CN114752509B

CN114752509B - Synergistic compound microbial preparation, preparation method thereof and application thereof in prevention and treatment of mikania micrantha

Info

Publication number: CN114752509B
Application number: CN202210528608.6A
Authority: CN
Inventors: 李敏慧; 仇婉嫣; 钟家祺; 列巧婷; 何嘉慧; 张芙蓉; 习平根; 姜子德
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2022-05-16
Filing date: 2022-05-16
Publication date: 2023-08-29
Anticipated expiration: 2042-05-16
Also published as: CN114752509A

Abstract

The invention discloses a synergistic compound microbial preparation, a preparation method thereof and application thereof in preventing and controlling mikania micrantha. The formulations of the present invention include a deposit number GDMCC No:62399 A.pseudolycopus and B.pseudolycopus WGJ-1 and having a accession number of GDMCC No: fusarium berkovicii WGJ-2 of 62398. The invention utilizes the specialization of the cercospora on the parasitic host plant, the synergistic effect of the cercospora and fusarium, and the safety of other crops, thereby realizing the pertinence and the synergistic effect of the synergistic compound microbial preparation, the safety of crops and the environmental friendliness. The preparation can effectively control the diffusion of the mikania micrantha, overcomes the defects of preventing and controlling the mikania micrantha in physical and chemical means, is convenient and quick, saves time and labor, and is easy to coordinate with other prevention and control methods for use, thereby obtaining good social benefits.

Description

Synergistic compound microbial preparation, preparation method thereof and application thereof in prevention and treatment of mikania micrantha

Technical Field

The invention belongs to the technical field of prevention and control of harmful plants, and particularly relates to a synergistic compound microbial preparation, a preparation method thereof and application thereof in prevention and control of mikania micrantha.

Background

Mikania micrantha (Mikania micrantha h.b.k.) is a perennial vine of the genus eupatorium (mikania willd) of the family asteraceae (condositae). The biological invasion of mikania micrantha causes serious harm to the ecological environment in the south China, and the prevention and control problem of mikania micrantha has become a worldwide difficult problem.

The existing prevention and control means comprise manual and mechanical cleaning, chemical herbicide control, control methods utilizing natural enemy organisms and plant viruses, and the like. The manual cleaning has the advantages of high labor intensity, low efficiency and high cost, and is difficult to control mikania micrantha fundamentally; although the chemical control has good control effect, the chemical control is easy to cause environmental pollution and has great influence on native plants; biological control is the most promising method for controlling alien invading organisms. The pathogenic bacteria on the mikania micrantha can cause symptoms such as leaf spots, local necrosis and the like among the mikania micrantha leaves, and seriously inhibit the growth of the mikania micrantha.

The microbial source preparation has the advantages of small toxicity, small residue, strong selectivity, safety to non-target organisms, good environmental compatibility and the like, and meets the sustainable agricultural development requirement.

Disclosure of Invention

In order to overcome the defects and shortcomings in the prior art, the primary purpose of the invention is to provide a synergistic compound microbial preparation.

The invention also aims at providing a preparation method of the synergistic compound microbial preparation.

The invention also aims to provide the application of the synergistic compound microbial preparation in preventing and treating mikania micrantha.

In order to achieve the above object, the present invention adopts the following technical scheme:

a synergistic compound microbial preparation comprising a polypeptide having deposit No. GDMCC No: acidocella pseudolycopi (Cercospora mikaniicola) WGJ-1 of 62399 and accession number GDMCC No: fusarium berkovicii (Fusarium pernambucanum) WGJ-2 of 62398.

Further, the cercospora pseudolycopi WGJ-1 is a cercospora pseudolycopi WGJ-1 culture; preferably solid culture of cercospora pseudolycopi WGJ-1; more preferably, the preparation is carried out by the following method: the cercospora pseudolycopi WGJ-1 is transferred to a sterilized PDA solid culture medium for activation, and is cultivated for 4-13 d, preferably 7d under the constant temperature of 28-29 ℃, preferably 28.3 ℃ and the constant humidity condition of 38-40%, preferably 39% in a dark place.

Further, the fusarium berkovicii WGJ-2 is a fusarium berkovicii WGJ-2 culture; preferably fusarium berculosis WGJ-2 liquid culture with spore concentration of 0.8-1.2X10 ⁵ Per mL, preferably 1X 10 ⁵ individual/mL; more preferably, the preparation is carried out by the following method: transferring Fusarium berculosis WGJ-2 to a sterilized PDA solid culture medium for activation, and culturing for 6-8 d, preferably 7d under the constant temperature of 28-29 ℃, preferably 28.3 ℃ and constant humidity of 38% -40%, preferably 39% in a dark place; then the YPD culture is carried out based on a constant temperature culture shaker for fermentation at 27-29 ℃, preferably 28 ℃, and the shaking table speed is 150-200 rpm, preferably 180rpm, and the fermentation time is 60-90 h, preferably 48h.

Further, the mass (mg) to volume (mL) ratio of the solid culture of the cercospora pseudolycopi WGJ-1 and the liquid culture of the fusarium graminearum WGJ-2 is 0.8-1.2:0.8-1.2, preferably 1:1.

According to the preparation method of the synergistic compound microbial preparation, cercospora pseudolycopi WGJ-1 and fusarium berkovicum WGJ-2 are uniformly mixed according to the required proportion, and the synergistic compound microbial preparation is obtained.

Cercospora species with mikania micrantha control effect, namely cercospora pseudolycopi (Cercospora mikaniicola) WGJ-1, which is deposited on the Guangdong province microorganism strain collection (GDMCC) of No. 59 building of Xian Zhonglu 100 in Xiuzhou district of Guangdong province at 20 days of 2022, with the deposit number: GDMCC No:62399.

fusarium with function of promoting prevention and treatment of mikania micrantha, named Fusarium graminearum (Fusarium pernambucanum) WGJ-2, deposited on No. 59 building of Mitrex 100 in Xiuzhou district of Guangdong province at 20 months of 2022, with deposit number: GDMCC No:62398.

the synergistic compound microbial preparation or cercospora with the control effect of mikania micrantha or fusarium with the control effect of promoting mikania micrantha is applied to control mikania micrantha.

Compared with the prior art, the invention has the following advantages and effects:

(1) The invention utilizes the specialization of the cercospora on the parasitic of the host plant, the synergistic effect of the cercospora and fusarium, and the safety of crops, thereby realizing the pertinence and the synergistic effect of the synergistic compound microbial preparation, the safety of crops and environmental friendliness;

(2) The synergistic compound microbial preparation prepared by the invention has the characteristics of high efficiency, low toxicity, low residue, environmental compatibility and the like, and meets the requirements of agricultural green production and ecological environment protection;

(3) The synergistic compound microbial preparation prepared by the invention can effectively control the diffusion of mikania micrantha, overcomes the defects of preventing and controlling mikania micrantha in physical and chemical means, is convenient and quick, saves time and labor, and is easy to coordinate with other prevention and control methods for use, thereby obtaining good social benefits.

Drawings

FIG. 1 is a photomicromorphology characterization of cercospora pseudolycopi WGJ-1; wherein a-d are conidia; e-g is conidiophore; h. i is conidium and conidium peduncles; j is the front face of the bacterial colony; k is the back of the colony;

FIG. 2 is a phylogenetic tree between cercospora pseudoshinskii WGJ-1 and cercospora related fungi constructed based on ITS sequences;

FIG. 3 is a photomicromorphogram of Fusarium berkovicii WGJ-2; wherein a-f are conidia; g is conidiophore; h is conidium and conidium peduncles; i is the front face of the colony; j is the back of the colony;

FIG. 4 is a phylogenetic tree between Fusarium berkovicii WGJ-2 and Fusarium-related fungi constructed based on ITS sequences and EF-1 alpha sequences;

FIG. 5 is a graph showing the effects of different treatments on Mikania micrantha; wherein a is blank PDA culture medium treatment, b is cercospora pseudolycopi culture treatment, c is fusarium berkovicum fermentation liquor treatment, and d is synergistic compound microbial preparation treatment;

FIG. 6 is a statistical graph of the pathogenic effects of different treatments on mikania micrantha;

FIG. 7 is a graph showing the results of the pathogenicity detection of the synergistic compound microorganism of the present invention on plants around the multiple places of Mikania micrantha.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but embodiments of the present invention are not limited thereto.

Example 1

1. Test design

1. Isolation of strains: fresh mikania micrantha diseased leaves are selected, the whole leaves are subjected to surface disinfection by 75% alcohol for 15-30 s and then washed three times by sterile water, the fresh leaves are spread in a fresh-keeping box after being dried, the fresh leaves are placed in a 28 ℃ for moisturizing culture for 3-5 d, after hypha and spores grow out around diseased tissues, the spores are washed by the sterile water to prepare spore suspension, the spore suspension is coated on a PDA flat plate, after the spores are cultured for 2-3 d at the 28 ℃, single colony edge hypha is picked to a new PDA flat plate, and purified isolated strains WGJ-1 and WGJ-2 are obtained.

2. Morphological identification: since the isolated strain WGJ-1 does not produce spores on PDA culture medium basically, the isolated strain is transferred to mikania micrantha culture medium (the preparation method is shown in example 3) for culturing, after the spores are produced, a few spores are selected to be made into temporary glass slides, microscopic morphological characteristics of pathogenic bacteria are observed under an optical microscope, and the spore sizes are measured. The isolated culture of strain WGJ-2 was inoculated onto PDA medium, incubated at 28℃for 7d in the dark, a temporary slide of the pathogen culture was picked up, the microscopic morphological characteristics of the pathogen were observed under an optical microscope, and the spore size was measured.

3. Molecular biology identification: cultures of strains (WGJ-1 and WGJ-2) on PDA medium were collected, respectively, and their DNA was extracted; the ITS sequence of the isolated strain is amplified by using universal primers ITS1 and ITS4, the elongation factor gene EF-1 alpha sequence of the WGJ-2 strain is amplified by using EF-1 alpha-1 and EF-1 alpha-2, and the PCR product is cloned into a T vector after purification and is sent to a company for sequencing. And respectively carrying out Blastn sequence comparison on the obtained ITS and EF-1 alpha sequences on NCBI networks, downloading related sequences with high similarity, constructing a phylogenetic tree by using a maximum likelihood method (Maximalikelive, ML) (Kumar et al, 2016), wherein the strain WGJ-1 constructs a monogenic phylogenetic tree based on the ITS, the strain WGJ-2 constructs a phylogenetic tree of the ITS and EF-1 alpha double sequences, and repeating the self-expanding support for 1000 times.

4. Results

(1) Morphological and molecular biological identification results of strain WGJ-1

As shown in fig. 1, a-d are conidia; e-g is conidiophore; h. i is conidium and conidium peduncles; j is the front face of the bacterial colony; k is the back of a bacterial colony, the conidium of the isolated bacteria is needle-shaped, the length is 60.0-120.0 mu m, the width is 4.0-10.0 mu m, the bacterial colony is colorless or light brown, the membrane is multiple, the bacterial colony is slightly bent, the basal part is truncated to an inverted cone shape, and the top is thinner than the basal part; conidiophores are densely clustered, brown to eleish brown, have diaphragms, stand upright or bend or are knee-bending, and have branches.

The result of the phylogenetic tree constructed based on the ITS gene sequence is shown in figure 2, the ITS sequence (SEQ ID NO. 1) of the strain WGJ-1 has 100% similarity with the ITS sequence of the cercospora pseudolycopi Cercospora mikaniicola in GenBank, and the phylogenetic analysis of the ITS sequence also tightly gathers the cercospora pseudolycopi in one branch and is obviously distinguished from other cercospora.

Most of the cercospora fungi have host specialization, the same cercospora species only parasitizes on different genus plants of the same family (Guo Yinglan, 2020), and cercospora pseudolycopus can infect plants of the genus pseudolycopus, such as eupatorium and eupatorium adenophorum (mikania micrantha) (Kirschner R,2015; guo Yinglan, 2020). Thus, based on the microscopic morphological characteristics of the host and pathogenic bacteria and molecular system development analysis results, strain WGJ-1 was identified as cercospora pseudolycopi (Cercospora mikaniicola) and deposited at 20 months of 2022 on 4 months with the Guangdong province microorganism strain collection (GDMCC) of No. 59 building of Xianzhonglu 100 of Xiuzhou district, guangdong province, with deposit number: GDMCC No:62399.

(2) Morphological and molecular biological identification results of strain WGJ-2

As shown in fig. 3, a-f are conidia; g is conidiophore; h is conidium and conidium peduncles; i is the front face of the colony; j is the back of a bacterial colony, the conidium of the strain WGJ-2 is provided with a plurality of diaphragms, most of the diaphragms are separated by 3 to 6 diaphragms, the length of the diaphragms is 15.0 to 25.0 mu m, the width of the diaphragms is 3.0 to 6.0 mu m, the diaphragms are colorless to light brown, and the diaphragms are dark in color and are sickle-shaped or spindle-shaped; the conidiophores branch off and are light brown to yellow brown.

A phylogenetic tree of the strain is constructed based on ITS (SEQ ID NO. 2) and EF-1 alpha gene sequence (SEQ ID NO. 3), and the result is shown in figure 4, wherein the similarity of the F-1 alpha sequence of the fusarium and F-Fusarium pernambucanum of fusarium berkomarovii causing passion flower rot in GenBank is 100%. The two-gene phylogenetic analysis based on ITS and EF-1 a sequences also tightly focused this bacterium in one branch from it and clearly distinguished from other fusarium.

Thus, based on the microscopic morphological characteristics and the results of the two-gene phylogenetic analysis, strain WGJ-2 was identified as Fusarium burmanii (Fusarium pernambucanumA.C.S.Santos, C.S.Lima, P.V.Tiago & N.T.Oliveira) and deposited at Canon 3, 20 months 2022 under the accession number of the Guangdong microbiological culture Collection center (GDMCC) of No. 100, mitsui, guangdong, city, calif.: GDMCC No:62398.

ITS sequence of cercospora pseudolycopi WGJ-1 (SEQ ID NO. 1):

TCCGTAGGTGAACCTGCGGAGGGATCATTACTGAGTGAGGGCCTTCGGGCTCGACCTCCAACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTAGCTTGGTATTGGGCGCCGCGGTGTTCCGCGCGCCTCAAAGTCTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGTCGCGGCCGTTAAATCTTTCACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。

the ITS sequence of Fusarium berkovicii WGJ-2 (SEQ ID NO. 2):

TCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCTATACGTTGCCTCGGCGGATCAGCCCGCGCCCCGTAAAACGGGACGGCCCGCCCGAGGAcCCCTAAACTCTGTTTTTAGTGGAACTTCTGAGTAAAACAAACAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCAGCTTGGTGTTGGGACTCGCGGTAACCCGCGTTCCCCAAATCGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAATMATACACCTCGTTACTGGTAATCGTCGCGGCCACGCCGTAAAACCCCAACTTCTGAATGTtGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。

the EF-1 alpha gene sequence of Fusarium berkovicii WGJ-2 (SEQ ID NO. 3):

ATGGGTAAGGAAGACAAGACTCACCTTAACGTCGTCGTCaTCGGCCaCGTCGACTCTGGCAAGTCGACCACTGTGAGTACTACCCACGATGATCTGCTTATCAGTAGTCATCAACCCCGCCAGATGTGGCGGGGTAAGTTCAACTGGGAATATTTGCTGACAAGATTGCATAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTTTCCATTTCCCTCGATCGCACGCCCTCTACCCACCGATCCATCAGTCGAATCAGTTACGACGATTGAATATGCGCCTGTTACCCCGCTCGAGTACAAAATCTTGCGTTTCAACCGTAATTTTTTTTTGGTGGGGTGTCAACCCCGCTACTCGAGCGACAGACGTTTGCCCTCTTCCCACAAACTCATTTCTTGTGCATCACGTGTCCATCAGCCACTAACCACACGACAATAGGAAGCCGCCGAGCTCGGTAAGGGTTCTTTCAAGTACGCCTGGGTTCTTGACAAGCTCAAGGCTGAGCGTGAGCGTGGTATCACCATCGATATCGCCCTCTGGAAGTTCGAGACTCCTCGCTACTATGTCACCGTCATTGGTACGTTATCATCACTTACACTCAATACTTTCTCATGCTAACATGTACTTCAGACGCTCCCGGTCACCGTGATTTCATCAAGAACATGATCACTGGTACCTCC。

example 2

1. Transferring the strains WGJ-1 and WGJ-2 onto PDA culture medium for activation, culturing at constant temperature of 28.3deg.C under 39% constant humidity for 7d, and sterilizing with a puncher to obtain 6mm culture of cercospora and Fusarium; inoculating Fusarium culture into YPD medium, placing into a constant temperature culture shaker for batch fermentation at 28deg.C, and shaking culturing on a shaking table at 180rpm for 48 hr to obtain spore with concentration of 1×10 ⁵ Each/mL of fermentation broth of strain WGJ-2.

2. The synergistic compound microorganism preparation is obtained after mixing the strains WGJ-1 and WGJ-2 according to the mass (mg) to volume (mL) ratio of 1:1.

Example 3

Collecting healthy leaves of mikania micrantha, cleaning, placing 25g of the healthy leaves in a tissue culture bottle for sealing, performing high-temperature wet heat sterilization in a sterilization pot to obtain a mikania micrantha culture medium, inoculating a eupatorium adenophorum strain WGJ-1 on an ultra-clean workbench, culturing for 10-14d in a climatic chamber at 28 ℃, and preparing a temporary glass slide for microscopic morphological observation and measurement when a large number of conidia are generated by the strain WGJ-1; the culture of the strain WGJ-2 is carried out on a PDA culture medium, the strain WGJ-2 is inoculated on a super clean workbench to a PDA flat plate, the strain is placed in a climatic chamber with the temperature of 28 ℃ for 7d, and after a large amount of conidia are generated by the strain WGJ-2, a temporary glass slide is manufactured for microscopic morphological observation and measurement.

Example 4

1. Experimental group setting

(1) Blank PDA Medium control group

(2) Reference is made to the cercospora culture obtained in example 2;

(3) Reference is made to the fusarium fermentation broth obtained in example 2;

(4) The synergistic compound microbial preparation obtained in reference to example 2;

2. test materials

The inoculated leaf is a healthy leaf of mikania micrantha.

3. Test design

Healthy mikania micrantha leaves are adopted, washed clean by 75% alcohol and sterilized double distilled water, each group is treated for three times, all culture environments are kept consistent, and the mikania micrantha leaves are placed under the condition of preserving moisture at 26 ℃. Inoculating with sterilized toothpick and pipette on ultra clean bench. The test is to set a blank PDA culture medium control group, a cercospora culture, a fusarium fermentation broth and a synergistic compound microbial preparation, and observe the disease condition 7d after inoculation.

4. Test results

FIG. 5 shows the results of pathogenicity tests on mikania micrantha in different treatments, wherein a is blank PDA medium treatment, b is tail spore bacteria culture treatment, c is fusarium fermentation broth treatment, and d is synergistic compound microbial preparation treatment. It can be seen that the blank PDA culture medium and Fusarium WGJ-2 are not pathogenic to mikania micrantha, the cercospora WGJ-1 and the synergistic compound microbial preparation are pathogenic, and the area of the disease spots caused by the synergistic compound microbial preparation is larger, which indicates that the synergistic compound microbial preparation has better prevention and control effects, presumably, more toxins are generated after the synergistic compound microbial preparation is mixed with the cercospora micrantha, the wilting capability of the cercospora micrantha is stronger, and the synergistic compound microbial preparation has a certain synergistic effect, but the specific action mechanism of the cercospora micrantha is still to be further studied.

Example 5

1. Test group design

(1) Blank PDA Medium control group

(2) The synergistic compound microbial preparation obtained in reference to example 2;

2. test materials

The inoculated host is plant around Mikania micrantha, including litchi, banana, acacia, eucalyptus, longan, etc. Healthy plant leaves are adopted, after the surfaces of the plant leaves are disinfected by 75 percent of alcohol, the plant leaves are washed clean by sterilized water, each group of plant leaves are treated for three times, all culture environments are kept consistent, and the plant leaves are placed under 26 ℃ in a moisturizing way. All inoculation processes are carried out on an ultra-clean workbench, so that no pollution of other foreign bacteria is ensured. The test is provided with a blank control group and a synergistic compound microbial preparation, and the disease condition is observed 7d after inoculation.

3. Test results

As a result, as shown in FIG. 7, leaves of all inoculated plants did not form lesions and did not develop disease.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Sequence listing

<110> agricultural university of south China

<120> a synergistic compound microbial preparation, preparation method thereof and application thereof in prevention and treatment of mikania micrantha

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 536

<212> DNA

<213> Tail spore fungus of pseudo-herba Lycopi (Cercospora mikaniicola)

<220>

<223> ITS sequence of cercospora pseudolycopi WGJ-1

<400> 1

tccgtaggtg aacctgcgga gggatcatta ctgagtgagg gccttcgggc tcgacctcca 60

accctttgtg aacacaactt gttgcttcgg gggcgaccct gccgtttcga cggcgagcgc 120

ccccggaggc cttcaaacac tgcatctttg cgtcggagtt taagtaaatt aaacaaaact 180

ttcaacaacg gatctcttgg ttctggcatc gatgaagaac gcagcgaaat gcgataagta 240

atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcacattgc gccctttggt 300

attccgaagg gcatgcctgt tcgagcgtca tttcaccact caagcctagc ttggtattgg 360

gcgccgcggt gttccgcgcg cctcaaagtc tccggctgag ctgtccgtct ctaagcgttg 420

tgatttcatt aatcgcttcg gagcgcgggc ggtcgcggcc gttaaatctt tcacaaggtt 480

gacctcggat caggtaggga tacccgctga acttaagcat atcaataagc ggagga 536

<210> 2

<211> 546

<212> DNA

<213> Fusarium berkovicii (Fusarium pernambucanum)

<220>

<223> ITS sequence of Fusarium berkovicii WGJ-2

<400> 2

tccgtaggtg aacctgcgga gggatcatta ccgagtttac aactcccaaa cccctgtgaa 60

catacctata cgttgcctcg gcggatcagc ccgcgccccg taaaacggga cggcccgccc 120

gaggacccct aaactctgtt tttagtggaa cttctgagta aaacaaacaa ataaatcaaa 180

actttcaaca acggatctct tggttctggc atcgatgaag aacgcagcaa aatgcgataa 240

gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcacat tgcgcccgcc 300

agtattctgg cgggcatgcc tgttcgagcg tcatttcaac cctcaagctc agcttggtgt 360

tgggactcgc ggtaacccgc gttccccaaa tcgattggcg gtcacgtcga gcttccatag 420

cgtagtaatm atacacctcg ttactggtaa tcgtcgcggc cacgccgtaa aaccccaact 480

tctgaatgtt gacctcggat caggtaggaa tacccgctga acttaagcat atcaataagc 540

ggagga 546

<210> 3

<211> 717

<212> DNA

<213> Fusarium burejense (Fusarium pernambucanum)

<220>

<223> EF-1 alpha Gene sequence of Fusarium berkovicii WGJ-2

<400> 3

atgggtaagg aagacaagac tcaccttaac gtcgtcgtca tcggccacgt cgactctggc 60

aagtcgacca ctgtgagtac tacccacgat gatctgctta tcagtagtca tcaaccccgc 120

cagatgtggc ggggtaagtt caactgggaa tatttgctga caagattgca tagaccggtc 180

acttgatcta ccagtgcggt ggtatcgaca agcgaaccat cgagaagttc gagaaggttg 240

gtttccattt ccctcgatcg cacgccctct acccaccgat ccatcagtcg aatcagttac 300

gacgattgaa tatgcgcctg ttaccccgct cgagtacaaa atcttgcgtt tcaaccgtaa 360

tttttttttg gtggggtgtc aaccccgcta ctcgagcgac agacgtttgc cctcttccca 420

caaactcatt tcttgtgcat cacgtgtcca tcagccacta accacacgac aataggaagc 480

cgccgagctc ggtaagggtt ctttcaagta cgcctgggtt cttgacaagc tcaaggctga 540

gcgtgagcgt ggtatcacca tcgatatcgc cctctggaag ttcgagactc ctcgctacta 600

tgtcaccgtc attggtacgt tatcatcact tacactcaat actttctcat gctaacatgt 660

acttcagacg ctcccggtca ccgtgatttc atcaagaaca tgatcactgg tacctcc 717

Claims

1. A synergistic compound microbial preparation is characterized in that: from accession number GDMCC No:62399 Acidocella pseudolycopiCercospora mikaniicola) WGJ-1 and accession number GDMCC No:62398 Fusarium berkovicumFusarium pernambucanum) WGJ-2.

2. The synergistic compound microbial preparation according to claim 1, characterized in that:

the cercospora pseudolycopi WGJ-1 is a cercospora pseudolycopi WGJ-1 solid culture;

fusarium berkovicii WGJ-2 is a Fusarium berkovicii WGJ-2 liquid culture.

3. The synergistic compound microbial preparation according to claim 2, characterized in that:

the spore concentration of the fusarium bernoulli WGJ-2 liquid culture is 0.8-1.2X10 ⁵ individual/mL;

the mass and volume ratio of the solid culture of the cercospora pseudolycopi WGJ-1 to the liquid culture of the fusarium graminearum WGJ-2 is 0.8-1.2 mg:0.8-1.2 mL.

4. The synergistic compound microbial preparation according to claim 3, characterized in that:

the mass to volume ratio of the solid culture of the cercospora pseudolycopi WGJ-1 to the liquid culture of the fusarium graminearum WGJ-2 is 1 mg/1 mL.

5. The synergistic compound microbial preparation according to claim 2, characterized in that:

the solid culture of the cercospora pseudolycopi WGJ-1 is prepared by the following method: transferring the cercospora pseudolycopi WGJ-1 to a sterilized PDA solid culture medium for activation, and culturing for 4-13 d under constant temperature of 28-29 ℃ and constant humidity condition of 38-40% in a dark place;

the fusarium berkovicii WGJ-2 liquid culture is prepared by the following method: transferring Fusarium berculosis WGJ-2 to a sterilized PDA solid culture medium for activation, and culturing for 6-8 d under the constant temperature of 28-29 ℃ and the constant humidity condition of 38-40% in a dark place; and then inoculating YPD culture to a constant temperature culture shaker for fermentation, wherein the fermentation temperature is 27-29 ℃, the shaking table speed is 150-200 rpm, and the fermentation time is 60-90 h.

6. The synergistic compound microbial preparation according to claim 2, characterized in that:

the solid culture of the cercospora pseudolycopi WGJ-1 is prepared by the following method: transferring cercospora pseudolycopi WGJ-1 to a sterilized PDA solid culture medium for activation, and culturing for 7d under constant temperature of 28.3 ℃ and constant humidity condition of 39% in a dark place;

the fusarium berkovicii WGJ-2 liquid culture is prepared by the following method: transferring Fusarium berculosis WGJ-2 to sterilized PDA solid culture medium, activating, and culturing in dark at constant temperature of 28.3deg.C under 39% constant humidity for 7d; then, YPD culture is carried out based on a constant temperature culture shaker for fermentation at 28 ℃ and a shaking table speed of 180rpm for 48 hours.

7. The method for preparing the synergistic compound microbial preparation as claimed in any one of claims 1 to 6, characterized in that: uniformly mixing cercospora pseudolycopi WGJ-1 and fusarium berkovicum WGJ-2 according to a required proportion to obtain the synergistic compound microbial preparation.

8. A cercospora strain with mikania micrantha control effect, which is characterized in that: named as cercospora pseudolycopiCercospora mikaniicola) WGJ-1, which was deposited at 20 months of 2022 at 5 in the Guangdong province microorganism strain collection, accession number: GDMCC No:62399。

9. use of the synergistic compound microorganism preparation according to any one of claims 1 to 6 or the urospora having a control effect of mikania micrantha according to claim 8 for controlling mikania micrantha.