CN114736878B

CN114736878B - Co-expression pig interferon L3 and pig interleukin 22 recombinant baculovirus and application thereof

Info

Publication number: CN114736878B
Application number: CN202110017853.6A
Authority: CN
Inventors: 刘平黄; 徐发荣
Original assignee: Qinhuangdao Modern Dog Biotechnology Co ltd
Current assignee: Qinhuangdao Modern Dog Biotechnology Co ltd
Priority date: 2021-01-07
Filing date: 2021-01-07
Publication date: 2024-04-19
Anticipated expiration: 2041-01-07
Also published as: CN114736878A

Abstract

The invention discloses a recombinant baculovirus for co-expressing porcine interferon L3 and porcine interleukin 22 by using a baculovirus/insect cell expression system. Co-expressed rPoIFN-L3 and rPoIL-22 can be secreted and expressed in cell supernatant through indirect immunofluorescence and Western-blot. Co-expressed rPoIFN-L3 and rPoIL-22 have good biological activity and can effectively inhibit TGEV/PEDV/PDCoV infection in vitro respectively. In addition, rPoIFN-L3 and rPoIL-22 were found to have synergistic anti-TGEV/PEDV effects in vitro at 50ng/mL concentrations. The protein expression system can obtain a large number of rPoIFN-L3 and rPoIL-22 with biological activity, and the invention provides a foundation for further realizing industrialized preparation for resisting porcine enterocoronavirus infection.

Description

Co-expression pig interferon L3 and pig interleukin 22 recombinant baculovirus and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to a recombinant baculovirus for co-expressing porcine interferon L3 and porcine interleukin 22 by using a baculovirus/insect cell expression system and application thereof.

Background

Diarrhea caused by enteroviruses is very common in the pig industry and has important economic significance, with coronaviruses being the most prominent, consisting of 4 genera α, β, γ and δ. Among several porcine enterocoronaviruses that have been discovered, transmissible gastroenteritis virus (TGEV), porcine Epidemic Diarrhea Virus (PEDV) and porcine acute diarrhea syndrome coronavirus newly appeared in 2017 (SADS-CoV) are among the alpha coronaviruses and porcine delta coronavirus (PDCoV) are among the delta coronaviruses. Examination of porcine diarrhea associated virus in southern areas from 2012 to 2018 shows that PEDV is the most commonly detected virus with a prevalence of 50.21% to 62.10% in the sample, followed by PDCoV. In addition to individual infections, mixed infections are also very common for several porcine enterocoronaviruses. Several porcine enteroviruses, which differ in their antigens, do not provide cross-protection. There is a need for vaccines or therapeutics against a single virus, but so far no report has been made on PDCoV and SADS-CoV vaccines, which makes how to effectively inhibit several porcine enterocoronavirus infections a problem to be solved.

Several porcine enteroviruses were found to have their cell receptors that, although different, all act primarily on intestinal epithelial cells. The cytokines IFN-L and IL-22 of the IL-10 family selectively act on mucosal epithelial cells, such as the respiratory tract, intestinal tract, etc. It plays an important role in the mucosal epithelial barrier anti-infective process. Our laboratory preliminary studies demonstrated that prokaryotic expression of IL-22 and IFN-L significantly inhibited porcine enterocoronavirus infection, and IFN-L3 was superior to IFN-L1 and type I interferon (IFN- α) in resisting porcine enterocoronavirus. In addition, the research indicates that IFN-L and IL-22 can synergistically inhibit rotavirus infection, and in view of the fact that porcine enterocoronavirus and rotavirus mainly act on intestinal epithelial cells, we speculate that IFN-L3 and IL-22 can synergistically inhibit porcine enterocoronavirus infection.

The baculovirus/insect cell expression system has the advantages of high product expression level in the practical application process, post-translational processing of the expression product, similar biological activities of immunogenicity, antigenicity, function and the like of the exogenous protein to those of the natural protein, low cost of large-scale production of genetic engineering products and the like, and is one of four expression systems of genetic engineering. There has been no report of co-expression of porcine interferon L3 and porcine interleukin 22 using baculovirus/insect cell expression systems.

Disclosure of Invention

In view of the above circumstances, in order to solve the problems of the above-mentioned techniques, the present invention proposes that the recombinant baculovirus of porcine interferon L3 and porcine interleukin 22 is co-expressed by using a baculovirus/insect cell expression system, and the co-expressed rPoIFN-L3 and rPoIL-22 can be secreted and expressed in the cell supernatant by indirect immunofluorescence and Western-blot. Co-expressed rPoIFN-L3 and rPoIL-22 have good biological activity and can effectively inhibit TGEV/PEDV/PDCoV infection in vitro respectively. In addition, rPoIFN-L3 and rPoIL-22 were found to have synergistic anti-TGEV/PEDV effects in vitro at 50ng/mL concentrations. A large number of rPoIFN-L3 and rPoIL-22 with biological activity can be obtained through the protein expression system, and a foundation is laid for further realizing the industrialized preparation for resisting the porcine intestinal coronavirus infection.

Co-expressing porcine interferon L3 and porcine interleukin 22 recombinant baculovirus comprises the following steps:

(1) Construction of baculovirus expression vectors

Amplifying the full length of rPoIFN-L3 and rPoIL-22 genes to obtain PCR products; performing gel cutting purification on the obtained PCR product, firstly performing double enzyme cutting on pFastBacdual vectors by using EcoRI and HindIII, performing double enzyme cutting on rPoIFN-L3 subjected to gel cutting purification by using EcoRI and HindIII, and performing PCR purification on the enzyme-cut product; ligating the digested pFastBacdual to rPoIFN-L3 using T4 ligase; carrying out double digestion on pFastBacdual-rPoIFN-L3 plasmid with correct sequence by using XhoI and Sph I, and carrying out double digestion on rPoIL-22 obtained by gel cutting and purification by using XhoI and Sph I; then extracting the plasmid to obtain pFastBacdual-rPoIFN-L3-rPoIL-22 plasmid;

(2) Construction of recombinant baculoviruses

PFastBacdual-rPoIFN-L3-rPoIL-22 is transformed into competent DH10Bac, and then 3 times of blue and white spot screening is carried out, and pole grains are extracted;

(3) Expression of rPoIFN-L3 and rPoIL-22

Firstly, transfecting insect cells, and culturing SF21 cells in Grace's culture solution containing 10% fetal bovine serum; preparing stem grain DNA, cellfectin reagent, mixing in a sterilizing tube, and centrifuging to remove cells and large fragments; filtering the supernatant by using a filter, transferring the supernatant into a new centrifuge tube, and preserving the supernatant in a dark place to obtain a P1 strain; inoculating the P1 generation virus into cells, and collecting supernatant to obtain P2 generation virus; inoculating the P2 generation virus into insect cells to obtain P3 generation virus; the P3 generation virus was inoculated into cells, the supernatant was collected, centrifuged to remove the cells and large debris, and after the supernatant was filtered using a filter, the supernatant was transferred to a new centrifuge tube to obtain a supernatant containing rPoIFN-L3 and rPoIL-22.

The application discloses a recombinant baculovirus for coexpression of porcine interferon L3 and porcine interleukin 22, which comprises the following steps:

1) Cutting gel sheets containing DNA fragments with a clean scalpel, placing the gel into pre-weighed EP tubes and weighing, and recording the gel weight;

2) Adding 1 volume of Binding Buffer into the gel slice;

3) Incubating the gel mixture at 58 ℃ for about 10min until the gel sheet is completely dissolved, inverting the mixing tube every 2min during which to promote thawing;

4) Transferring the dissolved gel solution to a Gene JET purification column, centrifuging for 1min at 12000r/min, discarding the liquid in a collecting pipe, and putting the purification column into a recovery header again;

5) Adding the Wash Buffer into a purification column, centrifuging for 1min at 12000r/min, discarding the liquid in a collecting pipe, and putting the purification column into a recovery collecting pipe again;

6) Centrifuging the empty Gene JET purification column 12000r/min for 1min;

7) Transferring the purified column into a new EP tube, adding 65 ℃ sterilized water into the column, standing for 1min, centrifuging for 1min at 12000r/min, measuring the concentration by an ultraviolet spectrophotometer, and preserving to-20 ℃.

The co-expression of the porcine interferon L3 and the porcine interleukin 22 recombinant baculovirus according to the application, in the step (1), the enzyme digestion product is subjected to the following PCR purification steps:

1) Transferring the enzyme-cleaved product to a clean EP tube;

2) Adding Binding Solution with 3 times of volume into the enzyme digestion product, and oscillating and uniformly mixing;

3) Placing the Spin Column into a collection tube, transferring the mixture of 2) into the Spin Column at 12000

Centrifuging at r/min for 1min, discarding the liquid in the collecting pipe, and putting the Spin Column into the recovery collecting pipe again;

4) Adding Wash Solution into the Column, standing for 1min, centrifuging for 1min at 12000r/min, discarding the liquid in the collecting pipe, and placing Spin Column into the recovery header again; repeating this step once;

5) Centrifuging at 12000r/min for 5min, transferring Spin Column into new EP tube, adding 65 deg.C sterilized water to Spin Column, standing for 1min, and centrifuging at 12000r/min for 1min; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

According to the application, the recombinant baculovirus of the co-expressed porcine interferon L3 and porcine interleukin 22 is characterized in that in the step (1), the enzyme-cleaved pFastBacdual is connected with rPoIFN-L3 by using T4 ligase, and the connection procedure is as follows: the ligation product was transformed at 25℃for 2h and 65℃for 15min, the transformation steps were as follows:

1) Adding 10 μl of the ligation product into 100 μLDH5α competence, ice-bathing for 30min, heat-shocking at 42deg.C for 1min, and standing on ice for 3min;

2) 800 mu L of antibiotic-free LB is added into the mixture, and the mixture is put into a shaking table to shake for 50min at 37 ℃ and 220 r/min;

3) Centrifuging at 800r/min for 5min, removing the supernatant, and coating on solid LB plate with ampicillin resistance at 37deg.C

The incubator was left for 15h.

The recombinant baculovirus co-expressing the porcine interferon L3 and the porcine interleukin 22 is characterized in that in the step (1), plasmid extraction is carried out, and the steps are as follows:

1) Pouring the bacterial liquid into a 2mLEP tube, centrifuging for 1min at 12000r/min, and discarding the supernatant;

2) Taking 250 mu L S to precipitate, and re-suspending the precipitate; taking 250 mu L S to a tube, turning over for 4-6 times, uniformly mixing for no more than 5min;

3) Taking 350 mu L S to a tube, turning over the tube up and down for 6 to 8 times, and centrifuging the tube for 10 minutes at 12000 r/min;

4) Taking out the supernatant, placing the supernatant on a column, placing the column in a 2mL collecting pipe, and centrifuging for 1min at 12000 r/min; discarding the liquid in the collection tube, and putting the column in the recovery header again;

5) Adding 500 mu LWash to the column, centrifuging at 12000r/min for 1min; discarding the liquid in the collection tube, and putting the column in the recovery header again;

6) Adding 700 mu LWash to the column, and centrifuging at 12000r/min for 1min; discarding the liquid in the collection tube, and putting the column in the recovery header again; repeating this step once; exchanging the collection tube for a 1.5mLEP tube;

7) Taking 50 mu L of 65 ℃ endotoxin-free water into a column, standing for 1min, and centrifuging for 1min at 12000 r/min; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

According to the application, the recombinant baculovirus of the co-expressed porcine interferon L3 and porcine interleukin 22 is prepared by transforming pFastBacdual-rPoIFN-L3-rPoIL-22 into competent DH10Bac in the step (2), and screening by blue and white spots for 3 times, wherein the steps are as follows:

1) Taking 5 mu L of plasmid to DH10Bac competence, uniformly mixing, carrying out ice bath for 30min, carrying out heat shock for 30s at 42 ℃, and placing on ice for 3min;

2) 800 mu L of antibiotic-free LB is added into the mixture, and the mixture is put into a shaking table for shaking for 4 hours at 37 ℃ and 220 r/min;

3) Respectively diluting the transformants with antibiotic-free LB according to the ratio of 1:10, 1:100 and 1:1000, respectively taking 100 mu L of each transformant, and coating the 100 mu L of each transformant onto a solid LB plate which is prepared in advance and used for screening blue and white spots, and keeping out of light for 24 hours at 37 ℃;

4) Several white colonies are selected from each plate, streaked on a solid LB plate of a new blue and white spot screening, and subjected to a 2 nd round of blue and white spot screening, 3 rounds of screening, white colonies are selected to liquid LB containing Kan, gen, tet, and shaking is carried out at 37 ℃ for 24 hours at 220 r/min.

The co-expression of the porcine interferon L3 and the porcine interleukin 22 recombinant baculovirus according to the application, in the step (2), the extraction of the bacmid is carried out, and the steps are as follows:

1) Pouring the bacterial liquid into a 2mL EP tube under the aseptic condition, centrifuging for 1min at 12000r/min, and discarding the supernatant;

2) Taking 250 mu L S to precipitate, and re-suspending the precipitate;

3) Taking 250 mu L S to a tube, turning over the tube up and down for 4 to 6 times, and uniformly mixing for less than 5 minutes;

4) Taking 350 mu L S to a tube, turning over the tube up and down for 6 to 8 times, and centrifuging the tube at 13000r/min and 4 ℃ for 15min;

5) Sucking the supernatant to another EP tube, adding equal volume of isopropanol, mixing, standing at 4deg.C for 30min, and standing at 12000r/min

Centrifuging at 4deg.C for 15min;

6) Discarding the supernatant, adding 500 μl of 70% absolute ethanol, reversing upside down, washing the precipitate, and centrifuging at 12000r/min for 5min;

7) Discarding ethanol, drying for 10min, and dissolving with 65deg.C 80 μl endotoxin-free water; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

The recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 according to the present application, wherein in step (3), insect cells are transfected and SF21 cells are cultured in Grace's medium containing 10% fetal bovine serum; the preparation rod grain DNA, cellfectin reagent is mixed in a sterilizing tube, and the operation steps are as follows:

1) 2ug of purified bacmid DNA was diluted into 100. Mu.L of non-supplemented Grace medium;

2) Completely mixing the Cellfectin reagent, and turning over and mixing for 5-10 times; aspirate 8. Mu. L CELLFECTIN reagent diluted into 100. Mu.L of non-supplemented Grace medium;

3) Diluted bacmid DNA (total volume about 210 ul) was ligated using diluted Cellfectin reagent; mixing lightly, and incubating for 30min at room temperature;

4) During the incubation of the DNA/Cellfectin mixture, the medium was removed from the cells and washed with 2mL of non-supplemented Grace medium; discarding the washing medium;

5) Adding 0.8mL of non-supplemented Grace medium to each tube containing the mixture, mixing well, and adding the mixture to the wells containing cells;

6) Culturing at 27 ℃ for 5 hours; discarding the DNA/Cellfectin mixture, adding 2mL of whole culture medium to the cells;

7) Incubating at 27 ℃ for 72 hours or until cytopathic effect is observed;

8) Virus-containing cells were collected from each well and transferred to a 15mL centrifuge tube.

The application of the recombinant baculovirus for co-expressing the porcine interferon L3 and the porcine interleukin 22 is applied to resisting porcine intestinal coronavirus infection.

After the technology provided by the invention is adopted, the coexpression pig interferon L3 and pig interleukin 22 recombinant baculovirus and the application thereof according to the embodiment of the invention have the following beneficial effects: the invention successfully constructs a baculovirus expression system for rPoIFN-L3 and rPoIL-22 co-expression, and can secrete and express the rPoIFN-L3 and rPoIL-22 proteins with biological activity; the invention lays a foundation for further realizing the industrialized preparation for resisting the porcine enterocoronavirus infection.

Drawings

FIG. 1 shows the PCR results of recombinant bacmid;

wherein 1: rBacmid;2: rBac-rPoIFN-L3-rPoIL-22;3: blank control

FIG. 2 shows indirect immunofluorescence detection of rPoIFN-L3 and rPoIL-22 protein expression;

FIG. 3 shows the expression sites of Westernblot detection rPoIFN-L3 or rPoIL-22;

FIG. 4 shows SDS-PAGE (a) and Westernblot (b) results of purified products;

Wherein 1: purifying the sample by rPoIFN-L3 protein; 2: rPoIL-22 protein purification samples

FIG. 5 shows the detection of antiviral activity of rPoIFN-L3 protein;

FIG. 6 is a diagram showing that rPoIFN-L3/rPoIL-22 regulates expression of a related gene in IPEC-J2 cells;

FIG. 7 shows that rPoIFN-L3/rPoIL-22 inhibits TGEV, PEDV or PDCoV infection;

FIG. 8 shows that rPoIFN-L3 and rPoIL-22 synergistically inhibit TGEV, PEDV or PDCoV infections.

Detailed Description

Various preferred embodiments of the present invention will be described below with reference to the accompanying drawings. The following description is provided with reference to the accompanying drawings to assist in the understanding of the exemplary embodiments of the invention as defined by the claims and their equivalents. It includes various specific details that aid in understanding, but they are to be considered exemplary only. Accordingly, those skilled in the art will recognize that various changes and modifications may be made to the embodiments described herein without departing from the scope and spirit of the invention. Moreover, a detailed description of functions and configurations well known in the art will be omitted for the sake of clarity and conciseness of the present specification.

1 Construction of baculovirus expression vectors

The rPoIFN-L3 and rPoIL-22 are subjected to gene optimization synthesis, wherein the rPoIFN-L3 contains an FC tag and the rPoIL-22 contains a His tag. The following primers are designed according to the sequence of the synthesized gene and the enzyme cutting site of the vector, and the full length of rPoIFN-L3 and rPoIL-22 genes are amplified:

rPoIFN-L3-EcoRⅠ-F：5'CGGAATTCATGCGTGTGCTGGTC3'

rPoIFN-L3-HindⅢ-R：5'CCCAAGCTTTTACTTGCCTTGGGTCTTG3'

rPoIL-22-XhoⅠ-F：5'CCGCTCGAGATGCGTGTGCTGGTG3'

rPoIL-22-SphⅠ-R：5'ACATGCATGCTTAGTGGTGGTGATGGTGG3'

The PCR reaction system is as follows: 30.5. Mu.l of sterilized water, 10. Mu.l of reaction buffer (5X), 4. Mu.l of dNTP (2.5 mmol.L ^-1), 0.5. Mu.l of PRIMESTAR enzyme, 2. Mu.l of each of the upstream and downstream primers (10. Mu. Mol.L-1, heavy chain and light chain) and 1. Mu.l of template. The PCR reaction conditions of rPoIFN-L3 are as follows: the PCR procedure was: 95 ℃ for 5min,98 ℃ for 10s, 60 ℃ for 5s, 72 ℃ for 60s,35 cycles; the amplified PCR product was subjected to 1% agarose gel electrophoresis at 72℃for 5min to determine whether DNA was present. The PCR reaction conditions of rPoIL-22 are as follows: the PCR procedure was: 2min at 95 ℃,30 s at 94 ℃, 90s at 68 ℃ and 35 cycles; the amplified PCR product was subjected to 1% agarose gel electrophoresis at 72℃for 5min to determine whether DNA was present.

And (3) performing gel cutting purification on the obtained PCR product, wherein the specific steps are as follows:

1) Gel sheets containing DNA fragments were cut with a clean scalpel, as close as possible to DNA to reduce gel volume.

The gel was placed in a pre-weighed 1.5mL EP tube and weighed and the gel weight recorded.

2) 1 Volume of Binding Buffer was added to the gel slice.

3) The gel mixture was incubated at 58℃for about 10min until the gel pieces were completely dissolved. The mixing tube was inverted every 2min during this period to promote thawing.

4) The dissolved gel solution was transferred to a Gene JET purification column, centrifuged at 12000r/min for 1min, the liquid in the collection tube was discarded, and the purification column was placed in the recovery header again.

5) 700 Μ LWash Buffer was added to a purification column (diluted with ethanol), centrifuged at 12000r/min for 1min, the liquid in the collection tube was discarded, and the purification column was placed in the recovery header again.

6) The empty Gene JET purification column 12000r/min was centrifuged for 1min.

7) The purification column was transferred to a fresh 1.5mL EP tube, 20. Mu.L of 65℃sterilized water was added to the column, and the column was allowed to stand for 1min and centrifuged at 12000r/min for 1min. The concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

The pFastBacdual vector was cut with EcoRI and HindIII, and the system was as follows: reaction buffer (10×) 2 μl, ecoRI, hindIII enzymes 1 μl each, sterilized water 6 μl, pFastBacdual vector 10 μl. The enzyme digestion procedure is as follows: and 4h at 37 ℃ and 20min at 80 ℃ to carry out gel cutting purification on the obtained enzyme cutting product, wherein the steps are the same as the above.

The cut gel purified rPoIFN-L3 was digested with EcoRI and HindIII, and the digested product was subjected to PCR purification because the cut fragments were smaller. The PCR purification steps were as follows:

1) The cleavage product was transferred to a clean EP tube.

2) Adding 3 times of Binding Solution into the enzyme cutting product, and shaking and mixing uniformly.

3) Placing Spin Column into collecting tube, transferring the mixture obtained in step (2) into Spin Column to 12000

Centrifuging at r/min for 1min, discarding the liquid in the collecting pipe, and putting the Spin Column into the recovery header again.

4) Adding 700 mu LWash Solution to the Column, standing for 1min, centrifuging for 1min at 12000r/min, discarding the liquid in the collection tube, and putting Spin Column into the recovery header again. This procedure was repeated once.

5) Spin Column was transferred to a fresh EP tube by centrifugation at 12000r/min for 5min, 30. Mu.L of 65℃sterilized water was added to Spin Column, and the mixture was allowed to stand for 1min and centrifuged at 12000r/min for 1min. The concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

The digested pFastBacdual was ligated with rPoIFN-L3 using T4 ligase. The connection system is as follows: reaction buffer (10X) 1. Mu.L, T4 ligase 1. Mu.L, rPoIFN-L3 fragment 6.5. Mu.L, pFastBacdual vector 1.5. Mu.L. The connection procedure is as follows: the ligation product was transformed at 25℃for 2h and 65℃for 15 min. The conversion steps are as follows:

1) 10. Mu.L of the ligation product was added to 100. Mu.LDH 5. Alpha. Competence in an ice bath for 30min, heat-shocked at 42℃for 1min, and then left on ice for 3min.

2) 800. Mu.L of antibiotic-free LB was added thereto, and the mixture was put into a shaking table and shaken at 37℃for 50min at 220 r/min.

3) Centrifuge at 800r/min for 5min, discard the supernatant and apply the whole remainder to ampicillin-resistant solid LB plate. At 37 DEG C

The incubator was left for 15h.

After the plates were removed from the 37℃incubator, larger, round individual colonies were picked in 4mL of ampicillin-resistant liquid LB and placed in a shaker at 37℃at 220r/min for 13h. Then, plasmid extraction was performed as follows:

1) The bacterial liquid is poured into a 2mLEP tube, centrifuged for 1min at 12000r/min, and the supernatant is discarded.

2) The pellet was resuspended by taking 250 mu L S a into the pellet. (3) Taking 250 mu L S to a tube, turning over for 4-6 times, and uniformly mixing for no more than 5min.

3) Taking 350 mu L S to a tube, turning over the tube up and down for 6 to 8 times, and centrifuging the tube for 10 minutes at 12000 r/min.

4) The supernatant was removed and placed on a column, the column was placed in a 2mL collection tube and centrifuged at 12000r/min for 1min. The liquid in the collection tube is discarded and the column is returned to the recovery header.

5) 500 Mu LWash of the mixture was applied to a column and centrifuged at 12000r/min for 1min. The liquid in the collection tube is discarded and the column is returned to the recovery header.

6) 700 Mu LWash of the mixture was applied to a column and centrifuged at 12000r/min for 1min. The liquid in the collection tube is discarded and the column is returned to the recovery header. This procedure was repeated once. The collection tube was replaced with a 1.5mLEP tube.

7) 50. Mu.L of 65℃endotoxin-free water was taken into the column, allowed to stand for 1min, and centrifuged at 12000r/min for 1min. The concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃. And (3) carrying out double enzyme digestion verification on the obtained plasmid, wherein the specific operation is the same as that described above. The correct pFastBacdual-rPoIFN-L3 plasmid was transferred to Jilin provincial treasury Mei Biotechnology Co.Ltd for sequencing.

The correctly sequenced pFastBacdual-rPoIFN-L3 plasmid was double digested with XhoI, sphI. The enzyme digestion system is as follows: reaction buffer (10X) 5. Mu.L, xhoI, sphI enzyme 1.5. Mu.L each, sterilized water 32. Mu.L, pFastBacdual-rPoIFN-L3 plasmid 10. Mu.L. The enzyme digestion procedure is carried out at 37 ℃ for 12h and 65 ℃ for 20min the enzyme cutting product is subjected to gel cutting purification, the steps are the same as above.

RPoIL-22 obtained by gel cutting purification was subjected to double digestion with XhoI, sph I. The enzyme digestion system is as follows: reaction buffer (10X) 5. Mu.L, xhoI, sphI enzyme 1.5. Mu.L each, rPoIL-22 gel recovered 42. Mu.L of product. The digestion procedure was 37℃for 12h and the obtained digestion product was subjected to PCR purification at 65℃for 20min, as described above. The digested pFastBacdual-rPoIFN-L3 was T4 ligated with rPoIL-22.

The connection system is as follows: reaction buffer (10X) 2. Mu.L, T4 ligase 1. Mu.L, rPoIL-22 fragment 3. Mu.L, pFastBacdual-rPoIFN-L3 vector 6. Mu.L. The connection procedure is as follows: the ligation product was converted at 16℃for 12h and 65℃for 15 min. The transformation procedure was as above.

Then, after the plate was taken out of the 37℃incubator, a larger, round single colony was picked in 4mL of ampicillin-resistant liquid LB, placed in a shaking table, and shaken at 37℃for 13 hours at 220 r/min. Then extracting the plasmid, and carrying out double enzyme digestion verification on the obtained plasmid in the plasmid extraction step, wherein the specific operation is the same as that described above. The correct pFastBacdual-rPoIFN-L3-rPoIL-22 plasmid was subjected to restriction enzyme digestion and sent to Jilin provincial treasury Mei Biotechnology Co.Ltd for sequencing.

To this end, the optimally synthesized genes encoding rPoIFN-L3 and rPoIL-22 mature proteins were successfully inserted into the donor plasmid pFastBacDual, under the control of the PH and P10 promoters, respectively.

Construction and identification of recombinant baculoviruses

PFastBacdual-rPoIFN-L3-rPoIL-22 was transformed into competent DH10Bac and subjected to 3 blue-white screening. The method comprises the following specific steps:

1) Taking 5 mu L of plasmid to DH10Bac competence, mixing uniformly, carrying out ice bath for 30min, carrying out heat shock for 30s at 42 ℃, and placing on ice for 3min.

2) 800. Mu.L of antibiotic-free LB was added thereto, and the mixture was put into a shaking table at 37℃for 4 hours at 220 r/min.

3) Transformants were diluted 1:10, 1:100, 1:1000 respectively with antibiotic-free LB, 100. Mu.L each was applied to a solid LB plate prepared in advance for screening for bluish white spots, and protected from light at 37℃for 24 hours.

4) Each plate was streaked with several white colonies (large, isolated) on a solid LB plate from a new blue-white screen, and subjected to round 2 of blue-white screening, after 3 rounds of screening, white colonies were selected to contain Kan,

In liquid LB of Gen, tet, 220r/min at 37℃was shaken for 24h.

Then extracting the stalk grains, which comprises the following specific steps:

1) Under aseptic condition, pouring the bacterial liquid into a 2mLEP tube, centrifuging for 1min at 12000r/min, and discarding the supernatant.

2) The pellet was resuspended by taking 250 mu L S a into the pellet.

3) Taking 250 mu L S to a tube, turning over up and down for 4-6 times, and uniformly mixing for no more than 5min.

4) Taking 350 mu L S to a tube, turning over the tube up and down for 6 to 8 times, and centrifuging the tube at 13000r/min and 4 ℃ for 15min.

5) Sucking the supernatant to another EP tube, adding equal volume of isopropanol, mixing, standing at 4deg.C for 30min,12000

Centrifuging at r/min 4 ℃ for 15min.

6) The supernatant was carefully discarded, 500. Mu.L of 70% absolute ethanol was added, the mixture was turned upside down, and the precipitate was washed and centrifuged at 12000r/min for 5min.

7) The ethanol was discarded, dried for 10min, and dissolved in 80. Mu.L endotoxin-free water at 65 ℃. The concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

Preparation of LB solid plates for blue-white screening: ampicillin (AMPICILLIN): 100mg of ampicillin was dissolved in 1mL of ddH2O, filtered for use, stored at-20℃and finally used at 1:1000 (v/v). Kananamycin (KANAMYCIN): 50mg of the calicheamicin was dissolved in 1mLddH O, filtered through a 0.22 μm filter and used at 1:1000 (v/v) and stored at-20 ℃. Gentamicin (GENTAMICIN): 7mg of gentamicin was dissolved in 1mLddH O, filtered through a 0.22 μm filter and used at 1:1000 (v/v) at-20 ℃. Tetracycline (TETRACYCLINE): 10mg of tetracycline was dissolved in 1mL of absolute ethanol and used at 1:1000 (v/v) and stored at-20 ℃. Galactoside (X-gal): 100mg of galactoside was dissolved in 1mL of DMSO and used at 1:1000 (v/v) and stored at-20 ℃. Isopropyl thiogalactoside (IPTG): 40mg of IPTG was dissolved in 1mL of ddH2O, filtered through a 0.22 μm filter, and used at 1:1000 (v/v) and stored at-20 ℃. After the preparation of LB solid plates for screening blue and white spots is completed, the solid plates are stored at 4 ℃ in a dark place.

The recombinant bac-rPoIFN-L3-rPoIL-22 was identified by PCR: PCR identification of recombinant bacmid was performed using M13 upstream and downstream primers according to Bac-to-Bac baculovirus expression system instructions.

M13 Forward：5′GTTTTCCCAGTCACGAC3′

M13 Reverse：5′CAGGAAACAGCTATGAC3′

PCR reaction system: ex Taq enzyme 12.5. Mu.L, M13 upstream and downstream primers 0.25. Mu.L, sterile water 10. Mu.L, plasmid dilution followed by 1. Mu.L (no more than 10 ng). PCR reaction conditions: 94℃for 4min,94℃for 30s, 55℃for 30s,72℃for 5min,35 cycles; the PCR product obtained was amplified at 72℃for 7min and subjected to 1% agarose gel electrophoresis to determine whether the DNA size was as expected.

Expression of 3rPoIFN-L3 and rPoIL-22

Insect cells were first transfected and SF21 cells were cultured in Grace's medium containing 10% fetal bovine serum. 9X 10 ⁵ Sf21 cells were seeded per well in 6 well plates and contacted at 27℃for 2h. For each transfected sample, a pellet DNA, cellfectin reagent was prepared and mixed in a 1.5mL sterile tube. The specific operation is as follows:

1) 2ug of purified bacmid DNA was diluted into 100. Mu.L of non-supplemented Grace medium.

2) Completely mixing the Cellfectin reagent, and turning over and mixing for 5-10 times. Mu. L CELLFECTIN reagent was aspirated and diluted into 100. Mu.L of non-supplemented Grace medium.

3) Diluted bacmid DNA (total volume about 210 ul) was ligated using diluted Cellfectin reagent. Mixing gently, and incubating at room temperature for 30min.

4) During the incubation of the DNA/Cellfectin mixture, the medium was removed from the cells and washed with 2mL of non-supplemented Grace medium. The wash medium was discarded.

5) To each tube containing the mixture was added 0.8mL of non-supplemented Grace medium, mixed well and the mixture was added to the wells containing the cells.

6) Culturing at 27 ℃ for 5 hours. The DNA/Cellfectin mixture was discarded and 2mL of whole medium was added to the cells.

7) Humid conditions at 27 ℃ were incubated for 72h or until cytopathic effect was observed.

Centrifugation at 500r/min for 5min removed cells and large debris. After the supernatant was filtered using a 0.45um filter, the supernatant was transferred to a new 15mL centrifuge tube and stored at 4℃in the absence of light. This is the P1 generation strain. P1-generation virus was inoculated into cells at a density of 2×10 ⁶ at moi=0.05. The supernatant was collected 72 hours and obtained by specific procedures such as (9) generation P1 virus. Thus, the P2 generation virus is obtained. And inoculating the P2 generation virus into insect cells to obtain the P3 generation virus. The seed toxicity titers were determined by plaque assay.

The P3-generation virus was inoculated into cells having a cell density of 2X 10 ⁶ at MOI=5, the supernatant was collected for 96 hours, and centrifuged at 1000r/min at 4℃for 10 minutes to remove the cells and large debris. After the supernatant was filtered using a 0.45um filter, the supernatant was transferred to a new centrifuge tube. Thus, a supernatant containing rPoIFN-L3 and rPoIL-22 was obtained.

4 Indirect immunofluorescence and Western blot detection of rPoIFN-L3 and rPoIL-22 expression

The indirect immunofluorescence is specifically operated as follows: identifying the SF21 insect cells in the logarithmic growth phase transfected by the correct recombinant rod particles, culturing for 72 hours at 27 ℃, fixing 30min,0.05%Triton X-100 by 4% paraformaldehyde for 15min when the morphology is diseased, blocking for 2 hours at 37 ℃ by 5% skim milk, taking a 1:500 diluted murine anti-His tag antibody as a primary antibody, and carrying out 1: after 500-fold dilution of Alexa Fluor 546 coat anti-mouse IgG antibody and 1:800-fold dilution of goat anti-pig IgG (abcom) as secondary antibodies, DAPI staining was performed for 10min, fluorescence was observed with an inverted fluorescence microscope.

The Western blot is specifically operated as follows: collecting 96h virus infection supernatant, centrifuging at 1000r/min for 10min, adding 5 XSDS Buffer for boiling, performing SDS-PAGE electrophoresis, and wet transferring to nitrocellulose membrane. The detection of Westernblot is carried out by taking goat anti-pig IgG diluted 1:5000 times and mouse anti-His tag diluted 1:2000 times as primary antibodies, and IRDye800 marked anti-goat IgG antibody and anti-mouse IgG antibody diluted 1:10000 times as secondary antibodies, and imaging is carried out by a near infrared fluorescence scanning imaging system. Purification of 5rPoIFN-L3/rPoIL-22

Collecting 96h infected virus supernatant, centrifuging at 1000r/min for 10min, filtering with 0.45 μm filter membrane to remove impurities, and purifying sequentially with protein A affinity chromatography column and cobalt affinity chromatography column. The purified protein samples were then subjected to SDS-PAGE electrophoresis and wet transferred to nitrocellulose membranes. Western blot detection is carried out by taking goat anti-pig IgG diluted 1:5000 times and mouse anti-His tag diluted 1:2000 times as primary antibodies, and IRDye800 marked anti-goat IgG antibody and anti-mouse IgG antibody diluted 1:10000 times as secondary antibodies, and imaging is carried out by using a near infrared fluorescence scanning imaging system.

6RPoIFN-L3 antiviral Activity assay

1) Plating an appropriate amount of MDBK cells into 96-well cell culture plates;

2) Diluting the sample to be detected by multiple ratio from 10 < -1 > -10 < -8 >;

3) 100 μl of diluted samples per well was added to a 96-well plate, 3 replicate wells per dilution, untreated groups were set as controls;

4) After 24h incubation at 37 ℃, the supernatant was discarded, VSV GFP virus was inoculated, and the untreated group was similarly inoculated with virus as a virus control group;

5) When the Cytopathy (CPE) of the virus control group was about 100%, the expression of GFP fluorescent protein was observed by an inverted fluorescent microscope.

7RPoIFN-L3/rPoIL-22 activity and detection of anti-porcine enterocoronavirus activity

IPEC-J2 cells were seeded into 24-well plates for 1 day to generate fused monolayers. IPEC-J2 cells were treated with rPoIFN-L3 or rPoIL-22 at final concentrations of 10ng/mL, 100ng/mL, 1000ng/mL, and F12 DMEM as negative control. After 24h of culture, cells were harvested for detection of related gene expression.

Similarly, after treatment for 24 hours with rPoIFN-L3 or rPoIL-22 at a final concentration of 10ng/mL, 100ng/mL, 1000ng/mL, TGEV, PEDV or PDCoV virus with MOI=1 was inoculated, virus solution was removed after adsorption at 37℃for 2 hours, washed 3 times, and after F12 DMEM was added for 48 hours at 37℃the cells and supernatant were harvested to detect virus infection.

Detection of synergistic antiviral effects of 8rPoIFN-L3 and rPoIL-22 in vitro

IPEC-J2 cells were seeded into 24-well plates and grown to confluent monolayers. Cells were treated with rPoIFN-L3, rPoIL-22 and mixed rPoIFN-L3 and rPoIL-22, respectively, for 24 hours, inoculated with TGEV, PEDV or PDCoV virus having MOI=1, adsorbed at 37℃for 2 hours, then virus solution was removed, washed 3 times, added with F12 DMEM, and cultured at 37℃for 48 hours, and then the cells were harvested to detect virus infection. Wherein the rPoIFN-L3 and rPoIL-22 concentrations used alone were 100ng/mL and the mixed rPoIFN-L3 and rPoIL-22 concentrations were 50ng/mL, respectively.

In the embodiment of the invention, the baculovirus transfer vector is presented by Liu Changming teacher laboratory; insect cells SF21 were kept by the inventor laboratory; coli (e.coli) DH10Bac competent cells, grace's insect cell medium, fetal Bovine Serum (FBS) from race-fish technologies; coli (e.coli) DH 5a competent cells were purchased from TaKaRa company; Sf9 insect cell serum-free medium ii was purchased from Shanghai source culture biotechnology Co. The gene optimized synthesis of rPoIFN-L3 and rPoIL-22 was performed by Souzhou Jin Weizhi Biotechnology Co.

The results of the above construction method are analyzed as follows.

1 PCR analysis of recombinant bacmid

To identify whether pFastBacdual-rPoIFN-L3-rPoIL-22 was transposed successfully. The present study uses M13 upstream and downstream primers to perform PCR amplification of recombinant bacmid DNA, and can judge whether the PCR amplification is successful or not through the size of the product band. The pINL-L3 gene sequence is 1311bp, and the pIL-22 is 549bp. The result shows that the PCR band size of pFastBacdual-rPoIFN-L3-rPoIL-22 transposition product rBac-rPoIFN-L3-rPoIL-22 is about 5000bp, and the PCR band size of pFastBacdual transposition product rBacmid is about 2500bp, as shown in FIG. 1. That is, pFastBacdual-rPoIFN-L3-rPoIL-22 was successfully transposed.

Expression of 2rPoIFN-L3/rPoIL-22 protein

After transfection of rBac-rPoIFN-L3-rPoIL-22 rod into SF21 insect cells, the study used antibodies of different fluorescent signals for the purpose of verifying whether rPoIFN-L3 or rPoIL-22 protein was expressed, and was tested using an indirect immunofluorescence method. The results showed that rPoIFN-L3 exhibited a green fluorescent signal by detection with goat anti-porcine IgG H & L (FITC) antibody, while rPoIL-22 exhibited a red fluorescent signal by detection with mouse anti-His tag antibody-fluorescent gene 546 goat anti-murine IgG antibody, and that the 2 fluorescent signals were almost completely coincident, as shown in FIG. 2. To further explore the expression sites of rPoIFN-L3 and rPoIL-22 proteins, equal amounts of cell supernatants, cell lysates, and cell pellets were detected by the Westernblot method, wherein rPoIFN-L3 was detected by goat anti-pig IgG-Dylight 700-labeled anti-goat IgG antibody, and rPoIL-22 was detected by mouse anti-His monoclonal antibody-Dylight 700-labeled anti-mouse IgG antibody. The results showed that proteins were mainly present in the supernatant, with little content in cell lysates or cell pellets, as shown in fig. 3. The above results indicate that rBac-pIFN-L3-pIL-22 bacmid was successfully expressed after transfection into insect cells and the expressed proteins were mainly present in the supernatant.

Purification and identification of 3rPoIFN-L3/rPoIL-22 protein

And (3) centrifugally concentrating rPoIFN-L3 or rPoIL-22 protein through an ultrafiltration tube, and purifying through a ProteinA affinity chromatographic column and a cobalt affinity chromatographic column in sequence. To identify the effect of protein purification, the study was examined using SDS-PAGE. The results are shown in FIG. 4a, which shows that neither rPoIFN-L3 (48 Ku) nor rPoIL-22 (20 Ku) protein bands are single. The rPoIFN-L3 protein purified sample deduces that the 50 Ku-sized band is rPoIFN-L3 protein according to the protein size, and the lower band may be an shed Fc tag or a partial protein of rPoIFN-L3 formed due to degradation and the like. The number of bands of rPoIL-22 protein purified samples were all presumed to be rPoIL-22 proteins, which were formed because of the slight differences in protein size due to differences in protein glycosylation during protein expression. The study was further validated by Western blot using Fc-or His-tag specific antibodies. The results are shown in FIG. 4b, which shows that all 2 bands of rPoIFN-L3 protein purified samples can be recognized by Fc tag specific antibodies, while all of the several bands of rPoIL-22 protein purified samples can be recognized by His tag specific antibodies, which is in line with expectations. The results prove that rPoIFN-L3 or rPoIL-22 protein has better purification effect and no impurity.

Antiviral Activity assay for 4rPoIFN-L3

To investigate whether baculovirus expressed rPoIFN-L3 has antiviral activity and units of antiviral activity, the present study used VSV-GFP virus to examine the antiviral activity of rPoIFN-L3. The results are shown in FIG. 5, which shows that rPoIFN-L3 is antiviral, and the antiviral activity unit of the purified rPoIFN-L3 is calculated to be 5X 105AU/mg. Whereas the antiviral activity unit of the rPoIFN-L3-containing supernatant was 1X 103AU/mL. For uniform quantification in subsequent studies, the study used no antiviral activity units, but protein concentration units.

Analysis of 5rPoIFN-L3 or rPoIL-22 protein Activity

To investigate whether baculovirus expressed rPoIFN-L3 or rPoIL-22 had biological activity, the expression of the relevant genes in cells was examined after treatment of IPEC-J2 cells with a concentration of rPoIFN-L3 or rPoIL-22 for 24 h. The results showed that rPoIFN-L3 could induce the expression of interferon-stimulated gene 15 (ISG 15) (FIG. 6 a), mucosal virus resistance gene A (MXA) (FIG. 6 b), interferon-induced transmembrane protein 1 (IFITM 1) (FIG. 6 c) or 3 (IFITM 3) (FIG. 6 d), 2'-5' -oligoadenylate synthetase-like protein (OASL) (FIG. 6 e) in a dose-dependent manner. After rPoIFN-L3 treatment of cells at a concentration of 1000ng/mL, ISG15, MXA, IFITM1, IFITM3 or OASL expression was up-regulated by about 150-fold, 1500-fold, 160-fold, 40-fold or 2000-fold, respectively (FIGS. 6 a-e). That is, rPoIFN-L3 can successfully stimulate the transcription of an interferon-stimulated gene (ISG) in IPEC-J2 cells to promote the cells to be in an antiviral state. Similarly rPoIL-22 can be dose-dependent up-regulating the expression of avidin beta defensin 2 (BD-2) in IPEC-J2 cells, 1000ng/mL rPoIL-22 up-regulates BD-2 expression by about 8-fold, 100ng/mL rPoIL-22 up-regulates BD-2 expression by about 5-fold, and 10ng/mL rPoIL-22 up-regulates BD-2 expression by about 4-fold (FIG. 6 f). The results prove that rPoIFN-L3 and rPoIL-22 respectively have good biological activity.

Inhibition of infection by porcine enterocoronavirus by 6rPoIFN-L3 or rPoIL-22

Previous work in this laboratory has shown that prokaryotic expression of either IFN-L or IL-22 inhibits infection by enterocoronaviruses. To examine whether baculovirus expressed rPoIFN-L3 or rPoIL-22 could inhibit viral infection, IPEC-J2 cells were pretreated with a concentration of rPoIFN-L3 or rPoIL-22 for 24h, then inoculated with TGEV, PEDV or PDCoV, respectively, at MOI=1, and after 48h of incubation the cells were collected and examined by relative fluorescent quantitative PCR method. The results are shown in FIGS. 7c and 7a, which show that rPoIFN-L3 and rPoIL-22, respectively, can be dose dependent in inhibiting TGEV, PEDV or PDCoV infection. To ensure reliability of the results, the study also examined the TCID50 of the supernatant, as shown in FIGS. 7d and 7b, consistent with the results of the relative fluorescence quantitative PCR method. It was shown that rPoIFN-L3 at concentrations of 1000ng/mL and 100ng/mL reduced TGEV infection by more than 70%, PEDV infection by more than 80%, PDCoV infection by more than 90% (FIG. 7 d). rPoIL-22 reduced TGEV or PEDV infection by about 80% and PDCoV infection by about 85% at concentrations of 1000ng/mL and 100ng/mL (FIG. 7 b). The above results indicate that baculovirus expressed rPoIFN-L3 or rPoIL-22 was effective in inhibiting TGEV/PEDV/PDCoV infection in IPEC-J2 cells.

7RPoIFN-L3 and rPoIL-22 synergistically inhibit infection of porcine enterocoronavirus

To investigate whether baculovirus expressed rPoIFN-L3 and rPoIL-22 could synergistically inhibit porcine enterocoronavirus infection. After pretreatment of IPEC-J2 cells with rPoIFN-L3 and rPoIL-22 for 24h, the cells were pooled and examined by the relative fluorescent quantitative PCR method by inoculating TGEV, PEDV or PDCoV at MOI=1 and culturing for 48 h. The results show that rPoIFN-L3 and rPoIL-22 have better synergy at 50ng/mL concentration. Treatment of cells with rPoIFN-L3 or rPoIL-22 at a concentration of 100ng/mL alone inhibited TGEV infection by 2.2-fold or 1.4-fold, PEDV infection by 178-fold or 12-fold, and PDCoV infection by 20.5-fold or 4.8-fold compared to the virus control group. Whereas 50ng/mL rPoIFN-L3 and 50ng/mL rPoIL-22 co-treated cells inhibited TGEV infection by 4.5-fold, PEDV infection by 334-fold, PDCoV infection by 24.3-fold, i.e., 75%,99.6% or 95% or so of TGEV, PEDV or PDCoV infection (FIG. 8). The above results indicate that the anti-TGEV/PEDV effect after co-treatment of cells with rPoIFN-L3 and rPoIL-22 at a concentration of 50ng/mL is superior to that of 100ng/mL rPoIFN-L3 or rPoIL-22 alone. I.e., 50ng/mL rPoIFN-L3 and rPoIL-22 have a synergistic effect in anti-TGEV/PEDV infection in vitro, whereas rPoIFN-L3 and rPoIL-22 at this concentration show a additive effect in anti-PDCoV infection in vitro.

The foregoing has outlined rather broadly the more detailed description of the invention in order that the detailed description of the principles and embodiments of the invention may be implemented in conjunction with the detailed description of the invention that follows, the examples being merely intended to facilitate an understanding of the method of the invention and its core concepts; meanwhile, as those skilled in the art will have variations in the specific embodiments and application scope in accordance with the ideas of the present invention, the present description should not be construed as limiting the present invention in view of the above.

From the description of the embodiments above, it will be apparent to those skilled in the art that the invention may be practiced. Of course, the above listed cases are only examples, and the present invention is not limited thereto. Those skilled in the art will appreciate that other variations or simplifications of the inventive solution may be suitably employed in the present invention and are intended to be included within the scope of the present invention.

Claims

1. The recombinant baculovirus for coexpression of the porcine interferon L3 and the porcine interleukin 22 is characterized by being obtained by constructing the following steps:

(1) Construction of baculovirus expression vectors

(2) Construction of recombinant baculoviruses

PFastBacdual-rPoIFN-L3-rPoIL-22 was transformed into competent DH10Bac, and subjected to 3 times of blue-white screening, followed by extraction of the rod particles.

2. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (1), the obtained PCR product is subjected to gel cutting and purification, and the specific steps are as follows:

cutting gel sheets containing DNA fragments with a clean scalpel, placing the gel into pre-weighed EP tubes and weighing, and recording the gel weight;

adding 1 volume of Binding Buffer into the gel slice;

Incubating the gel mixture at 58 ℃ for about 10min until the gel sheet is completely dissolved, inverting the mixing tube every 2 min times during which to promote thawing;

Transferring the dissolved gel solution to a Gene JET purification column, centrifuging for 1min at 12000r/min, discarding the liquid in a collecting pipe, and putting the purification column into a recovery header again;

adding Wash Buffer into a purification column, centrifuging at 12000r/min for 1min, discarding the liquid in the collecting pipe, and putting the purification column into a recovery collecting pipe again;

the empty Gene JET purification column 12000 r/min was centrifuged at 1 min;

Transferring the purified column into a new EP tube, adding 65 deg.C sterilized water into the column, standing for 1min, centrifuging at 12000r/min for 1min, measuring concentration with ultraviolet spectrophotometer, and storing to-20deg.C.

3. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (1), the enzyme digestion product is subjected to PCR purification steps as follows:

Transferring the enzyme-cleaved product to a clean EP tube;

adding Binding Solution with 3 times of volume into the enzyme digestion product, and oscillating and uniformly mixing;

Putting the Spin Column into a collecting pipe, transferring the mixed solution in the step 2) into the Spin Column, centrifuging at 12000 r/min for 1: 1 min, discarding the liquid in the collecting pipe, and putting the Spin Column into a recovery collecting pipe again;

Adding Wash Solution into the Column, standing for 1 min, centrifuging for 1 min at 12000 r/min, discarding the liquid in the collecting pipe, and placing Spin Column into the recovery collecting pipe again; repeating this step once;

Centrifuging at 12000 r/min for 5 min, transferring Spin Column into new EP tube, adding 65 deg.C sterilized water to Spin Column, standing for 1min, and centrifuging at 12000 r/min for 1min; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

4. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (1), the enzyme-cleaved pFastBacdual is linked with rPoIFN-L3 by using T4 ligase, and the linking procedure is as follows: the ligation product was transformed at 25℃for 2 h at 65℃for 15 min, the transformation procedure being as follows:

10. Mu.L of the ligation product was added to 100. Mu.L of DH 5. Alpha. Competence, ice-bath for 30 min, heat-shock 1min at 42℃and then placed on ice for 3: 3 min;

800 mu L of antibiotic-free LB is added into the mixture, and the mixture is put into a shaking table for shaking at the temperature of 37 ℃ for 50 min at 220 r/min;

800 Centrifuge 5 min r/min, discard the supernatant and apply the whole to ampicillin-resistant solid LB plate and place 15: 15 h in a 37℃incubator.

5. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (1), the plasmid is extracted as follows:

Pouring the bacterial liquid into a2 mL EP tube, centrifuging for 1min at 12000 r/min, and discarding the supernatant;

Taking 250 mu L S to precipitate, and re-suspending the precipitate; taking 250 mu L S to a tube, turning over the tube for 4 to 6 times, and uniformly mixing for no more than 5 min;

taking 350 mu L S to a tube, turning over the tube up and down for 6-8 times, and centrifuging the tube at 12000 r/min for 10 min;

Taking out the supernatant, placing the supernatant on a column, placing the column in a 2mL collecting pipe, and centrifuging for 1min at 12000 r/min; discarding the liquid in the collection tube, and putting the column in the recovery header again;

Adding 500 μL Wash 1 onto the column, and centrifuging at 12000r/min for 1min; discarding the liquid in the collection tube, and putting the column in the recovery header again;

700. Mu.L Wash 2 was applied to the column and centrifuged at 12000 r/min for 1: 1 min; discarding the liquid in the collection tube, and putting the column in the recovery header again; repeating this step once; exchanging the collection tube for a 1.5 mL EP tube;

adding 50 μl of 65deg.C endotoxin-free water into the column, standing for 1 min, and centrifuging at 12000 r/min for 1 min; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

6. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (2), pFastBacdual-rPoIFN-L3-rPoIL-22 is transformed into competent DH10Bac, and then subjected to 3 times of blue and white spot screening, the steps are as follows:

taking 5 mu L of plasmid to DH10Bac competence, uniformly mixing, ice-bathing for 30min, heat-shocking for 30 s at 42 ℃, and placing on ice for 3 min;

800 mu L of antibiotic-free LB is added into the mixture, and the mixture is put into a shaking table for shaking 4h at the temperature of 37 ℃ at 220 r/min;

Diluting the transformants with antibiotic-free LB according to the ratio of 1:10, 1:100 and 1:1000 respectively, and respectively taking 100 mu L of each transformant to be coated on a solid LB plate which is prepared in advance and used for screening blue white spots, wherein the solid LB plate is protected from light at 37 ℃ 24 h;

Several white colonies were picked on each plate, streaked on a solid LB plate from a new blue-white screen, subjected to round 2 of blue-white screen, and after 3 rounds of screening, white colonies were picked into a liquid LB containing Kan, gen, tet, and shaken for 24 h at 37℃220 r/min.

7. A recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in claim 1,

In the step (2), the extraction of the rod grains is performed as follows:

pouring the bacterial liquid into a 2mL EP tube under the aseptic condition, centrifuging at 12000 r/min for 1 min, and discarding the supernatant;

Taking 250 mu L S to precipitate, and re-suspending the precipitate;

taking 250 mu L S to a tube, turning over the tube up and down for 4-6 times, and uniformly mixing for less than 5min;

Taking 350 mu L S to a tube, turning over the tube up and down for 6-8 times, and centrifuging the tube at 13000 r/min and 4 ℃ for 15 min;

Sucking the supernatant to another EP tube, adding equal volume of isopropanol, mixing, standing at 4deg.C for 30min, centrifuging at 12000r/min at 4deg.C for 15 min;

Discarding the supernatant, adding 500 μl of 70% absolute ethanol, reversing upside down, washing the precipitate, and centrifuging at 12000 r/min for 5 min;

Discarding ethanol, drying to 10 min, and dissolving with 65deg.C 80 μl endotoxin-free water; the concentration was measured by ultraviolet spectrophotometer and stored at-20 ℃.

8. Use of a recombinant baculovirus co-expressing porcine interferon L3 and porcine interleukin 22 as defined in any one of claims 1 to 7 for the preparation of a formulation for combating porcine enterocoronavirus infection.