided the use of a combination of active ingredients for the manufacture of a formulation or medicament for: (i) repairing and/or regenerating cochlear outer hair cells; (ii) treating or preventing hearing impairment; and/or (iii) specific expression of effector genes in cochlear outer hair cells;

wherein, the active ingredient combination comprises:

(a) a cochlear outer hair cell-specific cis-regulatory element;

(b) a promoter; and

(c) an effector gene or a coding sequence thereof.

In another preferred example, the hearing impairment is hearing impairment associated with degeneration and/or damage of cochlear Outer Hair Cells (OHC).

In another preferred embodiment, the degeneration of extracochlear hair cells (OHC) is the degeneration caused by mutation of Prestin protein in OHC cells.

In another preferred embodiment, the cochlear outer hair cell is a human or non-human mammalian cochlear outer hair cell.

In another preferred embodiment, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

In another preferred embodiment, the promoter is selected from the group consisting of: hsp68, L7, thy-1, recoverin, calbindin, human CMV, GAD-67, chicken actin, CAG or CBA.

In another preferred embodiment, the promoter is Hsp 68.

In another preferred embodiment, the effector gene is a gene encoding a Prestin protein.

In another preferred embodiment, the cis-regulatory element drives expression of the effector gene specifically in cochlear outer hair cells.

In a second aspect of the invention, there is provided an active ingredient combination comprising:

(a) a cochlear outer hair cell-specific cis-regulatory element;

(b) a promoter; and

(c) an effector gene or coding sequence thereof;

wherein, the nucleotide sequence of the cochlea outer hair cell specificity cis-form regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

In another preferred embodiment, the promoter is selected from the group consisting of: hsp68, L7, thy-1, recoverin, calbindin, human CMV, GAD-67, chicken actin, CAG or CBA.

In another preferred embodiment, the promoter is Hsp 68.

In another preferred embodiment, the effector gene is a gene encoding a Prestin protein.

In another preferred embodiment, the cis regulatory element drives the expression of the effector gene specifically in extracochlear hair cells.

In a third aspect of the present invention, there is provided an expression vector comprising an expression cassette, wherein the expression cassette has a structure of formula I from 5 'end to 3' end:

Z0-Z1-Z2-Z3-Z0’ (I)

in the formula (I), the compound is shown in the specification,

each "-" is independently a chemical bond or a nucleotide linking sequence;

z0 is none, or a 5' UTR sequence;

z1 is the nucleotide sequence of the cis-regulatory element of the specificity of the cochlear outer hair cell;

z2 is a promoter sequence;

z3 is the nucleotide sequence of an effector gene; and

z0 'is a null, or 3' UTR sequence.

In another preferred embodiment, each nucleotide linker sequence is 1 to 30nt, preferably 1 to 15nt, more preferably 3 to 6nt in length.

In another preferred embodiment, the nucleotide linker sequence is derived from a nucleotide linker sequence cleaved by a restriction endonuclease.

In another preferred embodiment, the nucleotide sequence of the cochlear outer hair cell-specific cis-regulatory element is set forth in SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

In another preferred embodiment, the promoter is selected from the group consisting of: hsp68, L7, thy-1, recoverin, calbindin, human CMV, GAD-67, chicken actin, CAG or CBA.

In another preferred embodiment, the promoter is Hsp 68.

In another preferred embodiment, the effector gene is a gene encoding a Prestin protein.

In another preferred embodiment, the expression vector is selected from the group consisting of: plasmids, viral vectors.

In another preferred embodiment, the expression vector is selected from the group consisting of: eukaryotic expression vectors, lentiviral vectors, adenoviral vectors, adeno-associated viral vectors (AAV), or combinations thereof.

In another preferred example, the expression vector is an adeno-associated virus AAV vector.

In another preferred embodiment, the AAV vector is selected from the group consisting of: AAV2.7m8, AAV-ie or AAV-Anc 80.

In another preferred embodiment, said expression vector is used for expressing said effector gene.

In another preferred embodiment, the expression vector is used for expressing Prestin protein.

In another preferred embodiment, the expression vector is used for specifically expressing effector genes in cochlear outer hair cells.

In a fourth aspect of the invention, there is provided a host cell comprising an expression vector according to the third aspect of the invention.

In another preferred embodiment, the host cell is selected from the group consisting of: eukaryotic cells or prokaryotic cells.

In another preferred embodiment, the host cell is a mammalian cell, including human and non-human mammals.

In another preferred embodiment, the host cell is an extracochlear hair cell of a human or non-human mammal.

In a fifth aspect of the invention, there is provided a pharmaceutical formulation comprising: (a) the combination of active ingredients according to the second aspect of the invention, or the expression vector according to the third aspect of the invention, or the cell according to the fourth aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the dosage form of the pharmaceutical formulation is selected from the group consisting of: a lyophilized formulation, a liquid formulation, or a combination thereof.

In another preferred embodiment, the carrier is selected from the group consisting of: a lentiviral vector, an adenoviral vector, an adeno-associated viral vector (AAV), or a combination thereof; preferably, the vector is an AAV vector; more preferably AAV2.7m8, AAV-ie or AAV-Anc 80.

In another preferred embodiment, the content of the carrier in the pharmaceutical preparation is 1 × 10¹¹-1×10¹⁴Individual virus/ml, preferably 1X 10¹²-1×10¹³Individual virus/ml.

In another preferred embodiment, the therapeutically effective amount of the pharmaceutical formulation is 1 × 10¹¹-1×10¹⁴A virus, preferably 1X 10¹²-1×10¹³And (4) viruses.

In another preferred embodiment, the pharmaceutical formulation is for use in the treatment or prevention of hearing impairment, preferably the treatment of cochlear outer hair cell degeneration and/or damage.

In a sixth aspect of the invention, there is provided the use of a combination of active ingredients according to the second aspect of the invention, or an expression vector according to the third aspect of the invention, or a host cell according to the fourth aspect of the invention, or a pharmaceutical formulation according to the fifth aspect of the invention, in the manufacture of a medicament for the treatment or prevention of hearing loss.

In another preferred example, the hearing impairment is hearing impairment associated with degeneration and/or damage of cochlear outer hair cells.

In a seventh aspect of the invention, there is provided a method of repairing and/or regenerating outer cochlear hair cells, comprising transducing the active ingredient combination of the second aspect of the invention, or the expression vector of the third aspect of the invention, into degenerated or damaged outer cochlear hair cells.

In another preferred embodiment, the Prestin protein in the denatured or damaged cochlear outer hair cells is mutated.

In another preferred embodiment, the mutation comprises an inactivating mutation resulting from deletion, insertion or substitution of a single base or multiple bases in the coding sequence.

In an eighth aspect of the invention, there is provided a method of treating or preventing hearing impairment, the method comprising administering to a subject in need thereof a pharmaceutical formulation according to the fifth aspect of the invention.

In another preferred example, the hearing impairment is hearing impairment associated with degeneration and/or damage of extracochlear hair cells.

In another preferred embodiment, the method is a method of reducing degeneration and/or damage of extracochlear hair cells in a patient suffering from or at risk of developing hearing impairment.

In another preferred embodiment, the subject in need thereof includes humans and non-human mammals.

In another preferred example, the subject in need thereof has hearing impairment associated with degeneration and/or damage of outer cochlear hair cells

In another preferred embodiment, the method comprises directly administering the expression vector to the ear of a subject in need thereof.

In another preferred embodiment, the method comprises directly implanting the host cell into a cochlea of a subject in need thereof.

In another preferred example, the method can repair cochlear outer hair cells of a subject in need of hearing impairment associated with degeneration and/or damage of cochlear outer hair cells.

In another preferred embodiment, the method is such that the auditory function is substantially restored or maintained in the treated ear.

In a ninth aspect of the invention, there is provided a use of a cochlear outer hair cell-specific cis regulatory element, the cis regulatory element comprising an amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2 for driving the expression of effector genes specifically in cochlear outer hair cells.

In another preferred embodiment, the effector gene is a gene encoding a Prestin protein.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1: the deletion of the 13kb fragment suppressed expression of Prestin at P6. (A) The 13kb fragment is located in Prestin intron 2. (B) Sanger sequencing results of DNA from rat tail of Prestin-13k/+ mice. (C) Gel electrophoresis of PCR amplification products from mouse rat tail DNA from wild type (Prestin +/+), heterozygote (Prestin-13k/+) and homozygote (Prestin-13k/Prestin-13 k). (D-E) Prestin +/+ (D) and Prestin-13k/Prestin-13k (E) P6 cochlear tissue sample Whole-standard in situ RNA hybridization staining. Prestin mRNA is specifically expressed in wild-type outer hair cells (D), but cannot be detected in homozygous mutants (E). (F-G) immunohistofluorescence detection of Prestin using samples of cochlear tissue from P5 Prestin +/+ (F) and Prestin-13k/Prestin-13k (G). The Prestin protein is specifically expressed in wild-type outer hair cells (F), but no signal of the Prestin protein can be detected in homozygous mutants (G). The panels embedded in (F) are the same panels, but only the signal of the Prestin channel is presented. (H) Schematic flow chart of manual selection of tdTomato positive cells from P5 wild type, heterozygote and homozygote mice. (I-J) the content of Pretsin and Myo6 in cells derived from mice of different genotypes in the (H) picture was determined using the qPCR method. Deletion of the 13kb fragment had an effect on Prestin mRNA and a dose effect, but not Myo6 mRNA. Enrichment of Myo6 in hair cells demonstrated high purity of hair cells (J). P <0.05, p <0.001, scale: 20 μm (E, G).

FIG. 2: deletion of the near 5' 4kb fragment of intron 2 replicates the phenotype of the Prestin-13k mutant. (A) The distribution position of the 4k fragment (blue line, #1) on the Prestin intron-2 is shown. Mice with the other two fragments (#2 and #3) deleted did not observe a phenotype. (B) Morge sequencing of mouse rat tail DNA from Prestin 4k-1/+ mice. (C) Gel electrophoresis of PCR amplification products from mouse rat tail DNA from wild type (Prestin +/+), heterozygote (Prestin-4k/+) and homozygote (Prestin-4k-1/Prestin-4 k-1). (D-E') immunofluorescence Co-staining for Prestin and Myo6 in cochlear tissue samples of Prestin (+/+) and Prestin-4k-1/Prestin-4k-1 at P5. The Prestin protein is specifically expressed in wild-type outer hair cells (D-D '), but no signal of the Prestin protein can be detected in homozygous mutants (E-E'). (F-I) NLC measurements were performed on OHC's of 5 different genotypes at P14.5(F) and P60(G), respectively. The NLC curve of the Prestin-4k-1 mutant overlaps with that of the Prestin-13k mutant. Notably, no difference was found in the total Prestin content between Prestin-13k/+ and Prestin-4k-1/+ at P14.5 and P60 (H). Again, there was no difference between P14.5 and P60(I), Prestin-13k/Prestin-13k and Prestin-4k-1/Prestin-4 k-1.

FIG. 3: preset expression of Prestin requires a 1.4k fragment. (A-C) schematically illustrates how random deletions were induced in the 4k fragment (blue line) using multiple sgRNAs, of which 7 more potent sgRNAs have been previously tested for efficiency. Sgrnas were divided into two subgroups: group 1 at the 5' end, includes sg1, 5, 6, 7 and 8; group 2 includes sgrnas 8, 9, 10, 11, and 12 at the 3' end. Cas9 mRNA was injected into one cell phase zygote along with 5 sgrnas of group 1 (B) and group 2 (C), yielding 32 and 43F 0 mice, respectively. (D) Shows sanger sequencing of 1/32F0 mouse rat tail DNA from group 1 sgrnas (b). Sequencing results show that the mutant is possibly a homozygous mutant with 1429bp (1.4k) fragment deletion between sgRNA-1 and sgRNA-7. (E-F') immunofluorescence co-staining of Prestin and Myo6 in mouse cochlear specimens of P9 (D). The images are acquired at a low resolution (E-E ') and a high resolution (F-F'), respectively. A heterogeneous expression pattern of Prestin can be observed. Outer hair cells with high Prestin should be of wild type genotype (arrow in F-F '), and outer hair cells with very low or undetectable Prestin should be homozygous deleted for 1.4k (asterisk in F-F'). In conclusion, the mouse should be a chimera. The tail cells are mostly homozygous mutations, resulting in the inability to amplify the wild-type PCR product. Scale bar: 100 μm (E'); 20 μm (F').

FIG. 4: the 1.4kb fragment of mouse Presin and the 398bp fragment of human Prestin were sufficient to drive the expression of specific green fluorescent protein in cochlear OHC. (A) The transgenic mice were obtained by the Piggybac method with a 1.4kb fragment (as enhancer) and Hsp68 promoter to control EGFP. A unique transgene insertion pattern was present for each F0, but could be analyzed directly without further propagation. (B-B') immunofluorescent co-staining of EGFP and Myo6 was performed on cochlear tissue samples of F0 mice from P14. Viewing the image of the insert in (B-B') under a high power lens, EGFP expression was specific for outer hair cells, but not all outer hair cells were EGFP positive, indicating that the transgene insert in F0 mice was chimeric. (C-C') A cochlear tissue sample from another F0 mouse was subjected to immunofluorescence co-staining for EGFP and Myo6 at P21. EGFP signals were expressed in all outer hair cells, indicating that transgene insertion was not chimeric in this mouse. (D-F') human Prestin and mouse Prestin have 398bp highly homologous sequences. The sequence of 398bp is utilized to express EGFP in a mouse cochlea OHC specifically. Scale bar: 200 μm (B ') and 20 μm (C ', F ').

FIG. 5: the 1.4kb fragment of mouse Presin is aligned with the 398bp fragment of human Prestin for detailed similarity.

FIG. 6: the AAV virus made from mouse 1.4kb sequence and human 398bp sequence is used to specifically infect cochlear OHC. (A) AAV was produced using a 1.4kb sequence of the mouse Prestin gene and injected into the cochlea of a mouse. (B-B') P17 analysis of mouse cochlea, EGFP is mainly expressed in the extracochlear hair cells. (C) The 398bp sequence of the human Prestin gene is used to make AAV virus, which is injected into the cochlea of mouse. (D-D') P17 analysis of mouse cochlea, EGFP is also predominantly expressed on the extracochlear hair cells.

Detailed Description

The inventors of the present invention have conducted extensive and intensive studies and have surprisingly screened, for the first time, an extracochlear hair cell-specific cis regulatory element that can drive effector genes to be specifically expressed in extracochlear hair cells. Experiments prove that the extracochlear hair cell specificity cis-regulatory element regulates the expression of Prestin in extracochlear hair cells, and is a necessary condition for timely starting the expression of Prestin in OHC. And the AAV expression vector constructed by using the extracochlear hair cell specific cis-regulatory element can drive the specific expression of effector genes in the expression vector in the extracochlear hair cells.

On the basis of this, the present invention has been completed.

Term(s) for

In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

Sequence identity (homology) is determined by comparing two aligned sequences along a predetermined comparison window (which may be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

As used herein, the terms "subject", "subject in need thereof" refer to any mammal or non-mammal. Mammals include, but are not limited to, humans, vertebrates such as rodents, non-human primates, cows, horses, dogs, cats, pigs, sheep, goats.

As used herein, the terms "hearing impaired," "hearing disorder," and "hearing impairment" refer to a hearing dysfunction resulting from degeneration and/or damage of extracochlear hair cells.

Cis regulatory elements

Gene expression is dependent on two key components: one is a cis-regulatory element (CRE) consisting of a Transcription Factor (TF) binding site and other non-coding DNA sufficient to drive gene expression in a controlled temporal and spatial manner; the other is a trans-acting factor, such as TF that binds CRE. Promoters and enhancers are two major types of CRE. Promoters are usually close to the transcription start site, but promoters alone can only produce a minimal level of mRNA expression (Brown and Feder, 2005). Enhancers are widely distributed upstream, downstream, introns, or distal to individual genes and are critical for CRE differentiation. For example, one of the Atoh1 gene enhancers, located about 2 kb downstream of its 3' -UTR, is thought to be involved in determining the expression level of Atoh 1. Only cochlear sensory precursor cells expressing high levels of Atoh1 eventually develop into HC. Furthermore, gene expression is often controlled by multiple enhancers. Each enhancer may affect the expression pattern of a gene in a particular cell type or at a particular developmental stage.

Thyroid Hormone (TH) is a trans-acting factor, and a TH Response Element (TRE) plays a crucial role in regulating the expression of rat Prestin, and is presumed to be distributed in long intron 2 (. about.20 kbp) between exon 2 and exon 3 of rat Prestin. However, genetic evidence in vivo has not proven the importance of intron 2 sequences. In addition, it is not clear which part is the critical CRE, because 20 kbbp is too long to act as a driver to activate ectopic expression of specific genes in OHCs, finding a critical and short CRE provides a deeper understanding of the molecular mechanisms that reveal specific Prestin expression patterns in OHCs, and finding an outer hair cell specific CRE is of great clinical significance for gene therapy of deafness.

The invention provides a specific cis-regulatory element of an outer hair cell of a cochlea, wherein the cis-regulatory element comprises the amino acid sequence shown as SEQ ID NO: 1 or SEQ ID NO: 2 for driving the expression of effector genes specifically in cochlear outer hair cells. The cis-regulatory element is a 1.4kb sequence (SEQ ID NO: 1) located in mouse Prestin intron 2, which has about 80% sequence identity to a 398bp sequence (SEQ ID NO: 2) in human Prestin intron by sequence alignment. In the present example, AAV viruses constructed with the mouse 1.4kb sequence and the human 398bp sequence were able to express effector genes specifically in extracochlear hair cells.

Effector gene

As used herein, the term "effector gene" refers to any gene capable of being expressed in the outer hair cells of the cochlea. The sequence of the effector gene may be a sequence derived from the coding region (CDS) or open reading frame, or a sequence having at least 85% sequence identity with the sequence of the coding region (CDS) or open reading frame.

In another preferred embodiment, the "effector gene" refers to a gene that can be expressed and exert efficacy in extracochlear hair cells. Including but not limited to, those related to morphology, function of outer hair cells of the cochlea. For example, the efficacy of maintaining the sound sensitivity of the outer hair cells of the cochlea. In a preferred embodiment of the present invention, the effector gene is a gene encoding a Prestin protein.

Prestin

Prestin is a motor-type membrane protein encoded by the Slc26a5 gene and expressed specifically and persistently in the outer hair cells of the cochlea. The main function of Prestin protein is to help outer hair cells to stretch their own length when sound comes, thereby increasing the sensitivity of human or animal to sound. Both Prestin-/-mice and the population carrying the Prestin point mutation had a marked reduction in hearing capacity, and the outer hair cells of Prestin-/-mice developed progressive cell death from the high to low frequency region with age.

Prestin's information such as https:// www.ncbi.nlm.nih.gov/protein/? the information of the Slc26a5 gene, shown in term of Prestin, is https:// www.ncbi.nlm.nih.gov/gene/? term — Slc26a 5. As used herein, the term "gene encoding a Prestin protein" refers to the Slc26a5 gene. In preferred embodiments herein, the Prestin protein is preferably a human or mouse Prestin protein.

Adeno-associated virus

Adeno-associated virus (AAV), also called adeno-associated virus, belongs to the genus dependovirus of the family parvoviridae, is the simplest single-stranded DNA-deficient virus of the currently discovered class, and requires a helper virus (usually adenovirus) to participate in replication. It encodes the cap and rep genes in inverted repeats (ITRs) at both ends. ITRs are crucial for replication and packaging of viruses. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cells.

The recombinant adeno-associated virus (rAAV) is derived from non-pathogenic wild adeno-associated virus, is considered to be one of the most promising gene transfer vectors due to the characteristics of good safety, wide host cell range (divided and non-divided cells), low immunogenicity, long time for expressing foreign genes in vivo and the like, and is widely applied to gene therapy and vaccine research in the world. Over 10 years of research, the biological properties of recombinant adeno-associated viruses have been well understood, and many data have been accumulated on the application effects of recombinant adeno-associated viruses in various cells, tissues and in vivo experiments. In medical research, rAAV is used in the study of gene therapy for a variety of diseases (including in vivo, in vitro experiments); meanwhile, the gene transfer vector is used as a characteristic gene transfer vector and is widely applied to the aspects of gene function research, disease model construction, gene knock-out mouse preparation and the like.

Expression vectors and host cells

The invention provides an expression vector, which comprises an expression cassette, wherein the expression cassette has a structure shown in a formula I from 5 'end to 3' end:

Z0-Z1-Z2-Z3-Z0’ (I)

in the formula (I), the compound is shown in the specification,

each "-" is independently a chemical bond or a nucleotide linking sequence;

z0 is none, or a 5' UTR sequence;

z1 is the nucleotide sequence of the cis-regulatory element of the specificity of the cochlear outer hair cell;

z2 is a promoter sequence;

z3 is the nucleotide sequence of an effector gene; and

z0 'is a null, or 3' UTR sequence.

With the sequence information provided, the skilled artisan can use available cloning techniques to generate nucleic acid sequences or vectors suitable for transduction into cells.

Preferably, the nucleic acid sequence encoding the Prestin protein is provided as a vector, preferably as an expression vector. Preferably, it may be provided as a gene therapy vector, preferably suitable for transduction and expression in a target cell (e.g. a cochlear support cell). The vector may be viral or non-viral (e.g., a plasmid). Viral vectors include those derived from adenovirus, adeno-associated virus (AAV), including mutated forms, retroviruses, lentiviruses, herpes viruses, vaccinia virus, MMLV, GaLV, Simian Immunodeficiency Virus (SIV), HIV, poxviruses, and SV 40. Preferably, the viral vector is replication defective, or may be replication deficient, replication capable or conditionally replicating. Viral vectors can generally remain extrachromosomal without integrating into the genome of the target cell. A preferred viral vector for introducing an expression cassette of the invention into a target cell is an AAV vector. Selective targeting can be achieved using specific AAV serotypes (AAV serotype 2 through AAV serotype 12) or modified versions of any of these serotypes. In a preferred embodiment of the invention, the AAV vector is preferably AAV2.7m8, AAV-ie or AAV-Anc 80.

The viral vector may be modified to delete any non-essential sequences. For example, in AAV the virus may be modified to delete all or part of the IX gene, Ela and/or Elb gene. Replication is very inefficient for wild type AAV, without the presence of helper viruses such as adenovirus. For recombinant adeno-associated viruses, preferably, the replication and capsid genes are provided in trans (in the pRep/Cap plasmid), and only the 2 ITRs of the AAV genome are retained and packaged into virions, while the desired adenoviral genes are provided by adenovirus or another plasmid. Similar modifications can be made to lentiviral vectors.

Viral vectors have the ability to enter cells. However, non-viral vectors such as plasmids may be complexed with agents to facilitate uptake of the viral vector by the target cell. Such agents include polycationic agents. Alternatively, a delivery system such as a liposome-based delivery system may be used. The vector for use in the present invention is preferably suitable for use in vivo or in vitro, and preferably for use in humans.

The vector will preferably comprise one or more regulatory sequences to direct expression of the nucleic acid sequence in the target cell. Regulatory sequences may include promoters, enhancers, transcription termination signals, polyadenylation sequences, origins of replication, nucleic acid restriction sites, and homologous recombination sites, operably linked to a nucleic acid sequence. The vector may also include a selectable marker, e.g., to determine expression of the vector in a growth system (e.g., a bacterial cell) or in a target cell.

By "operably linked" is meant that the nucleic acid sequences are functionally related to the sequences to which they are operably linked, such that they are linked in a manner that affects the expression or function of each other. For example, a nucleic acid sequence operably linked to a promoter will have an expression pattern that is affected by the promoter.

The promoter mediates expression of the nucleic acid sequence linked thereto. Promoters may be constitutive or may be inducible. The promoter may direct the expression of the gene ubiquitously in cochlear cells, or specifically in cochlear cells. In the latter case, the promoter may direct cell type specific expression, such as an extracochlear hair cell. Suitable promoters will be known to those skilled in the art. For example, suitable promoters may be selected from the group consisting of: hsp68, L7, thy-1, recoverin, calbindin, human CMV, GAD-67, chicken actin, CAG, CBA and the like, but not limited to the group. Furthermore, gene expression targeting specific cells can also be achieved using cell-specific promoters.

In a preferred embodiment of the invention, an example of a suitable promoter is the Hsp68 promoter. In addition, one example of a suitable promoter is the immediate early Cytomegalovirus (CMV) promoter sequence. The promoter sequence is a strong constitutive promoter sequence capable of driving high level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). However, other constitutive promoter sequences may also be used, including, but not limited to, the simian virus 40(SV40) early promoter, the Mouse Mammary Tumor Virus (MMTV), the Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, the MoMuLV promoter, the avian leukemia virus promoter, the Epstein-Barr (Epstein-Barr) virus immediate early promoter, the rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, the actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch that is capable of turning on expression of a polynucleotide sequence operably linked to the inducible promoter when expression is desired, or turning off expression when expression is desired to be turned off. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.

The invention also provides a host cell for expressing the Prestin protein. Preferably, the host cell is a mammalian cell (preferably a human, more preferably a human cochlear outer hair cell).

Pharmaceutical formulations and compositions

The present invention provides a pharmaceutical formulation or composition comprising (a) the combination of active ingredients according to the second aspect of the invention, or the expression vector according to the third aspect of the invention, or the host cell according to the fourth aspect of the invention, and (b) a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the pharmaceutical formulation is for the treatment of hearing impairment.

In another preferred embodiment, the pharmaceutical formulation is for use in treating degeneration and/or damage of cochlear outer hair cells.

The "active ingredient" in the pharmaceutical preparation of the present invention refers to a vector (vector) of the present invention, such as a viral vector (including adeno-associated viral vectors). The "active ingredients", formulations and/or compositions described herein may be used to treat hearing impairment. "safe and effective amount" means: the amount of active ingredient is sufficient to significantly ameliorate the condition or symptom without causing serious side effects. "pharmaceutically acceptable carrier or excipient (excipient)" refers to: one or more compatible solid or liquid fillers or gel substances which are suitable for human use and must be of sufficient purity and sufficiently low toxicity. By "compatible" is meant herein that the components of the composition are capable of being combined with the active ingredients of the present invention and with each other without significantly diminishing the efficacy of the active ingredient.

The composition may be a liquid or a solid, such as a powder, gel or paste. Preferably, the composition is a liquid, preferably an injectable liquid. Suitable excipients will be known to those skilled in the art.

In the present invention, the vector may be administered to the subject by direct administration to the ear or cochlea. In either mode of administration, preferably, the carrier is provided as an injectable liquid. Preferably, the injectable liquid is provided as a capsule or syringe.

In the present invention, the host cell according to the present invention may be implanted into a subject for cochlear administration. Preferably, the host cell is provided as an injectable liquid.

Examples of pharmaceutically acceptable carrier moieties are cellulose and its derivatives (e.g. sodium carboxymethylcellulose, sodium ethylcellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (e.g. stearic acid, magnesium stearate), calcium sulfate, vegetable oils (e.g. soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (e.g. propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (e.g. tween, etc.)

) Wetting agents (e.g., sodium lauryl sulfate), coloring agents, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, and the like.

The compositions may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols and suitable mixtures thereof.

Method of treatment

The present invention provides a method of repairing and/or regenerating cochlear outer hair cells, the method comprising transducing the active ingredient combination of the second aspect of the invention, or the expression vector of the third aspect of the invention, into degenerated or damaged cochlear outer hair cells.

The present invention provides a pharmaceutical formulation or composition comprising the active ingredient combination of claim 3, or the expression vector of claim 4, or a host cell containing said expression vector, and a pharmaceutically acceptable carrier or excipient for use in a method of treating hearing impairment by repairing and/or regenerating cochlear outer hair cells. The pharmaceutical formulation or composition of the invention may be administered alone or in combination with (e.g. formulated in the same pharmaceutical composition as) other therapeutic agents.

The invention also provides a method of treating hearing impairment, comprising administering to a subject a pharmaceutical formulation or composition of the invention. The hearing impairment is hearing impairment associated with degeneration and/or damage of outer cochlear hair cells. The method comprises administering the expression vector of the invention directly to the ear (cochlea) of a subject in need thereof. The method further comprises directly implanting the host cell of the invention into a cochlea of a subject in need thereof.

As used herein, repairing and/or regenerating an extracochlear hair cell means a cell that has not previously possessed, or whose extracochlear hair cell capacity has been completely or partially degraded, and which, upon expression of a foreign nucleic acid sequence therein using an expression vector according to the present invention, becomes a cell possessing the characterization and function of the extracochlear hair cell.

The main advantages of the invention are:

(1) the cis-regulatory element provided by the invention drives Prestin expression in the cochlear outer hair cells specifically, and the AAV constructed by using the cis-regulatory element only enables effector genes contained in a virus vector to be expressed in the cochlear outer hair cells specifically.

(2) The cis-regulatory element of the invention has short sequence, only 1.4kb, even only 398bp, low difficulty in constructing the vector and compatibility with the vector with small molecular weight.

(3) The cis-form regulatory element has application value in the aspect of clinical gene therapy of hearing diseases such as deafness and the like caused by cochlear outer hair cell mutation.

The invention is further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: conditions described in a Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Methods and materials

Animal feeding

All mice were housed in the animal room according to a conventional 12 hour light/dark alternating schedule. Both male and female mice were used in the experiment. All animal feeding operations were performed according to the guidelines for laboratory animal Care and use of the national institutes of health and approved by the IACUC guidelines of the institute of neuroscience, Chinese academy of sciences (NA-032-2019).

Selection of high efficiency sgrnas

All sgrnas used herein were pretested in mouse one-cell stage zygotes. For testing, each sgRNA was injected into mouse fertilized eggs at a concentration of 50ng/ul together with Cas9 mRNA (100ng/ul), cultured for 3 days until blastocyst development stage, DNA was extracted, PCR amplified and Sanger (Sanger) sequenced. Each sgRNA was tested with 6 zygotes, and the criterion for effective sgrnas was considered to be that at least 3/6 zygotes were cleaved at the position targeted by the sgRNA.

The sgRNA sequences used herein are shown in the following table:

name (R)	Sequence 5 '-3'	SEQ ID NO:
			sgRNA-1	ACAATAGAAATCTCCATACG	3
sgRNA-2	GGTCTTGCTATGTTGAACAG	4
			sgRNA-3	AAAGGATTAATTAGCTACCC	5
sgRNA-4	GGATATATAAGAATACTCAT	6
			sgRNA-5	AGAAGTGCTCAGCAATTGTG	7
sgRNA-6	TAAAAATGTACCTGTGACTC	8
			sgRNA-7	CTTTATCATCATAACTTTAT	9
sgRNA-8	AACAATATACAAGATTTCCC	10
			sgRNA-9	GAACCAAGAACTAGTGTCAG	11
sgRNA-10	GTGAACTCCAGTTTCTCATA	12
			sgRNA-11	CATGAAACTAGCTGCCCACA	13

Construction of different Prestin intron mutant mice by using CRISPR/Cas9 system

The sgRNA-1 and the sgRNA-4 are used for constructing a Prestin-13k intron knockout mouse, the sgRNA-1 and the sgRNA-2 are used for constructing a Prestin-4k-1 intron knockout mouse, the sgRNA-2 and the sgRNA-3 are used for constructing a Prestin-5k intron knockout mouse, and the sgRNA-3 and the sgRNA-4 are used for constructing a Prestin-4k-2 intron knockout mouse. Cas9 mRNA (100 ng/. mu.l) and two different combinations of sgRNAs (50 ng/. mu.l each) were co-injected into one-cell fertilized eggs of mice and then implanted into pseudopregnant females. Performing mouse tail PCR identification on the F0 mouse, and carrying out passage after crossing the positive mouse and the wild mouse.

Additionally, 7 effective sgRNAs were selected at approximately 500 base intervals within the Prestin-4k-1 intron, and random DNA deletions were generated in the left segment of the Prestin-4k intron by co-injection of Cas9 mRNA (100 ng/. mu.l) and the first set of sgRNAs (sgRNAs-1, 5, 6, 7, 8, 50 ng/. mu.l) in one-cell mouse zygotes; the random DNA deletion of the right segment of the Prestin-4k intron was generated by co-injection of Cas9 mRNA (100 ng/. mu.l) and a second set of sgRNAs (sgRNAs-8, 9, 10, 11, 2, 50 ng/. mu.l) into single-cell mouse zygotes. All F0 mice were analyzed for F0 generation homozygotes using rat tail DNA PCR screening and Sanger sequencing analysis, and the resulting F0 generation heterozygotes were cross-passaged with wild mice.

Construction of Prestin 1.4k-hsp68-EGFP + transgenic mice and Virus preparation

A Prestin 1.4k bp fragment is obtained by PCR by taking mouse genome DNA as a template and is subcloned into a vector containing PiggyBac 5 'homologous arm and 3' homologous arm sequences, a heat shock protein 68(hsp68) mini promoter and EGFP. Using the T7 promoter and mMACHINE^TMThe T7 super transcription kit (Cat #: AM1345, Thermo Fisher Scientific) transcribes PiggyBac transposase mRNA in vitro. Purified Prestin 1.4k-hsp68-EGFP + vector (50 ng/. mu.l) was co-injected with PiggyBac transposase mRNA (100 ng/. mu.l) into small miceThe fertilized eggs are implanted into a pseudopregnant female mouse in the first cell stage of the mouse. F0 mice first underwent rat tail PCR screening, and identified transgenic insert positive mice directly analyzed phenotype or with wild type mice hybridization, establishment of stable mouse strains. AAV virus production is completed in the gene editing platform of neuroscience research institute of Chinese academy of sciences.

Sample preparation and immunofluorescence staining

Inner ear tissue from P5 mice was harvested and fixed overnight at 4 ℃ in 4% PFA. Mice of P14, P21, P30 and P60 were perfused with 1xPBS and 4% PFA, respectively, and the inner ear was removed and fixed in 4% PFA overnight at 4 ℃. The fixed tissue was washed 3 times with 1xPBS and then treated with EDTA (120mM) decalcification (P14 and P21 tissues decalcification overnight, P30 and P60 tissues decalcification for 2-3 days). Whole-mount staining, cochlear tissue was first incubated with 1% Triton X-100(X-100, Sigma) and 5% BSA (Cat #: BP1605, Fisher Scientific) in blocking solution for 1 hour at room temperature, followed by primary antibody incubation with 0.1% Triton X-100 and 5% BSA at 4 ℃ overnight.

The primary antibodies used in this study were anti-Prestin (goal, 1:500, Cat #: sc-22692, Santa Cruz Biotechnology), anti-Prestin (rabbit,1:50000, ab242128, Abcam, produced by the laboratory in cooperation with Abcam), anti-myostatin-VI (rabbit,1:500, Cat #:25-6791, protein Bioscience), anti-GFP (chicken,1:1000, Cat #: ab13970, Abcam).

The following day, 3 washes with 1xPBS containing 0.1% Triton X-100, followed by incubation with secondary antibody Alexa 488Donkey anti-goat IgG (Cat #: # A11055, Molecular Probes) for 2 hours at room temperature; alexa568donkey anti-rabbit IgG (Molecular Probes, # A10042); alexa 488donkey anti-chicken IgG (Cat #: 703-. After the secondary antibody had been incubated, it was washed three times with 1xPBS containing 0.1% Triton X-100, and the sample was counterstained with Hoechst33342(1:1000, Cat #:62249, Thermo Scientific) to visualize the nuclei. The stained sample was mounted with Prolong gold mounting tape (Cat #: P36930, Thermo Scientific). The specimens were scanned and photographed by a Nikon C2 confocal microscope, and the photographed images were analyzed by Image-J (NIH) software.

Whole tissue RNA in situ hybridization

The Prestin-specific RNA probe covers exons 4-6 of Prestin, is 384 bases in length, and is subcloned into the pBluescript-II vector containing the T3 promoter. The final vector was linearized with NotI (Cat #: R3189s, New England BioLabs) and transcribed using T7 RNA polymerase (Cat #: P2075, Promega). The nucleic acid probes were labeled using Digoxigenin (DIG) kit (Cat #:11277073910, Roche).

The inner ear tissue of P5 mice was dissected out and fixed in 4% DEPC-PFA overnight at 4 ℃. The cochlear shell is partially knocked down in order to allow better binding of the RNA probe to the sensory epithelium. The first day of the experiment, DEPC-PBS and DEPC-PBS containing 0.1% tween-20 (P1379, Sigma) were washed three times, then incubated with 5 μ g/ml proteinase K (Cat #:25530049, Thermo fisher) for 10 minutes at room temperature, followed by a secondary fixation with DEPC-4% PFA for 10 minutes at room temperature, followed by a10 minute incubation with 0.1M rnase-free triethanolamine (Cat #: V900257, Sigma) at room temperature. Then prehybridization was carried out for 2 hours with 1ml of a hybridization solution containing 50% formamide (Cat #:15515026, Thermo fisher), 250. mu.g/ml yeast RNA (Cat #:10109495001, Roche) and 500. mu.g/ml herring sperm DNA (Cat #:15634017, Thermo fisher), and hybridization was carried out overnight at 65 ℃ with a hybridization solution containing 0.5 ng/. mu.l of digoxin-labeled Prestin antisense strand RNA probe after completion of the prehybridization. The following day, the tissues were rinsed with 1XTBST and further electrophoresed in TAE buffer at 60V for 2 hours, followed by incubation with anti-DIG-AP antibody (Cat #:11093274910, Roche) overnight at 4 ℃. On the third day, a color reaction was performed using NBT/BCIP kit (Cat #:11681451001, Roche), and the color-developed sample was mounted with Prolong gold mounting plate (Cat #: P36930, Thermo Scientific), photographed with Olympus VS120 microscope, and subjected to subsequent data analysis using ImageJ (NIH) software.

Manual cell picking and qPCR analysis

Mouse models of the following three genotypes were used for the experiments:

1)Atoh1-CreER+；Ai9/+

2)Atoh1-CreER+；Ai9/+；Prestin-13k/+

3)Atoh1-CreER+；Ai9/+；Prestin-13k/Prestin-13k，

these three models were used to select wild-type hair cells, heterozygous knockout hair cells for the Prestin-13k intron sequence, and homozygous knockout hair cells for the Prestin-13k intron sequence, respectively. All mice were induced at P0, P1 at 3mg/40g mouse weight with tamoxifen (Cat #: T5648, Sigma), dissolved in corn oil (Cat #: C8267, Sigma), with inner and outer hair cells marked red by tdTomato, and tdTomato positive cells were manually selected at P5. This experiment was repeated three times, with each set of experiments containing three genotypes, with approximately 20-25 hair cells selected for each genotype. Dissection of the inner ear, manual cell selection and qPCR experimental procedures were as described in the previous article (Li et al, 2020 a; Li et al, 2018; Li et al, 2020 b). Total RNA inverted cDNA of P11 cochlear tissue was used as a normalization reference, and Prestin, Myosin-VI and GAPDH (internal reference gene) primers were selected by calculating amplification efficiency from a standard curve.

Testing of Auditory Brainstem Response (ABR)

Mice at 14.5 days, 21 days, 30 days and 60 days after taking out are divided into a homozygous group, a heterozygous group and a wild type group, at least 6 mice in each group are subjected to Auditory Brainstem Response (ABR) test, and 7 frequencies are detected in total: 4kHz, 5.6kHz, 8kHz, 11.3kHz, 16kHz, 22.6kHz and 32 kHz. The hearing data were analyzed using Excel and Graphpad prism 8 software.

The specific steps of the ABR test are as follows:

1) mice were weighed on an electronic balance and anesthetized by intraperitoneal injection with chloral hydrate (Cat #:23100, Sigma,480 mg/kg).

2) The anesthetized mouse is placed in a sound insulation chamber, a body temperature controller (Cat #:55-7020, Harvard Apparatus) is turned on, a temperature probe is placed below the body of the mouse, and the constant temperature of 37 ℃ is set.

3) Placing an electrode: electrodes were inserted subcutaneously at the cranial crown (recording electrode), right mastoid (reference electrode) and left shoulder (ground electrode), respectively. The preamplifier was turned on and the resistance was confirmed to not exceed 1 k.

4) ABR testing was performed using biosignz software under an open sound field.

A loudspeaker (MF1, Tucker-Davis Technologies, Inc, Alachua, FL, USA) is placed 10cm away from the two ears of the mouse, a 3 ms-long Toneburst short pure tone signal is adopted as a stimulating sound, the time length of voltage rising and voltage falling is 1ms, the short pure tone stimulating frequency is 20 times/second, the recording time is 15ms, and the average superposition is 400 times. The maximum stimulation sound intensity is 90dB SPL, the short pure tone intensity range is from 0 to 90dB SPL, the minimum stimulation intensity capable of distinguishing the ABR waveform is determined as a threshold value every 5dB step and is repeated for 2 times. Detection was performed in the order of 32kHz, 22.6kHz, 16kHz, 11.3kHz, 8kHz, 5.6kHz, 4 kHz.

5) After the detection, the mice are kept at the constant temperature of 37 ℃ until the mice are completely recovered.

Outer hair Cell Whole Cell Patch Clamp recordings (wheel Cell Patch Clamp Recording)

The temporal bone of the mouse was placed in extracellular fluid and the apical ring basement membrane was dissected out for further patch clamp experiments. All patch ranges correspond to hearing ranges between about 8kHz and 11 kHz. An AXON patch clamp system was used for the experiments, including an AXON200B patch clamp amplifier and a Digidata 1440B digital to analog converter. A glass microelectrode with an inner core (Cat #:1B150F-4, World Precision Instruments) was drawn to a tip impedance between 4-6M using a PC-100(Narige) glass microelectrode drawing machine. All patch clamp recordings and data analyses were performed using jClamp software. In recording the nonlinear membrane capacitance (NLC) of outer hair cells, the composition of the extracellular fluid is as follows: 136mM NaCl (Cat #: S7653, Sigma),1mM CaCl2(Cat #: C5080, Sigma),1mM MgCl2(Cat #: M2670, Sigma), and 10mM HEPES (Cat #: H3375, Sigma), pH was adjusted to 7.2 to 7.4 using NaOH (Cat #: S8045, Sigma) solution, and osmotic pressure was adjusted to 300mOsm using D-Glucose (Cat #: G8270, Sigma). The composition of the intracellular fluid was the same as that of the external fluid, but 10mM EGTA (Cat #: E4378, Sigma) was added. A10 mV continuous high-resolution bi-sinusoidal (390.6 Hz and 781.2Hz, respectively in frequency) stimulus was applied to a ramp voltage ranging from +150mV to-150 mV for 300 ms. The first derivative of the two-state Boltzmann function (two-state Boltzmann function) is used to fit the resulting data:

wherein

In the above formula, Qmax is the maximum value of nonlinear charge transfer, Vpkcm is the voltage value corresponding to the peak value of the membrane capacitance, and is also equal to half of the maximum charge transfer amount, Vm is the membrane potential, z is the ionic valence number, Clin is the linear membrane capacitance, e is the electronic capacity, k is the Boltzmann constant, and T is the absolute temperature value. The parameter reports were taken in the form of Mean ± SEM and were counted using one-way anova with GraphPad Prism 8.0 software (GraphPad, San Diego, US).

Example 1

Deletion of 13k bp fragment of Prestin intron 2 inhibits Prestin expression

The DNA sequence similarity of intron 2 between rat (. about.20 kbp) and mouse (. about.14.5 kbp) was 82.9%. Intron 2 of rat Prestin is considered to be critical for the specific expression of Prestin. The 14.5kb DNA fragment was first deleted by CRISPR/Cas9 method to determine its importance in mouse Prestin expression (FIGS. 1A-C). Two previously tested effective sgrnas (sgRNA-1 and sgRNA-4) were located at the 5 'and 3' ends of intron 2, respectively (fig. 1A). A mouse strain lacking a DNA fragment 6(13503bp, about 13kbp) between the sgRNA-1 and the sgRNA-4 was designated as a 13kb deletion mutant of Prestin intron 2 (Prestin-13 k/+). Both the Prestin-13k/+ heterozygote and the Prestin-13k/Prestin-13k homozygote mutant mice were healthy fertile mice. RNA in situ hybridization analysis showed that although Prestin was specifically detected in OHC (n ═ 3) of wild-type P6, Prestin was not detected in OHC of P6 Prestin-13k/Prestin-13k mutant mice (n ═ 3) (FIGS. 1D-E). Similarly, Prestin protein was clearly detected in all OHCs of wild type (n ═ 3), but Prestin was completely absent in OHCs of Prestin-13k/Prestin-13k mice (n ═ 3) at P5 (fig. 1F-G). Therefore, a 13 kbbp DNA fragment in intron 2 is considered to be necessary for the prompt initiation of Prestin.

It was next determined whether the transcription of intracochlear Prestin of heterozygous Prestin-13k/+ of P5 was affected, since previous results indicated that the Prestin mRNA in the heterozygous Prestin +/-was approximately half that in the wild type cochlea. However, the immunostaining and in situ RNA analysis described above did not show significant differences between wild-type and heterozygotes, partly because of their lower sensitivity. Thus, in three different models, a more sensitive qPCR analysis was applied to Tdtomato gene-tagged HCs (IHC and OHC): 1) atoh1-CreER +; rosa26-CAG-LSL-Tdtomato (Ai9)/+ (wild type HC); 2) atoh1-CreER +; ai 9/+; prestin-13k/+ (heterozygous mutant HC); 3) atoh1-CreER +; ai 9/+; prestin-13k/Prestin-13k (homozygous mutant HC). All mice were dosed with tamoxifen at P0 and P1. The cochlea was digested, Tdtomato + HC was manually picked, and RNA extraction and q-PCR analysis were performed at P5 (FIG. 1H). Three replicates were performed in each model, each replicate containing approximately 20 HCs.

q-PCR analysis showed that Prestin mRNA in heterozygote mutant HCs was statistically lower than that of wild-type HCs (FIG. 1I). As expected, the difference in Prestin was further significant between wild-type and homozygous mutant HCs (. about.. p <0.001) (fig. 1I). In contrast, no statistical differences were detected for Myo6 mRNA in HCs of the three genotypes (FIG. 1J). Note that qPCR analysis should underestimate the differences in Prestin mRNA in different models, since at present it is not technically guaranteed that all Tdtomato + cells are OHCs. Nonetheless, in agreement with previous reports, q-PCR data showed that deletion of 13kbp reduced expression of Prestin mRNA in a dose-dependent manner, but did not affect expression of other HC genes (e.g., Myo 6).

Example 2

Deletion of the near 5' 4k bp fragment of Prestin intron 2 repeats the phenotype of the Prestin-13k mutant

It was further determined which of the 13k bp fragments was necessary for Prestin expression. Using two additional sgRNA-2 and sgRNA-3, 13 kbbp previously tested for Prestin, were successfully divided into three approximately equal-length fractions (FIG. 2A). Through the combination between sgRNA-1 and 2 (# 4254bp), sgRNA-2 and 3 (# 5177bp), and sgRNA-3 and 4 (# 4080bp), three new mutant mice were generated, which were named Prestin-4k-1 (# 1 in FIG. 2A), Prestin-5k (#2 in FIG. 2A), and Prestin-4k-2 (# 3 in FIG. 2A), respectively. It was demonstrated that the mutant of Prestin-4k-1, but not the mutants of Prestin-5k and Prestin-4k-2, replicated the phenotype of the above mutant of Prestin-13 k. Thus, only the characteristics of the Prestin-4k-1 mutant are reported here (FIG. 2B). Both heterozygous Prestin-4k-1/+ and homozygous Prestin-4k-1/Prestin-4k-1 mutant mice were healthy and fertile and were easily identified by tail PCR (FIG. 2C).

Prestin is specifically expressed in wild-type OHC (FIG. 2D-D '), but not detected in OHC's of homozygous Prestin-4k-1/Prestin-4k-1 mutants (FIG. 2E-E '). And OHC of Prestin-4k-1/Prestin-4k-1 mice gradually restored Prestin expression at P14 and P60. The wild type, heterozygote and homozygote Prestin-4k-1 mutants, P14.5 and P60, were further subjected to NLC assay (FIGS. 2F and G). The Prestin-4k-1 mutant is similar to or overlaps with the OHC's corresponding to the Prestin-13k mutant. More importantly, no statistical differences were detected between Prestin-4k-1/+ and Prestin-13k/+ as well as between Prestin-4k-1/Prestin-4k-1 and Prestin-13k/Prestin 13k at P14.5 and P60 in terms of the number of Prestins (FIGS. 2H and I). In addition, there was no statistical difference in cell size and Prestin density. In conclusion, the loss of the 4k bp fragment near the 5' end of intron 2 has a very similar phenotype to the loss of the entire 13k bp fragment.

Example 3

Timely expression of Prestin requires a 1.4kb fragment of Intron 2

Next, it was planned to identify a CRE fragment smaller than 1.5 kbp in the 4 kbp range, which meets two criteria: 1) it is necessary for the timely expression of Prestin; 2) when bound to a mini-promoter, it can efficiently drive EGFP expression in OHCs, but not in IHCs or other cell types. 7 more potent sgrnas were pre-selected (# 5 to #11), which were distributed approximately every 500bp between sgRNA-1 and 2 (fig. 3A). Multiple sgRNAs and Cas9 may produce homozygous mutant F0 mice in single-cell fertilized eggs because of random DNA homozygous deletions between sgRNAs. Thus, these sgrnas are divided into two subgroups: 1) group 1 includes the 5 sgrnas on the left (sgrnas-1, 5, 6, 7, and 8); 2) group 2 includes the 5 sgrnas on the right (sgrnas-8, 9, 10, 11, and 2). Group 1 sgrnas (fig. 3B) or group 2 sgrnas (fig. 3C) were injected into single-cell stage zygotes along with Cas9 mRNA. Tail DNA PCR and Sanger sequencing were performed on 32 founder0(F0) mice from group 1. 12/32 mice clearly showed 7 different types of DNA deletions. Failure to generate clean PCR amplicons in other mice may be due to random insertion of large DNA fragments. More importantly, 1/32 mice appeared to be homozygous deletions of 1429bp (simply 1.4 kbbp) between sgRNA-1 and 7 (fig. 3D). Cochlear samples from this F0 mouse were immediately co-stained with Prestin and Myo6 (fig. 3E-F'). OHC's expressing higher Prestin were wild type genotypes (arrow in FIG. 3F-F'), while OHC's expressing lower or undetectable Prestin were homozygous deletion genotypes of 1.4 kbp (asterisks in FIG. 3F-F'). The chimeric expression pattern of Prestin showed that this 1.4kb chimeric homozygote deletion occurred in the cochlea, while the chimeric pattern of the tail tissue was much less.

In addition to the chimeric homozygous F0 mice analyzed above, other F0 mutant mice were also mated with wild type mice to reproduce germ cell stable mutant mice. Heterozygote-deficient mice from group 1 sgrnas were analyzed collectively: 522bp (Prestin-522/+) and 910bp (Prestin-910/+). The 522bp and 910bp fragments together occupy a 1.4 kbp region. Briefly, Prestin was absent from OHC's of homozygous Prestin-910/Prestin-910 mice of P5. No Prestin was detected in OHC from P5 mice homozygous for Prestin-522/Prestin-522. Of the 43F 0 mice derived from only group 2 sgrnas, only 2/43 mice clearly showed a hybrid DNA deletion of 2329bp and 2013bp, respectively. 2329bp deleted F0 mice were selected for germ cell passage. The 2329bp homology deletion had no effect on Prestin expression. Overall, deletion of 1.4 kbp or a portion (522bp or 910bp) inhibited Prestin expression in OHC of P5. Thus, 1.4 kbp between sgRNA-1 and sgRNA-7 was considered to be a key CRE element for Prestin expression. Whether the 1.4kb fragment is a potentially critical Prestin enhancer will be verified by transgenic mouse methods.

Example 4

The 1.4k fragment of mouse Presin and the 398bp fragment of human Prestin can specifically drive the expression of green fluorescent protein in cochlear OHC

By using the PiggyBac method, a transgenic mouse strain (abbreviated Prestin-1.4k-EGFP +) was constructed in which EGFP was driven by a mini-promoter from the mouse heat shock protein 68kDa (Hsp68) and a 1.4kb fragment (FIG. 4A). If 1.4 kbp is used as Prestin enhancer, then the expression of EGFP will be unique in OHC. A total of 21 positive transgenic mice were obtained. First, 4/21 mice were randomly selected for direct analysis at P6, P14, P21 and P30, respectively. EGFP was strongly and specifically expressed in cochlear OHCs of all 4F 0 mice, but not in all aged IHCs. In addition, the expression characteristics of EGFP in either chimeric (FIGS. 4B-B ") or homogeneous (FIGS. 4C-C") form were observed in F0 mice.

6/21 mice were randomly selected for germ cell stable passage, of which 4/6 mice produced stable Prestin-1.4k-EGFP + progeny. 2/6 mice failed to produce stable Prestin-1.4k-EGFP + progeny, probably due to the absence of transgene insertion into germ cells. EGFP was expressed in all cochlear OHC's, but not in IHC or vestibular HC's of P6-stabilized Prestin-1.4k-EGFP + mice, as expected. Specific EGFP expression in OHCs was maintained at P21. In general, the 1.4kb fragment is an enhancer of Prestin.

Meanwhile, the homologous sequence alignment of the mouse 1.4k bp fragment is carried out, and the result shows that the 398bp fragment can be found to be homologous with the mouse 1.4k bp fragment of Prestin in the human Prestin genome, and the total similarity is 77% (FIG. 4D and FIG. 5). Similarly, a transgenic mouse line was constructed in which expression of EGFP was driven by the human Prestin 398bp and Hsp68 mini-promoter (FIG. 4E). As expected, EGFP was specifically expressed in cochlear OHC of F0 mice (fig. 4F-F "). Thus, both mouse 1.4kb and human 398bp Prestin intron fragments were sufficient to drive the expression of specific EGFP in cochlear OHC.

Example 5

AAV produced by using mouse 1.4k bp sequence and human 398bp sequence specifically infects cochlear OHC

AAV viruses were next planned to be generated for specific transfection of OHCs. AAV2.7m8 was chosen as viral expression vector. Aav2.7m8, similar to Anc80L65, is a powerful viral vector capable of efficiently infecting a variety of cell types, including cochlear IHC, OHC and SC. To confer the ability of virus-specific transfection of OHCs, the original CAG promoter in aav2.7m8 was replaced with the mouse 1.4kb Prestin enhancer (fig. 6A) or human Prestin 398bp (fig. 6C) and Hsp68 mini-promoter which together controlled the expression pattern of reporter EGFP.

Aav2.7m8-1.4k (mouse) and aav2.7m8-398bp (human) viruses were injected into the cochlea of a neonatal mouse (P3) through the round window and analyzed 14 days later. It is exciting that EGFP was specifically highly expressed in cochlear OHC of P17 mice by injection of aav2.7m8-1.4k (fig. 6B-B ') or aav2.7m8-398bp virus (fig. 6D-D'). Thus, both aav2.7m8-1.4k and aav2.7m8-398bp viruses are specifically and efficiently targeted to OHCs.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> China academy of sciences brain science and intelligent technology prominent innovation center

<120> cochlear outer hair cell specific cis-regulatory element and application thereof

<130> P2020-2885

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 1429

<212> DNA

<213> mouse (Mus musculus)

<400> 1

accacgtatg gagatttcta ttgtgcttgt attacctagg attctacctt aaaataaaag 60

cattagtttt aaagcaaata tttttagctc attggcttgg taacccagat atctctagtt 120

ttgaaaagtt ccttgaagaa agactagtgt tcggtcaaaa tagattacca agaactgacc 180

tgagaccctg tccttgtgaa cagaaacaaa gtcctcaaaa cttccctcat acacagccag 240

cagcagcccc acgctcacca aaggctcaca tgatgcacac gcatctctca gcagtggtcc 300

aggccgggct tcagtgtatc caggcacagg actgtgctgt gcctcctctc tactcccaca 360

atgctttgct gcgttctcag cttcccatct cctttgatgg gtgaaactct cgcctatctg 420

tgttgatcag ctgttctgaa aggccccagg agatgatagc atctcttctc tgggtatcca 480

tgccagtgtt taatagcctc ttgaaactgc cgagaagtgc tcagcaattg tgtggtgggg 540

aaggacggtg tcagcaagga ataaagatga tctctcgcct cgacggtagc tgaaatgtga 600

gtttctgtgt ccaggctcag ataaaaagtg atcctcacac ctttctcaag tagccagaga 660

cgattgaatt tctggaccag ggcaggaaaa caagagcatg ttgctaacct tgcttagtgc 720

tggggacctg atcttcttgc cattacattg tcatttctat cattctcatt cttgaaaaat 780

tatcctttga tttagagata acttatgaca atgtgactct ttatcttcat tttctttact 840

cctgtcttca tatcctaaat tacctataat atttaaaaaa aaagtgtaga tagtagactg 900

tcaggttagt acaagaatga aagacttgag ctgagaaaga aagaggtggt gagcgagtgg 960

caaggagcca tatttaattt cttcccccca cccccctttg gttcatcctc cagcttccca 1020

tcccacctgt attggtaaaa atgtacctgt gactcaggat ccttgtgttt tttgtggact 1080

tccatacagt gtgtagagca gcagctccat gggtgacctg gtgacctaga ttcacctgat 1140

ctgacccaga tggccaaccc cagggtctta gttaattctc gagaatgtct tgagctaggg 1200

gattctgaga ccagaaacct aagacccaca ggacctgttc tcctccaccc ttccagccac 1260

cattaaagac aactctaata ctggactcat ttgacaagct tattgctaat cataagatgt 1320

cacgcttttg agcataagta tacgaaagta aatgattctt taccaactgc ttacagtgaa 1380

tcaagagttg aacaaaggca ctagaaagat ggctttatca tcataactt 1429

<210> 2

<211> 398

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 2

ggtgtaattc tgcctatcca ggatgatcag ctgttcctaa aggtccccag agacgataac 60

atctctgctc tgagtatcca tgccagtgtt taatagcctc ttgaaatttt ctccttgaag 120

tgatctgtga cttgttgagg tggggaagaa ggtgtcagca ggggataagc atgatcaact 180

tgatcgtagc tgaaatgtga actttagtgg ccaaactgag ataaaaaatg atcctcacac 240

cttctcaagt agttgaagac tattgagtta ccagaactgg gagaggagaa aaagagcaca 300

ttgtttacct taattatttc ttgggaccta atcatgttgc cattacattg taaattctgt 360

agattttcac acttggaaaa ttcttcttaa atttagag 398

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

acaatagaaa tctccatacg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 4

ggtcttgcta tgttgaacag 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

aaaggattaa ttagctaccc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ggatatataa gaatactcat 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

agaagtgctc agcaattgtg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

taaaaatgta cctgtgactc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

ctttatcatc ataactttat 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

aacaatatac aagatttccc 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

gaaccaagaa ctagtgtcag 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

gtgaactcca gtttctcata 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

catgaaacta gctgcccaca 20

Claims (10)

1. Use of a combination of active principles for the preparation of a formulation or medicament for: (i) repair and/or regeneration of extra-cochlear hair cells (OHC); (ii) treating or preventing hearing impairment; and/or (iii) specific expression of effector genes in cochlear outer hair cells;

wherein the active ingredient combination comprises:

(a) a cochlear outer hair cell-specific cis-regulatory element;

(b) a promoter; and

(c) an effector gene or a coding sequence thereof.

2. The use according to claim 1, wherein the hearing impairment is hearing impairment associated with degeneration and/or damage of extracochlear hair cells.

3. The use according to claim 1, wherein the extracochlear hair cell-specific cis regulatory element has a nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2, and the effector gene is a gene for coding Prestin protein.

4. An active ingredient combination, characterized in that said combination comprises:

(a) a cochlear outer hair cell-specific cis-regulatory element;

(b) a promoter; and

(c) an effector gene or coding sequence thereof;

wherein, the nucleotide sequence of the cochlea outer hair cell specificity cis-form regulatory element is shown as SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

5. An expression vector comprising an expression cassette, wherein said expression cassette has the structure of formula I from 5 'to 3':

Z0-Z1-Z2-Z3-Z0’ (I)

in the formula (I), the compound is shown in the specification,

each "-" is independently a chemical bond or a nucleotide linking sequence;

z0 is none, or a 5' UTR sequence;

z1 is the nucleotide sequence of the cis-regulatory element of the specificity of the cochlear outer hair cell;

z2 is a promoter sequence;

z3 is the nucleotide sequence of an effector gene; and

z0 'is a null, or 3' UTR sequence.

6. A host cell comprising the expression vector of claim 5.

7. A pharmaceutical formulation, comprising: (a) the active ingredient combination according to claim 4, or the expression vector according to claim 5, or the host cell according to claim 6, and (b) a pharmaceutically acceptable carrier or excipient.

8. Use of an active ingredient combination according to claim 4, an expression vector according to claim 5, a host cell according to claim 6, or a pharmaceutical preparation according to claim 7 for the preparation of a medicament for the treatment or prevention of hearing impairment.

9. A method of repairing and/or regenerating outer hair cells of the cochlea comprising transducing the active ingredient combination of claim 4, or the expression vector of claim 5, into denatured or damaged outer hair cells of the cochlea.

10. Use of an extracochlear hair cell-specific cis regulatory element, wherein the cis regulatory element comprises the amino acid sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 2 for driving the expression of effector genes specifically in cochlear outer hair cells.

Images