CN114747542A - Construction method and application of DSC2 gene knockout mouse model - Google Patents
Construction method and application of DSC2 gene knockout mouse model Download PDFInfo
- Publication number
- CN114747542A CN114747542A CN202210566424.9A CN202210566424A CN114747542A CN 114747542 A CN114747542 A CN 114747542A CN 202210566424 A CN202210566424 A CN 202210566424A CN 114747542 A CN114747542 A CN 114747542A
- Authority
- CN
- China
- Prior art keywords
- dsc2
- mouse
- right ventricular
- mouse model
- knockout mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000010172 mouse model Methods 0.000 title claims abstract description 35
- 101150085450 DSC2 gene Proteins 0.000 title claims abstract description 25
- 238000003209 gene knockout Methods 0.000 title claims abstract description 24
- 238000010276 construction Methods 0.000 title claims abstract description 10
- 230000002861 ventricular Effects 0.000 claims abstract description 58
- 208000031229 Cardiomyopathies Diseases 0.000 claims abstract description 48
- 239000003814 drug Substances 0.000 claims abstract description 18
- 229940079593 drug Drugs 0.000 claims abstract description 11
- 206010016654 Fibrosis Diseases 0.000 claims abstract description 10
- 230000004761 fibrosis Effects 0.000 claims abstract description 10
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 9
- 230000037361 pathway Effects 0.000 claims abstract description 9
- 238000011813 knockout mouse model Methods 0.000 claims abstract description 7
- 238000005516 engineering process Methods 0.000 claims abstract description 6
- 208000019622 heart disease Diseases 0.000 claims abstract description 6
- 230000005775 apoptotic pathway Effects 0.000 claims abstract description 4
- 230000008602 contraction Effects 0.000 claims abstract description 4
- 238000012544 monitoring process Methods 0.000 claims abstract description 3
- 102100037709 Desmocollin-3 Human genes 0.000 claims abstract 5
- 101000968042 Homo sapiens Desmocollin-2 Proteins 0.000 claims abstract 5
- 101000880960 Homo sapiens Desmocollin-3 Proteins 0.000 claims abstract 5
- 241000699666 Mus <mouse, genus> Species 0.000 claims description 46
- 241000699670 Mus sp. Species 0.000 claims description 24
- 108091033409 CRISPR Proteins 0.000 claims description 14
- 108090000623 proteins and genes Proteins 0.000 claims description 12
- 206010039163 Right ventricular failure Diseases 0.000 claims description 9
- 235000013601 eggs Nutrition 0.000 claims description 6
- 238000010354 CRISPR gene editing Methods 0.000 claims description 5
- 230000001105 regulatory effect Effects 0.000 claims description 5
- 238000011081 inoculation Methods 0.000 claims description 3
- 108020004999 messenger RNA Proteins 0.000 claims description 3
- 238000013518 transcription Methods 0.000 claims 1
- 230000035897 transcription Effects 0.000 claims 1
- 238000012217 deletion Methods 0.000 abstract description 11
- 230000037430 deletion Effects 0.000 abstract description 11
- 238000011160 research Methods 0.000 abstract description 11
- 206010028594 Myocardial fibrosis Diseases 0.000 abstract description 7
- 230000009456 molecular mechanism Effects 0.000 abstract description 7
- 206010013012 Dilatation ventricular Diseases 0.000 abstract description 5
- 230000033228 biological regulation Effects 0.000 abstract description 5
- 238000010356 CRISPR-Cas9 genome editing Methods 0.000 abstract description 3
- 230000014509 gene expression Effects 0.000 abstract description 3
- 238000002360 preparation method Methods 0.000 abstract description 3
- 238000011746 C57BL/6J (JAX™ mouse strain) Methods 0.000 abstract description 2
- 206010019280 Heart failures Diseases 0.000 abstract description 2
- 230000006806 disease prevention Effects 0.000 abstract 1
- 210000005241 right ventricle Anatomy 0.000 description 16
- 230000002107 myocardial effect Effects 0.000 description 14
- 230000006907 apoptotic process Effects 0.000 description 13
- 238000000034 method Methods 0.000 description 8
- 235000018102 proteins Nutrition 0.000 description 7
- 102000004169 proteins and genes Human genes 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 6
- 108020005004 Guide RNA Proteins 0.000 description 6
- 210000004027 cell Anatomy 0.000 description 6
- 230000008859 change Effects 0.000 description 6
- 210000001047 desmosome Anatomy 0.000 description 6
- 201000006058 Arrhythmogenic right ventricular cardiomyopathy Diseases 0.000 description 5
- 102000011799 Desmoglein Human genes 0.000 description 5
- 108050002238 Desmoglein Proteins 0.000 description 5
- 201000010099 disease Diseases 0.000 description 5
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 5
- 210000004165 myocardium Anatomy 0.000 description 5
- 238000010171 animal model Methods 0.000 description 4
- 230000000747 cardiac effect Effects 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 231100000221 frame shift mutation induction Toxicity 0.000 description 4
- 230000037433 frameshift Effects 0.000 description 4
- 230000006698 induction Effects 0.000 description 4
- 210000005240 left ventricle Anatomy 0.000 description 4
- 210000001519 tissue Anatomy 0.000 description 4
- 238000002604 ultrasonography Methods 0.000 description 4
- 102000000905 Cadherin Human genes 0.000 description 3
- 108050007957 Cadherin Proteins 0.000 description 3
- 102100034578 Desmoglein-2 Human genes 0.000 description 3
- 102100038199 Desmoplakin Human genes 0.000 description 3
- 101000924314 Homo sapiens Desmoglein-2 Proteins 0.000 description 3
- 241001465754 Metazoa Species 0.000 description 3
- 230000007547 defect Effects 0.000 description 3
- 230000001575 pathological effect Effects 0.000 description 3
- 230000008569 process Effects 0.000 description 3
- 208000002150 Arrhythmogenic Right Ventricular Dysplasia Diseases 0.000 description 2
- 101800000026 Dentin sialoprotein Proteins 0.000 description 2
- 101000691574 Homo sapiens Junction plakoglobin Proteins 0.000 description 2
- 101000583179 Homo sapiens Plakophilin-2 Proteins 0.000 description 2
- 102100026153 Junction plakoglobin Human genes 0.000 description 2
- 101100278583 Mus musculus Dsc2 gene Proteins 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 102100030348 Plakophilin-2 Human genes 0.000 description 2
- 230000005856 abnormality Effects 0.000 description 2
- 230000006793 arrhythmia Effects 0.000 description 2
- 206010003119 arrhythmia Diseases 0.000 description 2
- 238000011888 autopsy Methods 0.000 description 2
- 210000005242 cardiac chamber Anatomy 0.000 description 2
- 210000004413 cardiac myocyte Anatomy 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 230000001276 controlling effect Effects 0.000 description 2
- 230000005782 double-strand break Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 210000000981 epithelium Anatomy 0.000 description 2
- 239000000835 fiber Substances 0.000 description 2
- 230000003902 lesion Effects 0.000 description 2
- 230000007246 mechanism Effects 0.000 description 2
- 210000003470 mitochondria Anatomy 0.000 description 2
- 230000002438 mitochondrial effect Effects 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 230000008506 pathogenesis Effects 0.000 description 2
- 230000004853 protein function Effects 0.000 description 2
- 210000001147 pulmonary artery Anatomy 0.000 description 2
- 210000001908 sarcoplasmic reticulum Anatomy 0.000 description 2
- 230000002269 spontaneous effect Effects 0.000 description 2
- 238000010186 staining Methods 0.000 description 2
- 238000011477 surgical intervention Methods 0.000 description 2
- 238000001356 surgical procedure Methods 0.000 description 2
- 206010007513 Cardiac aneurysm Diseases 0.000 description 1
- 208000006029 Cardiomegaly Diseases 0.000 description 1
- 206010008479 Chest Pain Diseases 0.000 description 1
- 108020004705 Codon Proteins 0.000 description 1
- 206010010356 Congenital anomaly Diseases 0.000 description 1
- 102100040481 Desmocollin-2 Human genes 0.000 description 1
- 101710157873 Desmocollin-2 Proteins 0.000 description 1
- 108091000074 Desmoplakin Proteins 0.000 description 1
- 108050002237 Desmosomal cadherin Proteins 0.000 description 1
- 108091092584 GDNA Proteins 0.000 description 1
- 101000605827 Homo sapiens Pinin Proteins 0.000 description 1
- 208000001953 Hypotension Diseases 0.000 description 1
- 102000011782 Keratins Human genes 0.000 description 1
- 108010076876 Keratins Proteins 0.000 description 1
- 206010028851 Necrosis Diseases 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 206010030113 Oedema Diseases 0.000 description 1
- 108091034117 Oligonucleotide Proteins 0.000 description 1
- 206010033557 Palpitations Diseases 0.000 description 1
- 208000037273 Pathologic Processes Diseases 0.000 description 1
- 102100038374 Pinin Human genes 0.000 description 1
- 208000010378 Pulmonary Embolism Diseases 0.000 description 1
- 206010067171 Regurgitation Diseases 0.000 description 1
- 206010042434 Sudden death Diseases 0.000 description 1
- 208000031353 Systolic Murmurs Diseases 0.000 description 1
- 208000001871 Tachycardia Diseases 0.000 description 1
- 108010006785 Taq Polymerase Proteins 0.000 description 1
- 102100023935 Transmembrane glycoprotein NMB Human genes 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 150000001413 amino acids Chemical class 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000002763 arrhythmic effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 230000002308 calcification Effects 0.000 description 1
- 230000009787 cardiac fibrosis Effects 0.000 description 1
- 230000001010 compromised effect Effects 0.000 description 1
- 239000013078 crystal Substances 0.000 description 1
- 210000004292 cytoskeleton Anatomy 0.000 description 1
- 230000001086 cytosolic effect Effects 0.000 description 1
- 230000007812 deficiency Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000003205 diastolic effect Effects 0.000 description 1
- 230000010339 dilation Effects 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 208000002173 dizziness Diseases 0.000 description 1
- 238000007877 drug screening Methods 0.000 description 1
- 230000004064 dysfunction Effects 0.000 description 1
- 238000002592 echocardiography Methods 0.000 description 1
- 230000002526 effect on cardiovascular system Effects 0.000 description 1
- 231100001129 embryonic lethality Toxicity 0.000 description 1
- 206010016256 fatigue Diseases 0.000 description 1
- 230000003176 fibrotic effect Effects 0.000 description 1
- 238000007490 hematoxylin and eosin (H&E) staining Methods 0.000 description 1
- 239000000833 heterodimer Substances 0.000 description 1
- 239000000710 homodimer Substances 0.000 description 1
- 208000021822 hypotensive Diseases 0.000 description 1
- 230000001077 hypotensive effect Effects 0.000 description 1
- 230000028709 inflammatory response Effects 0.000 description 1
- 210000004692 intercellular junction Anatomy 0.000 description 1
- 230000003834 intracellular effect Effects 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 230000033001 locomotion Effects 0.000 description 1
- 230000036244 malformation Effects 0.000 description 1
- 230000001404 mediated effect Effects 0.000 description 1
- 210000003205 muscle Anatomy 0.000 description 1
- 230000003387 muscular Effects 0.000 description 1
- 208000010125 myocardial infarction Diseases 0.000 description 1
- 210000001087 myotubule Anatomy 0.000 description 1
- 230000017074 necrotic cell death Effects 0.000 description 1
- 231100000915 pathological change Toxicity 0.000 description 1
- 230000036285 pathological change Effects 0.000 description 1
- 230000009054 pathological process Effects 0.000 description 1
- 230000008289 pathophysiological mechanism Effects 0.000 description 1
- 230000002085 persistent effect Effects 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000000750 progressive effect Effects 0.000 description 1
- 235000004252 protein component Nutrition 0.000 description 1
- 238000002601 radiography Methods 0.000 description 1
- 238000009877 rendering Methods 0.000 description 1
- 230000010076 replication Effects 0.000 description 1
- 238000012827 research and development Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 230000035939 shock Effects 0.000 description 1
- 230000019491 signal transduction Effects 0.000 description 1
- 210000002027 skeletal muscle Anatomy 0.000 description 1
- 210000001562 sternum Anatomy 0.000 description 1
- 230000035882 stress Effects 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 206010042772 syncope Diseases 0.000 description 1
- 230000006794 tachycardia Effects 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 108091007466 transmembrane glycoproteins Proteins 0.000 description 1
- 102000035160 transmembrane proteins Human genes 0.000 description 1
- 108091005703 transmembrane proteins Proteins 0.000 description 1
- 210000000591 tricuspid valve Anatomy 0.000 description 1
- 238000013042 tunel staining Methods 0.000 description 1
- 210000000596 ventricular septum Anatomy 0.000 description 1
- 108700026220 vif Genes Proteins 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70525—ICAM molecules, e.g. CD50, CD54, CD102
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0375—Animal model for cardiovascular diseases
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Environmental Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Animal Husbandry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a construction method and application of a DSC2 gene knockout mouse model, and the DSC2 gene knockout mouse model is applied to the preparation of right heart disease prevention and treatment, right ventricular diastole and contraction monitoring, apoptosis pathway regulation and control reagents and medicines or fibrosis pathway regulation and control reagents and medicines; the DSC2 deletion mutant type mouse is constructed on the basis of a C57BL/6J mouse by using a CRISPR-Cas9 technology, and the DSC2 knockout mouse can effectively induce right ventricular cardiomyopathy and can be used as a mouse model for researching the right ventricular cardiomyopathy; the DSC2 gene is simply knocked out, so that the right ventricular cardiomyopathy expressions such as right ventricular enlargement, right ventricular myocardial fibrosis and middle and late right ventricular heart failure of the mouse can be generated along with the age increase of the mouse, and the mouse model can be used as an effective model in the subsequent molecular mechanism research of the right ventricular cardiomyopathy.
Description
Technical Field
The invention belongs to the technical field of biological engineering, and particularly relates to a construction method and application of a DSC2 gene knockout mouse model.
Background
Since Osler described for the first time the disease mainly involving right ventricular muscle in 1905, parchment of the heart, Uhls malformation, right ventricular dysplasia, and arrhythmogenic right ventricular dysplasia were reported. Since these diseases are mainly involved in right ventricular myocardium, the etiology and the mechanism of occurrence are unclear, and Thiene generally refers to Right Ventricular Cardiomyopathy (RVC) in 1988.
The clinical manifestations of the right ventricular cardiomyopathy are different greatly, part of patients do not have any clinical manifestations, the heart is not enlarged, and the heart is only discovered during autopsy or operation, but most of patients can have palpitation, fatigue, chest distress, dizziness, syncope and even sudden death. A few patients can have right heart failure and hypotensive shock, the patients lack specific signs, the heart range is usually enlarged, the left lower edge of the sternum can hear 1-2 grades of systolic murmurs, pathological third and fourth heart sounds appear, the second sound is wide-divided, tachycardia and the like, and the patients do not have any heart signs.
Echocardiography, cardiac nuclide and cardiovascular radiography examination are reliable methods for determining the present disease. The change is mainly that the right ventricle is enlarged, the movement of the free wall is weakened or disappeared, the ventricular septum moves in the same direction with the back wall of the left ventricle, the apex of the heart, the diaphragm surface and the front wall of the infundibulum can be seen to be diverticular or expanded like tumor, and the trabecula disappears. The heart chamber is reduced due to the normal or pressed left ventricle, and sometimes the left ventricle is slightly enlarged, and the tricuspid valve is in a normal position or accompanied by regurgitation.
According to pathological autopsy, lesions can be focal or diffuse, mainly involve the infundibulum of the anterior wall of the right ventricle (pulmonary artery cone), the apex of the heart and the posterior lower wall, which form a so-called "dysplastic triangle", the right ventricle usually increases spherically, the heart cavity expands, and ventricular aneurysms can form, and the muscular wall of the section ventricle becomes thin to different degrees. Under the mirror: the right ventricular myocardium is replaced by fat tissue or fibrous tissue to different degrees, the lesion is characterized in that the free wall and the cardiac apex of the right ventricle are obvious, and the residual cardiac muscle fiber is atrophied and takes the shape of irregular rope. Focal myocardial necrosis, inflammatory responses and fibrotic changes are seen in some cases.
The study found that myocardial cell necrosis in right ventricular cardiomyopathy may be a genetically determined apoptosis, and that persistent apoptosis may lead to progressive loss of cardiomyocytes to replacement by fibroadipose tissue is attractive because it makes a reasonable explanation for typical right ventricular involvement.
Desmosomes are the primary mode of intercellular junction and are of great importance for maintaining the normal morphology and function of epithelial tissues. Desmoglein (DSC) is one of the cadherin superfamily members, and in combination with Desmoglein (DSG) is called Desmoglein (DC), an important protein component that makes up desmosomes. The human desmosomal cadherin gene is located in the 2 band of the long arm 1 of chromosome 18, and expresses two groups of proteins, namely DSC1-3 and DSG 1-4. Like traditional cadherins, DCs have an intact transmembrane glycoprotein structure with the extracellular portion containing amino acid recognition sequences to complete intercellular desmosomal junctions in the form of heterodimers; the intracellular domain is connected to the cytoplasmic attachment plate, which in turn connects the keratin components of the cytoskeleton.
The DSC2 protein is a cadherin, belongs to a transmembrane protein, is an important component of desmosomes, is highly expressed in myocardium, skeletal muscle and alimentary canal epithelium, is an important connection among myocardial cells, is a key component of an intercalated disc, can maintain the integrity of the structure and the function of myocardial tissues, enhances the adhesion effect of the myocardial cells when bearing mechanical stress, and also widely participates in regulating and controlling signal transduction pathways inside and outside the myocardial cells. By analyzing the crystal structure of the DSC2 protein, the DSC2 can form a dimer structure, the DSC2 protein forms a homodimer during the assembly of the early desmosome, and the DSC2 protein and the DSG2 protein form a heterodimer during the assembly of the mature desmosome. Mutations such as other desmosome-associated proteins (PKP2, DSP, DSG2 and JUP) have been proved to be related to pathogenesis of cardiomyopathy, particularly ARVC and the like, and are mainly related to influences on desmosome and intercalated disc structures of myocardial cells so as to cause cardiomyopathy. Related desmoplakin (PKP2, DSP, DSG2 and JUP) frameshift mutations or inadvertent mutations have been reported to cause embryonic lethality in mice.
The right ventricular cardiomyopathy is a cardiomyopathy which mainly focuses on right ventricular involvement, initially shows that a right ventricle is enlarged, a left ventricle is normal in function, and finally mainly shows intractable right heart failure, and compared with other cardiomyopathies, the right ventricular cardiomyopathy is far from paying attention to the cardiomyopathy clinically. Mouse models for studying right ventricular cardiomyopathy are rare at present, and the mouse models for right heart failure generally adopt pulmonary artery constriction or pulmonary embolism models, so that the model building process is complicated, and the number of interference factors for model induction success is large.
In the classification of cardiomyopathy of WHO, a part of cardiomyopathy without significant arrhythmia is often classified as arrhythmic right ventricular cardiomyopathy (arrhythmogenic right ventricular cardiomyopathy), but actually, the pathological mechanism and the treatment scheme of the cardiomyopathy are completely different, and because the ARVC mouse model is characterized at present, various defects and problems exist, and no report exists at present for the right ventricular cardiomyopathy mouse model with pure right ventricular dilatation and no arrhythmia. Therefore, the establishment of the accurate replication animal model is important for improving the understanding of the pathological process of the right ventricular cardiomyopathy and exploring the optimal strategy for specific treatment.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a mouse model of the right ventricular cardiomyopathy mediated by the DSC2 deletion, the mouse model provides an ideal model for the research of the right ventricular cardiomyopathy, the research of molecular mechanisms and the drug screening of the right ventricular cardiomyopathy, and the mouse model can also be applied to the preparation of related pathway molecular mechanisms for regulating and controlling myocardial apoptosis, fibrosis and the like, and drugs and reagents.
In order to achieve the above purpose, the solution of the invention is as follows:
in a first aspect, the invention provides an application of a DSC2 gene knockout mouse model in preparation of a medicine for preventing and treating right heart disease. Namely, the mouse model with the DSC2 deletion can be used for providing a convenient mouse model for the subsequent related diseases such as right ventricular cardiomyopathy, right ventricular cardiac dysfunction and the like without other operations or drug induction. Specifically, the DSC2 fragment of the mouse was simply knocked out without any drug or surgical treatment, so that right ventricular cardiomyopathy was effectively induced.
Two gRNAs (gRNA 2: 5'-ACGTTGCCATGCAAGAGCCCAGG-3'; gRNA4: 5'-GATAGGAGCCCATCTTCTCTTGG-3') were designed at the editing site to create two gaps in the gene, a truncated fragment created by fragment deletion and frameshift mutation, rendering mouse DSC2 gene unexpressed.
Further, the right heart disease includes right ventricular cardiomyopathy and right heart failure and other related right heart diseases.
In a second aspect, the invention provides application of a DSC2 knockout mouse model in color ultrasound monitoring of right ventricular relaxation and contraction in a small animal. The mouse gradually begins to have the phenomena that the wall of the right ventricle becomes thin, the systolic function of the heart is reduced, the heart chamber of the right ventricle is enlarged and the like at the age of six weeks, and the change of the right ventricle of the mouse can be used for measuring the contraction and relaxation functions of the right ventricle by cardiac ultrasound.
In a third aspect, the invention provides an application of a DSC2 gene knockout mouse model in preparing an apoptosis pathway regulating reagent and a medicament. The experiment detection of the DSC 2-deleted mouse shows that the apoptosis-related indexes (Bax, cleared-caspase 3 and the like) are up-regulated, and the Tunel experiment detects that the apoptosis of the mouse is obviously increased along with the increase of the week-old, so that the mouse can be considered to participate in the apoptosis-related pathway along with the increase of the week-old. The method can be used for researching apoptosis-related pathways and molecular mechanisms and can be used as an effective animal model for developing apoptosis pathway regulation reagents and drug research.
In a fourth aspect, the invention provides an application of a DSC2 gene knockout mouse model in preparing a fibrosis pathway regulation reagent and a medicament. The mouse with DSC2 deficiency gradually generates myocardial fibrosis and even calcification at the beginning of six weeks of age, the mouse can spontaneously generate myocardial fibroplasia without any medicine or surgical intervention, the mouse can effectively research a fibrosis related pathway without any external intervention, can be used for researching the fibrosis related pathway and a molecular mechanism, and can be used as an effective animal model for developing a fibrosis pathway regulation reagent and drug research.
In a fifth aspect, the present invention provides a method for constructing a DSC2 gene knockout mouse model, comprising:
(1) designing and extracorporeally transcribing specific target sites gRNA2 and gRNA4 by using a CRISPR/Cas9 technology, wherein the gene sequences of the gRNA2 and the gRNA4 are respectively shown as SEQ ID No.1 and SEQ ID No. 2;
(2) simultaneously injecting mRNA of Cas9, gRNA2 and gRNA4 into fertilized eggs of a mouse, transplanting the fertilized eggs into a mother mouse for inoculation, and obtaining an F0-generation mouse;
(3) and crossing the F0 mouse and the wild mouse to obtain the DSC2 gene knockout mouse model of F1.
Wherein, in the step (1), the gRNA sequence is as follows:
gRNA2：5’-ACGTTGCCATGCAAGAGCCCAGG-3’(SEQ ID NO.1)；
gRNA4:5’-GATAGGAGCCCATCTTCTCTTGG-3’(SEQ ID NO.2)。
in step (2) and step (3), the Cas9 protein binds to the target site under the guidance of gRNA to cause DNA double strand break, thereby realizing target site base sequence deletion and finally realizing gene knockout. The DSC2 protein function is almost completely lost, so that the mice show the manifestations of right ventricular cardiomyopathy such as right ventricular enlargement, myocardial fibrosis and the like.
In a sixth aspect, the present invention provides a DSC2 gene knockout mouse model, which is a DSC2 gene knockout mouse.
Further, the mouse is a C57BL/6J strain mouse.
In a word, the invention takes a right ventricular cardiomyopathy model induced by a DSC2 deletion mouse caused by frameshift mutation as an experimental disease object, and can effectively induce the right ventricular cardiomyopathy by simply knocking out a mouse DSC2 fragment without any medicine or operation treatment.
Due to the adoption of the scheme, the invention has the beneficial effects that:
the mouse model of the invention constructs DSC2 deletion mutant (DSC2) on the basis of C57BL/6J mice by CRISPR-Cas9 technology without any external intervention treatment (DSC2)-/-) The mouse, DSC2 knockout mouse, can effectively induce right ventricular cardiomyopathy, and can be used for a mouse model for researching the right ventricular cardiomyopathy; and the deletion of DSC2 is closely related to pathological changes such as myocardial fibrosis and apoptosis, and can be used for related molecular mechanisms and related drug researches. The DSC2 gene is simply knocked out, so that the right ventricular cardiomyopathy expressions such as right ventricular enlargement, right ventricular myocardial fibrosis and middle and late right ventricular heart failure of the mouse can be generated along with the age increase of the mouse, and the mouse model can be used as an effective model in the subsequent molecular mechanism research of the right ventricular cardiomyopathy.
Drawings
FIG. 1 is a schematic diagram of the construction process of a DSC2 gene knockout mouse model of the present invention.
FIG. 2 is a schematic representation of right ventricular changes in wild type mice and homozygote mice of the invention.
FIG. 3 is a schematic representation of the myocardial fiber changes of wild-type mice and homozygote mice of the present invention.
FIG. 4 is an electron microscope schematic of wild type mice and homozygous mice of the invention.
FIG. 5 is a schematic representation of the process of myocardial apoptosis in wild-type and homozygous mice of the invention.
Detailed Description
The invention provides a construction method and application of a DSC2 gene knockout mouse model.
By wild type mice (wt/wt), heterozygote mice (DSC2)-/-Wt) and homozygous mice (DSC2)-/-/DSC2-/-) The three mice are found by repeating the test for a plurality of times, and are compared with DSC2-/-Compared with the/wt heterozygote mouse, the DSC2 homozygote knockout mouse can successfully induce a right ventricular cardiomyopathy model, while the DSC2 heterozygote has no relevant performances such as heart enlargement, and the like, and further proves that the right ventricular cardiomyopathy can be effectively induced only when the DSC2 homozygote is knocked out.
DSC2 knock-outThe mouse's performance in right ventricular cardiomyopathy: adopts CRISPR/Cas9 technology to successfully construct whole-body knockout DSC2-/-The change of the right ventricle (systolic area, major diameter, transverse diameter and basal segment; diastolic area, major diameter, transverse diameter and basal segment; change rate of the right ventricle area) of the mouse was observed every other week by color ultrasound of the mouse heart from the age of 4 weeks of the mouse. DSC2 found to be 8 weeks old-/-The area of the right ventricle of the mouse begins to be obviously increased under the heart hyper, so two time points (6 weeks old and 12 weeks old) before and after the enlargement of the right ventricle are selected, and the effect on myocardial fibrosis is observed through Masson staining; observing the condition of myocardial cell apoptosis through Tunel staining; the change of relevant myocardial intercalated disk and mitochondrial ridge structure is detected by an electron microscope.
Specifically, the construction method of the DSC2 gene knockout mouse model comprises the following steps:
(1) designing and extracorporeally transcribing specific target sites gRNA2 and gRNA4 by using a CRISPR/Cas9 technology, wherein the gene sequences of the gRNA2 and the gRNA4 are respectively shown as SEQ ID No.1 and SEQ ID No. 2;
(2) simultaneously injecting mRNA of Cas9, gRNA2 and gRNA4 into fertilized eggs of a mouse, transplanting the fertilized eggs into a mother mouse for inoculation, and obtaining an F0-generation mouse;
(3) extracting tail DNA of the F0 mouse, performing PCR amplification and sequencing the product;
(4) and crossing the F0 mouse and the wild mouse to obtain the DSC2 gene knockout mouse model of F1.
In the step (1), a pair of oligonucleotide sequences with a length of 20bp and aiming at the target DNA is designed according to the height and the sequence specificity of the Score by using a CRISPR Design tool (http:// criprpr. mit. edu /) of the Massachusetts institute of technology. The gRNA sequences are as follows:
gRNA2：5’-ACGTTGCCATGCAAGAGCCCAGG-3’(SEQ ID NO.1)；
gRNA4:5’-GATAGGAGCCCATCTTCTCTTGG-3’(SEQ ID NO.2)。
in step (3), the primer information for PCR amplification is as follows.
TABLE 1 primer information for PCR
| Primer sequence number | Primer name | Sequence (5 '-3') | Sequence listing |
| A1145 | 00002155-Dsc2-KO-tF1 | GCATACCCTCTGTCATTAGCATG | SEQ ID NO.3 |
| A1146 | 00002155-Dsc2-KO-tR1 | GAGTAGGTGGGAGTGAATTTGGTC | SEQ ID NO.4 |
TABLE 2 PCR reaction System
| Reaction Components | Volume(μL) |
| gDNA Template | 2.0 |
| 10×Taq Buffer(mg2+plus) | 2.0 |
| dNTP Mixture(10mM) | 0.5 |
| Primer mix(10μM) | 0.5 |
| Taq DNA polymerase(5U/μL) | 0.5 |
| Milli-Q H2O | To 20μL |
TABLE 3 PCR procedure
| Seg. | Temp. | | Cycle | |
| 1 | 95 | 5min | ||
| 2 | 95 | 30s | ||
| 3 | 58 | 30s | ||
| 4 | 72℃ | 30s | 2-4，40 | |
| 5 | 72℃ | 3min | ||
| 6 | 25℃ | hold |
In steps (2) to (4), the Cas9 protein is combined to the target site under the guidance of gRNA to cause DNA double strand break, thereby realizing target site base sequence deletion and finally realizing gene knockout. The DSC2 protein function is almost completely lost, so that the mice show the manifestations of right ventricular cardiomyopathy such as right ventricular enlargement, myocardial fibrosis and the like
Construction of DSC2 deletion mutant (DSC2) by CRISPR-Cas9 technique as shown in figure 1-/-) Mice: deletion of the 4 th exon of Desmocollin-2(DSC2) on chromosome 18 causes frame shift mutation, advanced appearance of stop codon and generation of truncated protein, thereby causing abnormal expression of DSC2 protein and causing DSC2-/-Is absent.
As shown in FIG. 2, DSC2 of 6 weeks old and 12 weeks old were selected respectively-/-Mice, found to start from 6 weeks, DSC2-/-The mouse hearts began to grow larger and a significant difference in heart size occurred at 12 weeks compared to wild type mice. Color ultrasound of mouse heart showed that the right ventricle of the mouse enlarged from 6 weeks of age, and at 12 weeks of age, DSC2-/-The right ventricle of the mouse is obviously expanded. Gross specimens showed that at 12 weeks of age, mice had enlarged right ventricles and significant thinning of the ventricular walls. This result indicates that DSC2-/-Mice, with increasing age in the week, may spontaneously develop right ventricular dilation and right ventricular wall thinning, consistent with the clinically compromised right ventricular phenotype of right ventricular cardiomyopathy.
As shown in fig. 3, by massson staining and HE staining, it was found that the mice developed fibrosis from six weeks of age, and developed significant fibrosis at 12 weeks of age. DSC2-/-Without any surgery or intervention, fibrosis of the heart muscle occurs spontaneously, which is consistent with the clinical replacement of normal cardiomyocytes by cardiac fibrosis in right ventricular cardiomyopathy.
As shown in fig. 4, the 6-week and 12-week myocardial intercalated disc structures including desmosomal structures under a transmission electron microscope were not obviously damaged by electron microscope analysis, and mitochondria were of different sizes, swollen, visible vacuole-like change, incomplete structures, partial mitochondrial cristae dissolution and rupture, myofiber edema, disorganization, even rupture, and sarcoplasmic reticulum became obviously bigger and brighter. Due to right ventricular cardiomyopathy and Ca2+Associated with, Ca2+The abnormalities of (a) may cause abnormalities in sarcoplasmic reticulum and mitochondria, which proves that DSC2-/-Consistent with the pathogenesis of right ventricular cardiomyopathy.
As shown in FIG. 5, DSC2 was found-/-The mouse can generate the apoptosis of myocardial cells along with the increase of age, and the model which can successfully induce the apoptosis without any operation or intervention treatment can be used for the research of subsequent apoptosis animal experiments.
In conclusion, the invention is a spontaneous right ventricular cardiomyopathy model caused by congenital mouse gene defects, and spontaneous right heart failure can appear in the later stage along with the age of the mice. The mice can spontaneously develop right ventricular cardiomyopathy along with the increase of the week age without any drug intervention or surgical intervention, and the mice show the symptoms of right heart failure at the later stage because the mice gradually develop the right ventricular cardiomyopathy phenotype at the age of six weeks. Because the induction time of the mouse is relatively short (can appear after six weeks of birth), the induction success rate is one hundred percent, the animal model can provide a powerful tool for the research of deep understanding of the pathophysiological mechanism of the right ventricular cardiomyopathy and the right heart failure, and plays an important role in research animal experiments of research and development of right ventricular cardiomyopathy and right heart failure medicines and clinical prevention and treatment.
The previous description of the specific embodiments is provided to enable any person skilled in the art to make or use the present invention. It will be apparent to those skilled in the art that various modifications to the specific embodiments and applications of the general principles described herein may be made without the use of inventive faculty. Therefore, the present invention is not limited to the above-described embodiments. Those skilled in the art should appreciate that many modifications and variations are possible in light of the above teaching without departing from the scope of the invention.
Sequence listing
<110> Zhongshan Hospital affiliated to double-denier university
Construction method and application of DSC2 gene knockout mouse model
<141> 2022-05-24
<150> 2021106901976
<151> 2021-06-22
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Artificial Sequence (Artficial Sequence)
<400> 1
acgttgccat gcaagagccc agg 23
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artficial Sequence)
<400> 2
gataggagcc catcttctct tgg 23
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence (Artficial Sequence)
<400> 3
gcataccctc tgtcattagc atg 23
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artficial Sequence)
<400> 4
gagtaggtgg gagtgaattt ggtc 24
Claims (8)
1. An application of a DSC2 gene knockout mouse model in preparing medicines for preventing and treating right heart diseases.
2. Use according to claim 1, characterized in that: the right heart disease includes right ventricular cardiomyopathy and right heart failure.
3. Use of a DSC2 knockout mouse model for monitoring right ventricular diastole and contraction.
4. An application of DSC2 gene knockout mouse model in preparing apoptosis pathway regulating reagent and medicine.
5. An application of a DSC2 gene knockout mouse model in preparing a fibrosis pathway control reagent and a medicament.
6. A construction method of a DSC2 gene knockout mouse model is characterized by comprising the following steps: it includes:
(1) the gene sequences of a gRNA2 and a gRNA4 of a transcription specific target site are designed and extracorporeally transcribed by using a CRISPR/Cas9 technology, wherein the gene sequences of the gRNA2 and the gRNA4 are respectively shown as SEQ ID No.1 and SEQ ID No. 2;
(2) simultaneously injecting mRNA of Cas9, gRNA2 and gRNA4 into fertilized eggs of a mouse, transplanting the fertilized eggs into a mother mouse for inoculation, and obtaining an F0-generation mouse;
(3) and crossing the F0 generation mouse and the wild type mouse to obtain the DSC2 gene knockout mouse model of F1 generation.
7. A DSC2 knockout mouse model, characterized by: it refers to a mouse with a DSC2 gene knocked out.
8. The DSC2 knockout mouse model of claim 7, wherein: the mice are mice of the C57BL/6J strain.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2021106901976 | 2021-06-22 | ||
| CN202110690197.6A CN113412819A (en) | 2021-06-22 | 2021-06-22 | Construction method and application of DSC2 gene knockout mouse model |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114747542A true CN114747542A (en) | 2022-07-15 |
| CN114747542B CN114747542B (en) | 2023-05-12 |
Family
ID=77789816
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110690197.6A Pending CN113412819A (en) | 2021-06-22 | 2021-06-22 | Construction method and application of DSC2 gene knockout mouse model |
| CN202210566424.9A Active CN114747542B (en) | 2021-06-22 | 2022-05-24 | Construction method and application of DSC2 gene knockout mouse model |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110690197.6A Pending CN113412819A (en) | 2021-06-22 | 2021-06-22 | Construction method and application of DSC2 gene knockout mouse model |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN113412819A (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980879B (en) * | 2021-02-23 | 2023-01-24 | 四川省人民医院 | Construction method and application of retinal vascular disease model |
| CN114451357B (en) * | 2022-01-20 | 2023-06-16 | 中山大学 | Construction method of adult mouse heart failure model based on myocardial retinol metabolic disorder |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017049002A1 (en) * | 2015-09-15 | 2017-03-23 | Massachusetts Institute Of Technology | A humanized mouse model of de novo human acute myeloid leukemia with a matching human immune system |
| CN110476878A (en) * | 2019-08-23 | 2019-11-22 | 复旦大学附属中山医院 | For simulating the method for building up of the mouse atrial fibrillation model of human diseases feature |
-
2021
- 2021-06-22 CN CN202110690197.6A patent/CN113412819A/en active Pending
-
2022
- 2022-05-24 CN CN202210566424.9A patent/CN114747542B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017049002A1 (en) * | 2015-09-15 | 2017-03-23 | Massachusetts Institute Of Technology | A humanized mouse model of de novo human acute myeloid leukemia with a matching human immune system |
| CN110476878A (en) * | 2019-08-23 | 2019-11-22 | 复旦大学附属中山医院 | For simulating the method for building up of the mouse atrial fibrillation model of human diseases feature |
Non-Patent Citations (2)
| Title |
|---|
| 武彤彤;吕丹;: "右室心肌病动物模型研究进展" * |
| 许霏 等: "CRISPR/Cas9技术在遗传性心肌疾病研究中的进展" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114747542B (en) | 2023-05-12 |
| CN113412819A (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114747542A (en) | Construction method and application of DSC2 gene knockout mouse model | |
| CN110382695A (en) | Prevent muscular dystrophy by the gene editing of CRISPR/CPF1 mediation | |
| Sebire et al. | Twin-to-twin transfusion syndrome results from dynamic asymmetrical reduction in placental anastomoses: a hypothesis | |
| Varadkar et al. | Notch2 is required for the proliferation of cardiac neural crest‐derived smooth muscle cells | |
| CN104274464B (en) | The foundation of dilated cardiomyopathy Brachydanio rerio disease model and application | |
| Sedmera et al. | Current issues and perspectives in hypoplasia of the left heart | |
| Rogers | The cardiovascular system | |
| Foo et al. | Effects of extended pharmacological disruption of zebrafish embryonic heart biomechanical environment on cardiac function, morphology, and gene expression | |
| Goehring | Congenital aneurysm of the aortic sinus of Valsalva | |
| WO2018196874A1 (en) | Genetically engineered non-human mammal, construction method therefor and use thereof | |
| CN113134076A (en) | Method for regenerating retinal ganglion cells with functions by using transcription factors | |
| US11795509B2 (en) | Screening kit for paroxysmal supraventricular tachycardia | |
| Rubin et al. | Congenital absence of the right pulmonary artery: Report of a case in a five month old infant, with suggestive evidence of unilateral pulmonary hypertension∗ | |
| US11653636B2 (en) | Method of making a rat model of retinal degeneration and rat model made thereby | |
| WO2001024627A1 (en) | Animal with the mass expression of human gene and test method by using the animal | |
| Philpott | Congenital atresia of aortic ring | |
| Novell et al. | Marfan's syndrome associated with pregnancy | |
| Du et al. | Surgical methods of inducing transverse aortic stenosis and myocardial infarction in the mouse | |
| Aubart et al. | Molecular genetics of the fibrillinopathies | |
| KR20190132069A (en) | A retinal degenerated animal model by PDE6B gene deletion and the preparation method thereof | |
| Wilsdon | Identifying novel genes that cause congenital heart disease | |
| CN114868705A (en) | Retinitis pigmentosa mouse model and construction method thereof | |
| Feit | Genetics of congenital heart disease: strategies | |
| Lewin et al. | The rare association of tetralogy of Fallot with hypertrophic cardiomyopathy. Report of 2 neonatal patients. | |
| Rodrigues et al. | Heterozygous deletion of the Williams-Beuren syndrome critical interval in mice recapitulates most features of the human disorder |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20220715 Assignee: Shanghai lanque biomedical Co.,Ltd. Assignor: ZHONGSHAN HOSPITAL, FUDAN University Contract record no.: X2022980022634 Denomination of invention: Construction and application of DSC2 gene knockout mouse model License type: Exclusive License Record date: 20221121 |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |