CN114752706A - Method and kit for rapidly detecting human papilloma virus nucleic acid type - Google Patents
Method and kit for rapidly detecting human papilloma virus nucleic acid type Download PDFInfo
- Publication number
- CN114752706A CN114752706A CN202210382445.5A CN202210382445A CN114752706A CN 114752706 A CN114752706 A CN 114752706A CN 202210382445 A CN202210382445 A CN 202210382445A CN 114752706 A CN114752706 A CN 114752706A
- Authority
- CN
- China
- Prior art keywords
- rpa
- chip
- primer
- solution
- human papillomavirus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses a method and a kit for rapidly detecting human papilloma virus nucleic acid types, and belongs to the technical field of biology. The method provided by the invention mainly utilizes primers SEQ ID NO.1-2 and probes SEQ ID NO.5-28 to realize the identification of different types of human papilloma viruses, and comprises the following specific steps: (1) extracting DNA in a sample; (2) taking the DNA extracted in the step (1) as a detection template, and carrying out RPA amplification reaction by adopting an RPA primer; (3) dividing the amplified product into a plurality of parts, and adding different RPA probes for hybridization; (4) the RPA amplification products were analyzed. The invention adopts the RPA amplification technology to amplify the target segment, the amplified product is added on the gene chip to be hybridized, and the amplification time only needs 20 minutes to reach the detectable concentration of the target gene by adopting the RPA amplification technology, thereby greatly shortening the detection time.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method and a kit for rapidly detecting human papilloma virus nucleic acid types.
Background
HPV virus is the abbreviation of human papillomavirus, belongs to the genus of papillomavirus A in the family of papovaviridae, is a sexually transmitted disease caused by infection with spherical DNA virus, and is mainly classified into HPV1, types 2, 6, 11, 16, 18, 31, 33 and 35, etc., and long-term infection with HPV16 and 18 types may be related to cervical carcinoma of women.
Human Papilloma Virus (HPV) is an epitheliophilic Virus with high specificity and has long been known to cause benign tumors and warts in humans, such as Human common warts, condyloma acuminatum, and papillomas on mucous membranes growing on the skin and mucous membranes in the vicinity of the reproductive organs. Like hepatitis B virus, HPV is also a DNA virus.
The most commonly used virus nucleic acid specific gene detection methods at present mainly include isothermal amplification-gold probe chromatography, real-time fluorescence PCR method and gene chip detection method.
Isothermal RNA amplification-gold probe chromatography
Amplifying the product by adopting a constant temperature amplification mode, adding the amplified product into 30ul of novel coronavirus detection solution, hybridizing with a specific probe, finally completely dripping the mixed solution into a sample hole of a detection card, and reading the result by chromatography and color development. The method has relatively low cost, but one reagent card can only distinguish one type, and if 20 types of HPV virus detection is carried out, more than 20 reagent cards need to be manufactured, so that the cost is greatly increased, and the operation is complicated.
2. Real-time fluorescent PCR
Real-time fluorescence PCR is a rapid, simple and convenient infectious pathogen nucleic acid detection technology with relatively low cost and is widely used in clinic. The method adopts a multi-channel fluorescence detection technology, can perform typing detection on more than 20 types of 6-8 tubes, and although detection can also be performed, the cost of the fluorescence probe is relatively high, the cost of multi-tube detection is increased, and the operation is inconvenient.
3. Traditional gene chip detection method
Firstly, amplifying HPV nucleic acid fragments through PCR amplification, adding amplified products onto a gene chip for hybridization, and reading the product by adopting a fluorescence scanner or a reader after the processes of elution and the like to obtain HPV type information. The biochip hybridization detection method has the characteristics of high detection sensitivity, high specificity and high detection flux on the same chip. However, in the detection by the chip, firstly, specific segment nucleic acid of a detection sample needs to be amplified, and after amplification, a product is put on a gene chip for hybridization, the PCR amplification process generally passes through 40 cycles, the time is about 1.5 hours, the time is long, the PCR process needs specific PCR amplification equipment, in order to prevent pollution, the PCR process needs to be carried out under a special environment, and the equipment cost and the environmental cost are relatively high.
Disclosure of Invention
One of the purposes of the invention is to provide an RPA primer and an RPA probe for identifying human papillomavirus types, wherein the primer comprises an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO. 2; the RPA probe is shown in SEQ ID NO. 5-28.
The invention also aims to provide a kit for detecting the human papilloma virus type, which comprises the RPA primer and the RPA probe.
Preferably, the kit further comprises at least one of an RPA reaction tube, a positive control template, a negative control template.
It is a further object of the present invention to provide a method for detecting human papillomavirus type, the method comprising the steps of:
(1) extracting DNA in a sample;
(2) taking the DNA extracted in the step (1) as a detection template, and carrying out RPA amplification reaction by adopting the RPA primer in claim 1;
(3) dividing the amplified product into a plurality of parts, and adding different RPA probes for hybridization;
(4) the RPA amplification products were analyzed.
Preferably, the system for the RPA amplification reaction in step (2) is 50. mu.L, which is shown in the following table:
| composition of the system | Volume (uL) |
| BufferA | 20 |
| BufferB | 20 |
| Primer F (10umol/ml) | 2 |
| Primer R (10umol/ml) | 2 |
| Form panel | 2.5 |
| Buffer C | 2.5 |
Last using ddH2O is complemented to 50 mu L;
buffer A included 20% PEG35000, 10% trehalose, 250mM creatine phosphate, 12.5mM dithiothreitol, 250mM Tris-HCl, 12.5mM dNTPs, and 5mM ATP;
buffer B is 500ng recA recombinase, 360ng single-chain binding protein, 25ng phosphokinase, 150ng BSU polymerase 50ng M-MLV reverse transcriptase and 75ng escherichia coli exonuclease III;
buffer C is 280mM magnesium acetate solution.
More preferably, the reaction conditions of the RPA amplification reaction in the step (2) are 37-45 ℃ for 25-35 min.
More preferably, the specific operation of step (3) is:
1) taking 10ul of amplification product to a biochip detection area;
2) 100ul of hybridization buffer solution is taken to be arranged on a chip and reacted for 30 minutes at the temperature of 45 ℃; the hybridization buffer solution is: 5 XSSC buffer, SDS concentration 0.4%, TX-100 concentration 0.2%;
3) washing with preheated 0.01-0.1N NaOH solution for 3 times, each time for 5-10 s;
4) washing the chip in 0.1 XSSC at 50 deg.C for 1min, and air-drying the chip surface;
5) taking 100ul BW reaction solution on a chip, and reacting for 10 minutes at room temperature; the BW reaction solution comprises 1 XSSC and a ligand with the concentration of 0.2mg/L HRP;
6) cleaning with 0.1 XSSC solution for 3 times, each time for 1 minute, and air-drying the surface of the chip;
7) 100ul of TMB color developing solution is taken to be placed on the surface of the chip and reacted for 5 minutes;
8) washing with 0.1 XSSC solution for 3 times, each time for 1 minute, centrifuging to spin-dry the residual liquid on the surface of the chip and photographing for analysis.
The formula of 20 × ssc is: sodium chloride 3M (175g/L), sodium citrate 0.3M (88 g/L);
TMB, 3 ', 5, 5' -Tetramethylbenzidine, is a commonly used substrate for horseradish peroxidase, and produces a soluble blue product when catalyzed by horseradish peroxidase or other suitable peroxidases.
More preferably, the analysis process of step (8) is: setting 3 multi-points for each HPV type probe reaction system, wherein the 3 points are the same, and if at least 2 points in the 3 points show positive, determining that the typing detection result is effective. In 3 points at the corresponding positions of all types of HPV on the chip, at least two signal points generate positive signals, and then the positive signals can be judged.
The fourth purpose of the invention is to provide the application of the RPA primer and the RPA probe in preparing a human papillomavirus type identification reagent.
Introduction of the RPA principle: the recombinase, in combination with the primer, forms a protein-DNA complex that is able to search for homologous sequences in double-stranded DNA. Once the primers locate the homologous sequences, strand exchange reaction formation occurs and DNA synthesis is initiated, exponentially amplifying the target region on the template. The replaced DNA strand binds to SSB, preventing further replacement. In this system, a single synthesis event is initiated by two opposing primers. The entire process is carried out very quickly and detectable levels of amplification product are typically obtained within ten minutes.
Compared with the prior art, the invention has the following beneficial effects:
the invention adopts the RPA amplification technology to amplify the target segment, the amplified product is added on the gene chip to be hybridized, and the amplification time only needs 20 minutes to reach the detectable concentration of the target gene by adopting the RPA amplification technology, thereby greatly shortening the detection time.
Drawings
FIG. 1 is a graph showing the result of detection of HPV16 in example 2.
FIG. 2 is a graph showing the result of HPV66 detection in example 2.
FIG. 3 is a graph showing the result of HPV52 detection in example 2.
FIG. 4 is a graph showing the result of detection of HPV16-18-58 in example 2.
FIG. 5 is a schematic diagram showing an HPV typing detection chip probe array in example 2.
FIG. 6 is a graph showing the results of detection of reference A in example 3.
FIG. 7 is a graph showing the results of detection of reference B in example 3.
Detailed Description
Example 1
Designing primers aiming at HPV viruses, wherein the specific sequences are as follows:
f primer (SEQ ID NO. 1): TTTGTTACTGTGGATACTACTCG, respectively;
r primer (SEQ ID NO. 2): GAAAAATAAACTGTAAATCATATTCCAC are provided.
Beta-actin is used as a positive control, and corresponding primers are designed, and the sequences are as follows:
F(SEQ ID NO.3)：CGAGCACAGAGCCTCGCCTTTGCCGA；
R(SEQ ID NO.4)：CTGGTGCCTGGGGCGCCCCACGAT。
wherein, 5' ends of SEQ ID NO.1 and SEQ ID NO.3 are marked with Biotin.
Probes designed for different types of HPV and beta-actin are shown in Table 1.
TABLE 1
Example 2
The clinical sample positive HPV16, 66, 52, 16-18-58 mixed sample is used for detection, and the specific process is as follows:
(1) sample extraction
1) Taking clinical specimens, respectively adding 1ml of physiological saline to dissolve, shaking and uniformly mixing, and respectively transferring to 1.5ml of centrifuge tubes;
2) centrifuging at 12000rpm for 10min, discarding the supernatant, and keeping the precipitate;
3) adding 50 μ l HPV sample treatment solution of Zhuhaiseoleqi biotechnologies GmbH, boiling at 100 deg.C for 10 min;
4) centrifuge at 12000rpm for 10 min.
(2) Amplification of
1) Uniformly mixing and packaging BufferA, BufferB and primer components into a PCR tube according to the system configuration table 2,
TABLE 2
| System composition | Volume (uL) |
| BufferA | 20 |
| BufferB | 20 |
| Primer F (10umol/ml) | 2 |
| Primer R (10umol/ml) | 2 |
| Form panel | 2.5 |
| Buffer C | 2.5 |
Buffer A included 20% PEG35000, 10% trehalose, 250mM phosphocreatine, 12.5mM dithiothreitol, 250mM Tris-HCl, 12.5mM dNTPs and 5mM ATP.
Buffer B was 500ng recA recombinase, 360ng single-stranded binding protein, 25ng phosphokinase, 150ng BSU polymerase 50ng M-MLV reverse transcriptase and 75ng E.coli exonuclease III.
Buffer C is 280mM magnesium acetate solution.
2) 2.5ul of DNA solution (template) extracted from the sample is added into the PCR tube in the step 1) and mixed evenly for standby.
3) 2.5ul Buffer C was added to the PCR tube and mixed well.
4) Placing into a constant temperature amplification instrument for reaction at 40 ℃ for 30 min.
(3) Hybridization of
1) Respectively taking 10ul of amplification products to the prepared biochip detection area;
2) 100ul of hybridization buffer solution is taken to be arranged on a chip and reacted for 30 minutes at the temperature of 45 ℃;
3) washing with preheated 0.01-0.1N NaOH solution for 3 times, each time for 5-10 s;
4) washing the chip in 0.1 times SSC at 50 deg.c for 1min, and air drying the chip surface;
5) taking 100ul BW reaction solution on a chip, and reacting for 10 minutes at room temperature;
6) cleaning with 0.1 XSSC solution for 3 times, each time for 1 minute, and air-drying the surface of the chip;
7) 100ul of TMB color development liquid is taken to be applied to the surface of the chip and reacted for 5 minutes;
8) washing with 0.1 XSSC solution for 3 times, each time for 1 minute, centrifuging to remove residual liquid on the surface of the chip, and taking pictures with a camera, wherein the results are shown in FIGS. 1, 2, 3 and 4.
Experimental validity: and (3) repeating the detection for each reaction system, wherein at least 2 of the 3 points show positive, and determining that the typing detection result is effective. In 3 points (3 repeats) at the corresponding positions of all types of HPV on the chip, at least two signal points generate positive signals and then can be judged to be positive; the schematic diagram of the HPV typing detection chip probe matrix is shown in FIG. 5, the positions of the probes of the HPV24 types in FIG. 5 are all 3 repeat points, the quality control probes are combined with the beta-actin amplification product to display signals, which indicates that the amplification is normal, and FIG. 5 only shows the positions of the signals displayed on the chip.
Example 3
Mixing HPV national standards 26, 43, 31, 33, 18, 39, 56, 51, 58, 59, 68 and 84 respectively with 10 microliter to obtain mixed type 26-43-31-33-18-39-56-51-58-59-68-84 reference A, mixing HPV national standards 44, 6, 11, 16, 35, 52, 66, 45, 53, 73 and 82 respectively with 10 microliter to obtain mixed type 44-6-11-16-35-52-66-45-53-73-82 reference B, respectively detecting the mixed type reference A and the mixed type reference B, wherein the positions of different types of probes on a chip are different, the different types of probes are judged according to whether signals exist at the corresponding positions of the probes or not, and the types of reference B do not exist, there is no signal at the corresponding position of the probe. The amplification was performed in the same tube system, and the sequences were different between the different types of amplification, and the probes were allowed to bind to the corresponding probes, and signals were displayed at the positions corresponding to the probes, and the detection method was the same as in example 2, whereby results are shown in FIG. 6 and FIG. 7, which illustrate that the types contained in the chips 26, 43, 31, 33, 18, 39, 56, 51, 58, 59, 68, 84, 44, 6, 11, 16, 35, 52, 66, 45, 53, 73, and 82 according to the present invention can all obtain accurate results.
Example 4
Adopting HPV national standard 26-43-31-33-18-39-56-51-58-59-68-84 type mixed type, detecting after amplification, and determining the type correctly; the HPV national standard 44-6-11-16-35-52-66-45-53-73-82 type mixed type is adopted, detection is carried out after amplification, and the type is correct.
The experimental procedure of this example was the same as in example 2.
Example 5
The detection result is negative, and the detection result shows that the kit detects the CT positive reference sample, the UU positive reference sample, the NG positive reference sample, the HSV positive reference sample, the CMV positive reference sample, the TP positive reference sample and the HBV positive reference sample, and the detection result shows that the CT positive reference sample, the UU positive reference sample, the NG positive reference sample, the HSV positive reference sample, the CMV positive reference sample, the TP positive reference sample and the HBV positive reference sample are not crossed, so that the detection method of the invention can not generate false positive.
The procedure of this example was the same as in example 2.
TABLE 3
| Type of sample | The result of the detection | Quality control point |
| CT positive reference substance | Negative of | Positive for |
| UU positive reference substance | Negative of | Positive for |
| NG positive reference | Negative of | Positive for |
| HSV positive reference | Negative of | Positive for |
| CMV positive reference substance | Negative of | Positive for |
| TP Positive reference | Negative of | Positive for |
| HBV positive reference | Negative of | Positive for |
Example 6
And (3) testing the sensitivity:
1. preparation of plasmid reference: for HPV types 6, 11, 16, 18, 52, 58, national standard dilution to 5X 10 is used3copies/ml、1×103copies/ml、5×102copies/ml，
2. Amplification and hybridization were carried out by repeating the procedure of example 2 10 times each.
3. The results are given in the following table:
note: the type detection result of "+" shows positive, the type is correct; "-" the type test result showed negative
As can be seen from the results of the standard tests, the national standard was used to dilute HPV types 6, 11, 16, 18, 52, 58 to 5X 103copies/ml、1×103The two concentrations of copies/ml can be stably detected, and the detection result is correct. HPV types 6, 52, 58, 5X 102The detection rate of the copies/ml detection result is less than 95 percent, and the overall detection sensitivity of the reagent is 1 multiplied by 103copies/ml。
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> Zhuhaisai Leqi biotechnologies GmbH
<120> method and kit for rapidly detecting human papillomavirus nucleic acid type
<130> 2022.04.07
<160> 29
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
tttgttactg tggatactac tcg 23
<210> 2
<211> 28
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
gaaaaataaa ctgtaaatca tattccac 28
<210> 3
<211> 26
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
cgagcacaga gcctcgcctt tgccga 26
<210> 4
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
ctggtgcctg gggcgcccca cgat 24
<210> 5
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 5
tatgtgcatc cgtaactaca tcttc 25
<210> 6
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
tgcatctgtg tctaaatctg ctac 24
<210> 7
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 7
tatgtgctgc catatctact tcag 24
<210> 8
<211> 28
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 8
tgggcaatat gatgctacca aatttaag 28
<210> 9
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 9
accttaccat tagtacatta tctgc 25
<210> 10
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 10
aatatgtctg tttgtgctgc aattg 25
<210> 11
<211> 27
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 11
tttatgcaca caagtaacta gtgacag 27
<210> 12
<211> 26
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 12
tgtgttctgc tgtgtcttct agtgac 26
<210> 13
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 13
tctatagagt cttccatacc cttc 24
<210> 14
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 14
agtgtgccac tgcaacatct ggtg 24
<210> 15
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 15
tgacgttatg tgcctctact gaccc 25
<210> 16
<211> 27
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 16
tacacagtcc cctccgtcta catatac 27
<210> 17
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 17
tgtgcctcta cacaaaatcc tgtgc 25
<210> 18
<211> 26
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 18
ttaactatta gcactgccac tgctgc 26
<210> 19
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 19
tatgtgctga ggttaaaaag gaaag 25
<210> 20
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 20
ttccgcaacc acacagtcta tgtct 25
<210> 21
<211> 27
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 21
tattagtact gctacagaac agttaag 27
<210> 22
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 22
ttatgcactg aagtaactaa ggaag 25
<210> 23
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 23
tctttctgtg tgtctcttct actac 25
<210> 24
<211> 27
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 24
tattaatgca gctaaaagca cattaac 27
<210> 25
<211> 27
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 25
tgtctactac tactgaatca gctgtac 27
<210> 26
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 26
agcactaatt tttctgtatg tgtag 25
<210> 27
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 27
taatttaacc attagcactg ctgct 25
<210> 28
<211> 25
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 28
agcaccaatt ttactattag tgctg 25
<210> 29
<211> 19
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 29
ttccgccgcc cgtccacac 19
Claims (9)
1. An RPA primer and an RPA probe for identifying human papillomavirus types are characterized in that the primer comprises an upstream primer SEQ ID NO.1 and a downstream primer SEQ ID NO. 2; the RPA probe is shown in SEQ ID NO. 5-28.
2. A kit for detecting human papillomavirus type, said kit comprising the RPA primer and RPA probe of claim 1.
3. The kit of claim 2, further comprising at least one of an RPA reaction tube, a positive control template, and a negative control template.
4. A method for detecting human papillomavirus type, comprising the steps of:
(1) extracting DNA in a sample;
(2) taking the DNA extracted in the step (1) as a detection template, and carrying out RPA amplification reaction by adopting the RPA primer in claim 1;
(3) dividing the amplified product into a plurality of parts, and adding different RPA probes for hybridization;
(4) the RPA amplification products were analyzed.
5. The method for detecting human papillomavirus type according to claim 4, wherein the system of the RPA amplification reaction in step (2) is 50 μ L, as shown in the following table:
Last using ddH2O is complemented to 50 mu L;
buffer A included 20% PEG35000, 10% trehalose, 250mM creatine phosphate, 12.5mM dithiothreitol, 250mM Tris-HCl, 12.5mM dNTPs, and 5mM ATP;
buffer B is 500ng recA recombinase, 360ng single-chain binding protein, 25ng phosphokinase, 150ng BSU polymerase 50ng M-MLV reverse transcriptase and 75ng escherichia coli exonuclease III;
buffer C was 280mM magnesium acetate solution.
6. The method for detecting the human papillomavirus type according to claim 5, wherein the reaction conditions of the RPA amplification reaction in step (2) are 37-45 ℃ for 25-35 min.
7. The method for detecting the human papillomavirus type according to any of the claims 4-6, characterized in that the specific operation of step (3) is:
1) taking 10ul of amplified product to a biochip detection area;
2) 100ul of hybridization buffer solution is taken to be arranged on a chip and reacted for 30 minutes at the temperature of 45 ℃; the hybridization buffer solution is: 5 XSSC buffer, SDS concentration 0.4%, TX-100 concentration 0.2%;
3) washing with preheated 0.01-0.1N NaOH solution for 3 times, each time for 5-10 s;
4) washing the chip in 0.1 XSSC at 50 deg.C for 1min, and air-drying the chip surface;
5) taking 100ul BW reaction solution on a chip, and reacting for 10 minutes at room temperature; the BW reaction solution comprises 1 XSSC and a ligand with the concentration of 0.2mg/L HRP;
6) cleaning with 0.1 XSSC solution for 3 times, each time for 1 minute, and air-drying the surface of the chip;
7) 100ul of TMB color developing solution is taken to be placed on the surface of the chip and reacted for 5 minutes;
8) washing with 0.1 XSSC solution for 3 times, each time for 1 minute, centrifuging to spin-dry the residual liquid on the surface of the chip and photographing for analysis.
8. The method for detecting the human papillomavirus type according to claim 7, wherein the analysis process of the step (8) is: and setting 3 duplicate points for each HPV type probe reaction system, wherein the 3 points are the same, and determining that the typing detection result is valid if at least 2 points in the 3 points are positive.
9. Use of the RPA primers and RPA probes according to claim 1 for the preparation of human papillomavirus type identification reagents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210382445.5A CN114752706A (en) | 2022-04-12 | 2022-04-12 | Method and kit for rapidly detecting human papilloma virus nucleic acid type |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210382445.5A CN114752706A (en) | 2022-04-12 | 2022-04-12 | Method and kit for rapidly detecting human papilloma virus nucleic acid type |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114752706A true CN114752706A (en) | 2022-07-15 |
Family
ID=82329745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210382445.5A Pending CN114752706A (en) | 2022-04-12 | 2022-04-12 | Method and kit for rapidly detecting human papilloma virus nucleic acid type |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114752706A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102822189A (en) * | 2010-01-29 | 2012-12-12 | 奇亚根盖瑟斯堡股份有限公司 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
| CN113801965A (en) * | 2021-10-15 | 2021-12-17 | 英科新创（苏州）生物科技有限公司 | Primer group, kit and analysis method for rapid typing detection of HPV16 type and HPV18 type viruses |
-
2022
- 2022-04-12 CN CN202210382445.5A patent/CN114752706A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102822189A (en) * | 2010-01-29 | 2012-12-12 | 奇亚根盖瑟斯堡股份有限公司 | Methods and compositions for sequence-specific purification and multiplex analysis of nucleic acids |
| CN113801965A (en) * | 2021-10-15 | 2021-12-17 | 英科新创（苏州）生物科技有限公司 | Primer group, kit and analysis method for rapid typing detection of HPV16 type and HPV18 type viruses |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1238100B1 (en) | Polynucleotide amplification method | |
| JP6785839B2 (en) | Probe set for analyzing DNA samples and how to use them | |
| US9416398B2 (en) | Generic buffer for amplification | |
| WO2022042568A1 (en) | Method for multiplex nucleic acid detection based on crispr technology | |
| CN110358815B (en) | Method for simultaneously detecting multiple target nucleic acids and kit thereof | |
| CN112877410B (en) | Optimized nucleic acid detection system based on CRISPR (clustered regularly interspaced short palindromic repeats) mediation and detection method thereof | |
| CN110317861B (en) | Kit for detecting pathogen | |
| CN111534514A (en) | Novel coronavirus detection kit based on Crisper | |
| CN111926114B (en) | Multiplex real-time PCR kit, method and application for detecting parainfluenza virus | |
| CN111910017A (en) | Multiplex-time PCR (polymerase chain reaction) kit for detecting respiratory pathogens, method and application | |
| CN110894534A (en) | Primer, probe, kit and detection method for detecting mycoplasma genitalium | |
| JP2003527098A (en) | Nucleic acid primers and probes for detecting tumor cells | |
| JP4628369B2 (en) | High-sensitivity nucleic acid multiplex analysis method | |
| CN114752706A (en) | Method and kit for rapidly detecting human papilloma virus nucleic acid type | |
| CN114807435A (en) | Kit for detecting respiratory syncytial virus and application thereof | |
| CN112029904A (en) | Gene chip and kit for detecting novel coronavirus | |
| EP3885455A1 (en) | Method and kit for the detection of sars-cov-2 virus in a sample based on reverse transcription loop-mediated isothermal amplification (rt-lamp) | |
| CN113502341A (en) | Real-time fluorescent nucleic acid isothermal amplification detection kit for treponema pallidum 16s RNA, and special primer and probe thereof | |
| CN111206117A (en) | Kit for detecting human immunodeficiency virus | |
| CN114381458B (en) | Ortsutsugamushi quantitative detection kit based on droplet PCR | |
| JP2021503285A (en) | Compositions and Methods for Detecting C1orf43 Nucleic Acid | |
| JP2017506517A (en) | Method for isolating nucleic acid from specimen in preservative for liquid cytology containing formaldehyde | |
| CN115058493B (en) | DNA probe for multiple nucleic acid detection, CRISPR-reverse dot hybridization nucleic acid detection system and application | |
| CN114107447B (en) | Method for quantitatively detecting novel coronavirus by combining Nb.BsrDI enzyme-mediated multiple cross-substitution amplification with fluorescence | |
| JP7472476B2 (en) | Primers and method for detecting Bordetella pertussis rRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |