CN114736962B

CN114736962B - Application of inhibitor of circDHTKD1 in preparation of medicine for regulating and controlling airway epithelial inflammation

Info

Publication number: CN114736962B
Application number: CN202210566976.XA
Authority: CN
Inventors: 钱粉红; 何山川; 庄琼馨; 杨贤苗; 严梦楠; 陈欣欣; 赵思婷; 曹宇; 刘雨雪
Original assignee: Affiliated Hospital of Jiangsu University
Current assignee: Affiliated Hospital of Jiangsu University
Priority date: 2022-05-24
Filing date: 2022-05-24
Publication date: 2023-01-24
Anticipated expiration: 2042-05-24
Also published as: CN114736962A

Abstract

The invention discloses an application of an inhibitor of circDHTKD1 in preparation of a medicine for regulating airway epithelial inflammation, and belongs to the field of biological medicines. The invention provides an application of a reagent for detecting the expression level of circDHTKD1 in the preparation of a kit for diagnosing and/or detecting airway epithelial inflammation; also provides an application of the reagent for detecting the expression level of circDHTKD1 in preparing a kit for diagnosing and/or detecting asthma. The invention provides an application of a circDHTKD1 inhibitor in preparation of a medicine for regulating airway epithelial inflammation and an application of the circDHTKD1 inhibitor in preparation of a medicine for treating asthma. The invention verifies the action mechanism of circDHTKD1, provides a potential target point for regulating and controlling the human airway epithelial inflammatory injury clinically, and provides a theoretical basis for the research of related medicaments.

Description

Application of inhibitor of circDHTKD1 in preparation of medicine for regulating and controlling airway epithelial inflammation

Technical Field

The invention relates to an application of a circDHTKD1 inhibitor in preparation of a medicine for regulating airway epithelial inflammation, and belongs to the field of biological medicines.

Background

Bronchial asthma is a chronic airway disease characterized by airway inflammation, airway hyperresponsiveness, and airway remodeling, with airway epithelium being an important participant in airway inflammation and airway innate immunity. Circular RNA (circular RNA) is a closed circular non-coding RNA, and more studies have confirmed that circular RNA is widely involved in the pathophysiology of various diseases.

However, the mechanism by which circular RNA participates in the regulation of airway epithelial inflammatory responses is currently unknown. Therefore, the deep research on the action mechanism of circRNA for regulating airway inflammation can provide a new strategy for the diagnosis and treatment of asthma, and has important significance.

Disclosure of Invention

The invention aims to discuss the application of the inhibitor of circDHTKD1 in preparing a medicine for regulating airway epithelial inflammation, the inflammatory effect of LPS on human bronchial epithelial cells (BEAS-2B) and the regulating effect of cyclic RNA (circDHTKD 1) in the medicine.

In order to realize the technical scheme, the invention provides the following technical scheme:

the first technical scheme is as follows: application of a reagent for detecting the expression level of circDHTKD1 in preparation of a kit for diagnosing and/or detecting airway epithelial inflammation.

The second technical scheme is as follows: application of a reagent for detecting the expression level of circDHTKD1 in preparation of a kit for diagnosing and/or detecting asthma.

Further, the circDHTKD1 regulates ERK pathway activation and inflammatory factor secretion through sponge adsorption miR-338-3p so as to realize diagnosis or detection of airway epithelial inflammation or asthma.

Further, the inflammatory factors are IL-6 and VEGF.

The technical scheme is as follows: application of an inhibitor of circDHTKD1 in preparation of medicines for regulating and controlling airway epithelial inflammation.

The technical scheme is as follows: application of an inhibitor of circDHTKD1 in preparation of medicines for treating asthma is provided.

Furthermore, the inhibitor takes circDHTKD1 as a target point, and the aim of regulating airway epithelial inflammation or treating asthma is fulfilled.

Compared with the prior art, the invention has the beneficial effects that:

the research result shows that the circDHTKD1 promotes LPS to induce BEAS-2B cells to generate inflammatory reaction, and the circDHTKD1 regulates an ERK channel through miR-338-3p and influences the inflammatory reaction induced by LPS. The invention proves that the circDHTKD1 is a key molecule for regulating and controlling airway epithelial inflammation, and the circDHTKD1 is expected to become a therapeutic target of the airway inflammation, provides a potential target for inhibiting the injury of the airway epithelial inflammation of a human clinically, and provides a theoretical basis for the research of related medicine targets. The research result of the invention provides a new pathophysiological mechanism for the occurrence of the bronchial asthma, and can be used for preventing and treating the bronchial asthma.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required in the embodiments will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a graph showing the results of analysis of the effect of LPS on the viability of BEAS-2B cells in CCK8 assay;

FIG. 2 shows the effect of LPS on the expression of BEAS-2B cell inflammatory factors (IL-6, IL-8, TNF-. Alpha.and VEGF), where A is the relative expression level of mRNA and B is the protein expression level;

FIG. 3 is a graph showing the results of relative expression of circDHTKD by qRT-PCR;

FIG. 4 is a graph of Sanger sequencing results;

FIG. 5 is a diagram showing the results of detecting the subcellular localization of circDHTKD1 in a nucleoplasm separation experiment;

FIG. 6 shows the effect of the knockdown of circDHTKD1 on the expression level of circDHTKD1 as determined by qRT-PCR;

FIG. 7 shows the detection of inflammatory factor changes following the knockdown of circDHTKD1, where panel A is the change in IL-6 mRNA expression; panel B is a graph of detecting changes in mRNA expression of IL-8; panel C is a graph measuring changes in mRNA expression of TNF- α; graph D is the detection of mRNA expression changes in VEGF; e is a graph of detecting changes in the expression levels of inflammatory factor protein;

FIG. 8 is a schematic diagram of the targeting validation of circDHTKD/miR-338-3 p;

FIG. 9 is a graph showing the results of a dual luciferase assay;

FIG. 10 is a graph of the knockdown circDHTKD1 detection of miR-338-3p expression level changes;

FIG. 11 is a schematic diagram showing the results of detecting protein expression after miR-338-3p expression is changed;

FIG. 12 is a schematic representation of the detection of protein expression of ERK, P-ERK;

FIG. 13 is a graph showing the expression of IL-6 and VEGF proteins detected, wherein FIG. A is a graph showing the expression of VEGF proteins; FIG. B is a schematic representation of IL-6 protein expression.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the documents are cited. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

The Opti-MEM medium used in the examples was from Gibco; the dual-luciferase reporter gene detection kit adopts Beijing Quanzijin Biotechnology company, model FR201; IL-6, IL-8, TNF- α and VEGF ELISA kits were purchased from Shanghai Bin Yuntian Biotechnology Ltd.

Example 1

Materials and methods

1. Test object

The human bronchial epithelial cell line (BEAS-2B) was purchased from the Shanghai cell Bank of the Chinese academy of sciences.

2. Experimental methods

2.1 main grouping:

(1) Effect of LPS on cell viability: 0. Mu.g/mL, 0.5. Mu.g/mL, 1. Mu.g/mL, 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL.

(2) Effects of LPS on airway epithelial cells: control and LPS treated groups were divided.

(3) Effect of circDHTKD1 on gene expression: divide (1) into control group, (2) LPS-treated group, (3) si-NC + LPS-treated group and (4) si-circ #1+ LPS group.

(4) The dual luciferase reporter gene experiments were grouped as follows: (1) circ-WT + miR-NC, (2) circ-WT + miR-338-3p mix, (3) circ-MUT + miR-NC and (4) circ-MUT + miR-338-3p mix.

(5) Effect of miR-338-3p on Gene expression: (1) control group, (2) LPS treated group, (3) miR-NC + LPS treated group and (4) miR-338-3p mix + LPS group.

(6) Functional rescue experiments were grouped as follows: (1) control group, (2) LPS + si-NC group, (3) LPS + si-circ #1 group, (4) LPS + si-circ #1 group, (5) LPS + si-circ #1+ miR inhibior NC group and (6) LPS + si-circ #1+ miR-338-3p inhibior group.

2.2 cell culture

BEAS-2B cells were cultured in RPMI-1640 medium (Thermo Fishier Scientific) supplemented with 10% bovine serum albumin (BSA; sigmaAldrich) and 100U/mL penicillin and 100. Mu.g/mL streptomycin at 5% CO ₂ The culture was carried out at 37 ℃ in a humid environment.

2.3 construction of LPS-induced bronchial epithelial cell inflammation model

Collecting BEAS-2B cells with good growth state and more than 80% of the cells paved on a cell culture dish, digesting, centrifuging, discarding supernatant, adding 1mL RPMI-1640 containing no double antibody for complete medium resuspension, and counting with a cell counting plateAnd (4) counting. According to 5X 10 per hole ⁵ The individual cells were seeded in 6-well plates at 5X 10 per well ⁴ Inoculating individual cells to 96-well plate, mixing gently to distribute cells uniformly, placing the culture dish flat, standing at 37 deg.C, 5% CO ₂ Culturing in an incubator. When the cells in the plate were cultured to 80% confluency, the original medium was discarded, and different concentrations of LPS (0. Mu.g/mL, 0.5. Mu.g/mL, 1. Mu.g/mL, 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL) were added to the medium to continue the culture for 24 hours.

2.4 CCK8 assay for cell viability

Adjusting the cell suspension concentration to 5X 10 ⁵ one/mL, adding 100 μ L of each well into a 96-well cell culture plate, setting a blank control group (only adding 100 μ L of culture medium), and setting three multiple wells for the same sample; adding 100 mu L PBS into peripheral holes at the periphery to reduce errors, culturing for 24h in a 5% incubator at 37 ℃, removing the original culture medium, taking 100 mu L of newly prepared culture medium (0 mu g/mL, 0.5 mu g/mL, 1 mu g/mL, 5 mu g/mL, 10 mu g/mL and 20 mu g/mL) containing LPS with different concentrations from each group, adding the culture medium containing the PBS with the same volume as the control group, continuing to culture for 24h, adding 10 mu L CCK-8 reagent into a super clean bench in a dark place, shaking gently and mixing uniformly, placing the mixture into the incubator for continuing 1-2 h, opening an enzyme labeling instrument to preheat to 37 ℃, and measuring the absorbance at the wavelength of 450 nm.

2.5 cell transfection

One day before transfection, cells were treated according to the above method, and 5X 10 cells were subjected to density adjustment using antibiotic-free RPMI-1640 complete medium ⁵ And inoculating the cells into a 6-hole cell culture plate, and culturing overnight to ensure that the cell confluency reaches 50-70% the next day. The original medium was aspirated off and the cells were gently rinsed twice with PBS. Add 1.5mL of Opti-MEM medium per well. Two 1.5mL enzyme-free EP tubes, labeled A and B, were prepared, and 125. Mu.L of Opti-MEM medium was added to each of the A, B tubes, and the wells were prepared in bulk. Add 5. Mu.L Lipofectamine to the EP labeled A ^TM 3000, blowing and beating by a pipettor and uniformly mixing; and adding 5 mu L of si-RNA or miR-imic/miR-inhibitor into the EP tube marked with the B, and blowing and beating by a pipette to be uniformly mixed. Mixing the solution in the tube A and the tube B, blowing and stirring uniformly, and standing for 15min at room temperature. Add 250. Mu.L of the mixture to the corresponding wellIn, after shaking and mixing, the mixture is placed at 37 ℃,5 percent of CO ₂ After culturing for 8h in the incubator, the transfection medium is discarded, and the complete medium without antibiotic is replaced by RPMI-1640 to continue culturing. And LPS treatment is carried out subsequently. All RNA sequences used in the transfection experiments are shown in table 1.

TABLE 1 RNA sequences for cell transfection experiments

2.6 RT-PCR and quantitative RT-PCR

Total cellular RNA was extracted with RNAasso PLUS according to PrimeScript ^TM The RTReagent kit instructions prepared a reverse transcription reaction system (as shown in table 2) and the reverse transcription program was set as follows: 15min at 37 ℃ (reverse transcription); 5sec at 85 ℃ (inactivation reaction of reverse transcriptase); infinity at 4 ℃. According to TB

Premix Ex Taq ^TM The kit instruction prepares a reaction system (shown in table 3), and the real-time fluorescent quantitative PCR reaction program is as follows: pre-denaturation at 95 ℃ for 30s; PCR reaction at 95 ℃ for 5s,40 cycles; annealing the primer at 60 ℃ for 30s; primer extension 60 ℃ for 60s. After the reaction is finished, obtaining the CT value, and adopting 2 ^-ΔΔct The relative expression of mRNA was analyzed and statistically analyzed (see FIG. 1 for results).

Primer sequences used in the experiments (as shown in Table 4)

TABLE 2 reverse transcription reaction System of 20. Mu.L

Name of reagent	Amount of addition
		5×PrimeScript ^TM Buffer	4μL
PrimeScript ^TM RT Enzyme Mix	1μL
		Oligo dT Primer(50μM)	1μL
Random
	6 mers(100μM)	1μL
Total RNA			1μL
	RNase-free Water	12μL
Total			20μL

TABLE 3 20 μ L real-time fluorescent quantitative PCR reaction System

TABLE 4 primers used in RT-qPCR experiments

2.7 Dual luciferase reporter Gene detection

A wild-type circ-WT fragment containing the full length of circDHTKD1 and having miR-338-3p binding site, and a mutant circ-MUT fragment with mutated binding site were synthesized and inserted into psiCHECK2 vector. Wild type and mutant dual-luciferase reporter plasmids, miR-338-3p-mimic or mimic NC and Lipofectamine ^TM 3000 cells were co-transfected with the formulated complex, as described above. After 48 hours of incubation, cells were collected and lysed and Relative Light Units (RLU) of firefly luciferase and renilla luciferase were determined using the dual-luciferase assay kit.

One day before transfection, cells were treated according to the above method, and 5X 10 cells were subjected to density adjustment using antibiotic-free RPMI-1640 complete medium ⁵ And (3) inoculating each cell in a 6-hole cell culture plate, and culturing overnight to ensure that the cell confluency reaches 50-70% on the next day. The original medium was aspirated off and the cells were gently rinsed twice with PBS. Add 1.5mL of Opti-MEM medium per well. Two 1.5mL enzyme-free EP tubes, labeled A and B, were prepared, and 125. Mu.L of Opti-MEM medium was added to each of the A, B tubes, and the wells were prepared in bulk. Add 5. Mu.L Lipofectamine to EP labeled A ^TM 3000, blowing and beating by a pipettor and uniformly mixing; and adding 5 mu L of si-RNA or miR-imic/miR-inhibitor into the EP tube marked with the B, and blowing and beating by a pipette to be uniformly mixed. Mixing the solution in the tube A and the tube B, blowing and stirring uniformly, and standing at room temperature for 15min. Adding 250 μ L of the mixture to the corresponding wells, shaking and mixing, and then subjecting to 37 deg.C, 5% CO ₂ After culturing for 8h in the incubator, the transfection medium is discarded, and the complete medium without antibiotic is replaced by RPMI-1640 to continue culturing. Followed by LPS treatment. All RNA sequences used in the transfection experiments are shown in table 1.

2.8 Western blot

Total protein was extracted from cultured BEAS-2B cells using RIPA lysate. The protein concentration was detected by BCA protein detection kit produced in petun sky. Subsequently, the proteins were mixed with 5 Xprotein loading buffer and boiled at 95 ℃ for 5min, separated by SDS-PAGE electrophoresis and transferred to PVDF membrane. Blocking with 5% bovine serum albumin solution at room temperature for 2h, then incubating the PVDF membrane with protein and the diluted primary antibody at 4 ℃ overnight, washing the membrane with TBST for 3 times, incubating the secondary antibody and the PVDF membrane at room temperature for 2h, washing the membrane with TBST for 3 times, developing with ECL luminescence solution, taking a picture with a gel imaging system, and storing. The gene GAPDH was normalized as an internal control.

2.9 extraction of RNA by nucleoplasm separation

According to PARIS ^TM The kit is used for separating and extracting total RNA of cytoplasm and nucleus of BEAS-2B cells. The subcellular localization of circRNA was performed by qRT-PCR experiments. GAPDH and NEAT1 were used as cytoplasmic and nuclear controls, respectively.

2.10 enzyme-linked immunosorbent assay (ELISA)

BEAS-2B cells at 2X 10 per well ⁵ The density of individual cells was seeded in 12-well plates. The cell culture dish supernatant was collected from a sterile 1.5mL EP tube, centrifuged at 2000rpm for 20 minutes, and the supernatant was collected. The levels of inflammatory cytokines IL-6, IL-8, TNF- α and VEGF were detected by enzyme linked immunosorbent assay with reference to kit instructions. OD (optical Density) measurement at 450nm wavelength by using full-function microplate reader ₄₅₀ The value is obtained.

2.11 nucleic acid electrophoresis and Sanger sequencing

And (3) carrying out electrophoretic separation on the PCR experimental product in 2% agarose gel, observing the product by an ultraviolet imaging system, cutting the gel, and sequencing the gel by Shanghai biological engineering Co.

2.12 statistical analysis method

The present study analyzed quantitative data using SPSS 20.0 software, expressed as mean ± standard deviation. Differences between two or more groups were assessed by Student T-test or ANOVA (analysis of variance) method. Significant differences were considered to exist at P values < 0.05.

Model of inflammation induced by LPS (lipopolysaccharide) in BEAS-2B cells

3.1 dilution of LPS to various concentrations (0. Mu.g/mL, 0.5. Mu.g/mL, 1. Mu.g/mL, 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL) with 10-th of FBS-containing, diabody-free RPMI-1640 medium, and culturing of BEAS-2B cells for 12h. The CCK-8 method detects the influence of HDM with different concentrations on cell proliferation. As shown in FIG. 1, LPS at a concentration of 5. Mu.g/mL or more significantly inhibited the activity of BEAS-2B cells, as compared to the control group.

3.2 the experimental group stimulates the cells with LPS of 5. Mu.g/mL for 24h, the control group is given PBS of equal volume, after RNA extraction, mRNA expression levels of IL-6, IL-8, TNF-alpha and VEGF are detected by real-time fluorescent quantitative PCR. As shown in FIG. 2, the relative mRNA expression levels of IL-6, IL-8, TNF-. Alpha.and VEGF and the supernatant protein content were significantly increased in the LPS group compared to the control group.

4.circDHTKD1 promotes LPS to induce inflammatory reaction of BEAS-2B cells.

4.1 As shown in FIG. 3, the results of the qRT-PCR experiment resulted in increased expression of circDHTKD1 by LPS treatment compared to the negative control group.

4.2 The circDHTKD1 localizes cytoplasm, and Sanger sequencing confirms that it is a circular RNA molecule formed by reverse splicing. Sanger sequencing results showed a sequence containing the reverse splice site, indicating that the product is a circular RNA (see figure 4 for details). Furthermore, subcellular localization of circDHTKD1 in BEAS-2B cells was examined by nucleoplasmic separation experiments, and it was found that circDHTKD1 was significantly enriched in the cytoplasm of BEAS-2B cells (see FIG. 5 for details)

4.3 Role of circDHTKD1 in LPS-induced BEAS-2B cell inflammatory injury: design 2 siRNA targeting circDHTKD1 (si-circ #1 and si-circ # 2) were subject to gene expression interference.

Design 2 siRNA targeting circDHTKD1 (si-circ #1 and si-circ # 2) was subjected to gene expression interference, and 48h after transfection, the expression of circDHTKD1 was detected by qRT-PCR. The results are shown in detail in FIG. 6, and compared to si-NC, the expression level of circDHTKD1 was significantly reduced after transient transfection of these 2 pairs of siRNA 48h, with the downregulation of circDHTKD1 levels by transfection of si-circ #1 being more significant. Si-circ #1 was chosen for subsequent experiments.

4.4 interference with circDHTKD1 expression and LPS stimulation for 24 hours, significant reductions were observed in both IL-6 and VEGF mRNA expression levels in BEAS-2B cells and protein expression levels in cell culture supernatants (see FIG. 7 for details).

circDHTKD1 as a sponge for miR-338-3p

5.1 bioinformatics predicts that circDHTKD1 has a miR-338-3p binding site (see FIG. 8 in detail), and a dual-luciferase reporter gene experiment proves that the circDHTKD1 and miR-338-3p have a binding relationship. After miR-338-3p micic and circ-WT/circ-MUT plasmid transfect cells, miR-338-3p is found to obviously reduce the activity of circ-WT luciferase, and has no inhibition effect on the activity of circ-MUT luciferase. Suggesting that the circDHTKD1 can be combined with miR-338-3p in a targeting way (see figure 9 for details).

5.2 after siRNA is transfected in BEAS-2B cells to interfere the expression of circRNA, the relative expression quantity of miR-338-3p is up-regulated (see FIG. 10 for details).

circDHTKD1 regulates ERK pathway through miR-338-3p and influences inflammatory reaction induced by LPS

6.1 miR-338-3p targets the ERK signaling pathway: after miR-338-3p mimic is transfected, the expression level of miR-338-3p in cells is obviously increased. When cells transfected with miR-338-3p imic are stimulated by LPS for 24 hours again, the protein levels of IL-6 and VEGF are remarkably reduced, and the phosphorylation level of ERK protein is also reduced (see figure 11 for details).

6.2 The circDHTKD1/miR-338-3p axis regulates ERK protein phosphorylation level and IL-6 and VEGF synthesis and secretion: after the circDHTKD1 siRNA and miR-338-3p inhibitor are co-transfected into BEAS-2B cells respectively, compared with an LPS + si-NC group, the ERK phosphorylation level of the LPS + si-circ #1 group is reduced; compared with the LPS + si-circ #1+ miR inhibitor NC group, the p-ERK protein level of the LPS + si-circ #1+ miR-338-3p inhibitor group is increased. The knockdown of circDHTKD1 inhibits the activation of ERK signaling pathway induced by LPS, and miR-338-3p inhibitor is transfected to reverse the reduction of ERK protein phosphorylation caused by circDHTKD1 knockdown (see FIG. 12 for details). By detecting the expression of IL-6 and VEGF in cell supernatants through ELISA experiments, miR-338-3p inhibitor transfected can reverse the reduction of IL-6 and VEGF protein expression caused by circDHTKD1 knockdown (see figure 13 for details).

The research shows that in the process of treating BEAS-2B cells by LPS, circDHTKD1 regulates ERK pathway activation and inflammatory factor secretion by absorbing miR-338-3p through a sponge.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Claims

1. Use of an agent for detecting the expression level of circular RNA circDHTKD1 in the preparation of a kit for diagnosing airway epithelial inflammation, wherein the circular RNA circDHTKD1 comprises a sequence of an inverted splice site, the sequence being: ATGCTGGAATCTCAGTTGATCATGGCCTTGC, the reverse splice site is between positions 15-16 of the sequence;

the reagent for detecting the expression level of the circular RNA circDHTKD1 comprises an upstream primer with the sequence of CTCCCAACTTCAGAGCCAGG and a downstream primer with the sequence of GCAAGGCCATGATCAACTGAG.

2. The use of claim 1, wherein the circular RNA circDHTKD1 regulates ERK pathway activation and inflammatory factor secretion by sponge adsorption of miR-338-3 p.

3. The use according to claim 2, wherein the inflammatory factors are IL-6 and VEGF.

4. Use of an inhibitor of the expression of circular RNA circDHTKD1 in the manufacture of a medicament for modulating airway epithelial inflammation, wherein the circular RNA circDHTKD1 comprises the sequence of the inverted splice site: ATGCTGGAATCTCAGTTGATCATGGCCTTGC, the reverse splice site is between positions 15-16 of the sequence;

the expression inhibitor comprises siRNA targeting circular RNA circDHTKD1, and the siRNA is si-circ #1; the si-circ #1 comprises a plus strand of sequence GCUGGAAUCUCAGUUGAUCAU and a minus strand of sequence AUGAUCAACUGAGAUUCCAGC.

5. The use of claim 4, wherein the expression inhibitor targets circular RNA circDHTKD1 for the purpose of modulating airway epithelial inflammation.