CN114736842A

CN114736842A - Method for detecting bioavailability of nutritive salt in water body by using promoter of synechococcus gene

Info

Publication number: CN114736842A
Application number: CN202210488031.0A
Authority: CN
Inventors: 姜海波; 刘浩; 王鑫威; 黄海龙; 韦嘉宁; 赵梦洁; 廖如兰; 殷克东
Original assignee: Ningbo University; Southern Marine Science and Engineering Guangdong Laboratory Zhuhai
Current assignee: Ningbo University; Southern Marine Science and Engineering Guangdong Laboratory Zhuhai
Priority date: 2022-05-06
Filing date: 2022-05-06
Publication date: 2022-07-12
Anticipated expiration: 2042-05-06
Also published as: CN114736842B

Abstract

The invention discloses a method for detecting bioavailability of nutritive salt in water by using a promoter of synechococcus gene. The invention realizes the fusion expression of the promoter of the gene which is sensitive to the nutrient salt deficiency in the synechococcus and the fluorescent protein by constructing the transgenic synechococcus containing the recombinant expression element consisting of the promoter sequence of the synechococcus gene which is sensitive to the nutrient salt deficiency in the water body and the fluorescent protein gene fragment, namely the expression of the downstream fluorescent reporter gene can be regulated and controlled by the promoter to obtain the fluorescent signal. When the nutrient salt in the water body is deficient, the expression of genes sensitive to the nutrient salt element deficiency and fluorescence reporter genes in synechococcus can be induced, and the bioavailability of the nutrient salt in the water body can be detected by measuring the fluorescence value. Compared with the existing method for detecting the concentration of the nutritive salt through the physicochemical characteristics of the nutritive salt elements, the method for detecting the bioavailability of the nutritive salt in the water body can reflect the bioavailability of the nutritive salt in the water body more truly.

Description

Method for detecting bioavailability of nutritive salt in water body by using promoter of synechococcus gene

Technical Field

The present invention belongs to the field of gene engineering technology. More particularly, relates to a method for detecting bioavailability of nutritive salt in water by using a promoter of a synechococcus gene.

Background

The nutritive salt is the material basis for the growth of phytoplankton, the content of the nutritive salt directly influences the primary productivity of the ocean, and the nutritive salt has very important significance on the ocean ecosystem. In the process of biogeochemical cycle, nutritive salt is closely related to biological activities, environmental factors and the like. In recent years, with the progress of research, the relationship between nutritive salt and ecological environment is increasingly emphasized.

The bioavailability of the nutritive salt in the water body is a key factor for controlling the biomass of phytoplankton, and has important significance for the research of water environment ecology. However, the existing research on the water body nutrient salt mainly focuses on the detection of the concentration of the nutrient salt, and neglects the bioavailability concentration of the water body nutrient salt. The existing nutrient salt concentration detection is realized by the way that the nutrient salt is in a substance form suitable for instrument detection through certain physicochemical reactions according to the physicochemical characteristics of nutrient salt elements, and the nutrient salt concentration is obtained through the calculation of technologies such as absorbance, mass spectrum or chromatogram and the like. Although the concentration of the nutritive salt has a certain reference value in the environmental aspect, from the biological point of view, the total content of a certain nutritive salt element in a specific environment cannot be fully utilized by phytoplankton, and the availability of the nutritive salt changes along with the change of external conditions, so the measured concentration of the nutritive salt cannot represent the bioavailability. Therefore, a method for detecting the bioavailability of the nutritive salt in the water body is needed.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a method for detecting the bioavailability of nutritive salt in water by using a promoter of a synechococcus gene.

The first purpose of the invention is to provide a transgenic synechococcus.

The second purpose of the invention is to provide the application of the transgenic synechococcus in detecting the bioavailability of the nutritive salt in the water body.

The third purpose of the invention is to provide a method for detecting the bioavailability of the nutritive salt in the water body by using the transgenic synechococcus.

The above purpose of the invention is realized by the following technical scheme:

synechococcus 7002 is a prokaryote that can produce organic matter by photosynthesis using inorganic nitrogen and phosphorus, is one of blue-green algae (also called cyanobacteria), and has a very strong adaptability to the environment. The invention realizes the fusion expression of the promoter of the gene sensitive to the nutrient salt element deficiency and the fluorescent protein in the synechococcus 7002 by constructing the transgenic synechococcus containing the recombinant expression element consisting of the promoter sequence of the synechococcus gene sensitive to the nutrient salt deficiency of the water body and the fluorescent protein gene fragment, namely the expression of the downstream fluorescent reporter gene can be regulated and controlled by the promoter to obtain the detectable fluorescent signal. When the nutrient salt in the water body is deficient, the expression of genes sensitive to the nutrient salt element deficiency and fluorescence reporter genes in the synechococcus can be induced, the concentration of the available nutrient salt elements in the environment can be indirectly reflected by measuring the fluorescence value, and the bioavailability of the phytoplankton in the sample water body which has a reference meaning can be more truly reflected.

The invention firstly provides a transgenic synechococcus which contains a recombinant expression element consisting of a promoter sequence of synechococcus gene sensitive to water body nutrient salt deficiency and a fluorescent protein gene fragment.

Specifically, the recombinant expression element is a recombinant expression vector containing a promoter sequence of synechococcus gene sensitive to water body nutrient salt deficiency and a fluorescent protein gene fragment.

Specifically, the expression vector is pAQE 19.

pAQE19 is constructed by inserting multiple cloning sites and antibiotic resistance genes into original genome plasmid pAQE1 in synechococcus 7002, has the characteristics of high homology with genome of synechococcus 7002 and long-term stable inheritance in algal cells, and is an excellent vector for exogenous gene expression in synechococcus 7002.

Specifically, the synechococcus gene sensitive to the lack of the nutritive salt in the water body is a synechococcus gene sensitive to the lack of nitrogen, phosphorus or iron elements.

In most of the oceanic sea ecosystems around the world, the elements that limit phytoplankton growth are mainly three elements, nitrogen (N), phosphorus (P) and iron (Fe). In fresh water ecosystems, eutrophication caused by water pollution is usually an excess of N, P elements. In order to detect the eutrophication condition in fresh water and the nutrient salt element restriction condition in the ocean, the invention selects the promoter of the gene sensitive to N, P and Fe in synechococcus 7002 to construct a recombinant expression vector, and obtains the corresponding transgenic synechococcus through transformation.

Specifically, the nitrogen deficiency-sensitive synechococcus is a1821 or D0010, the phosphorus deficiency-sensitive synechococcus is a2284 or a2352, and the iron deficiency-sensitive synechococcus is a1291 or G0079.

The nucleotide sequence of the above gene can be obtained by searching through a website (website: www.kegg.jp). Specifically, the nucleotide sequence of the A1821 gene can appear by inputting "SYNPCC 7002_ A1821" in the website search interface, and other genes can be searched by only changing the number of the following genes.

Specifically, the promoter sequence of the A1821 gene is shown as SEQ ID NO.1, and the promoter sequence of the D0010 gene is shown as SEQ ID NO. 2; the promoter sequence of the A2284 gene is shown as SEQ ID NO.3, and the promoter sequence of the A2352 gene is shown as SEQ ID NO. 4; the promoter sequence of the A1291 gene is shown as SEQ ID NO.5, and the promoter sequence of the G0079 gene is shown as SEQ ID NO. 6.

Specifically, the synechococcus of the invention is synechococcus 7002.

The invention also provides a method for detecting the bioavailability of the nutritive salt in the water body by using the transgenic synechococcus, which comprises the following steps:

s1, determining nutrient salt elements to be detected, preparing culture media containing the nutrient salt elements to be detected with different concentration gradients, placing transgenic synechococcus containing a recombinant expression element consisting of a promoter sequence of synechococcus gene which is sensitive to the deficiency of the nutrient salt elements to be detected and a fluorescent protein gene fragment in the culture media with different concentration gradients for culturing, determining a fluorescence value, and drawing a standard curve of the relation between the nutrient salt concentration and the fluorescence value;

s2, placing the transgenic synechococcus which is the same as the transgenic synechococcus in the step S1 into a water body sample to be detected, culturing the synechococcus under the same condition as the step S1, determining a fluorescence value, and calculating the concentration of nutrient salt elements corresponding to the standard curve in the water body sample to be detected by using the standard curve obtained in the step S1.

Because of the preference of phytoplankton for the absorption of nutrient salts, different forms of nutrient salts (such as the same nitrogen source, which can be divided into organic and inorganic, and more preferentially phytoplankton for the absorption of inorganic nitrogen) are available to phytoplankton differently, and the eutrophication effect of water bodies brought by different types of nitrogen sources with the same content is quite different. Specifically, the invention detects NO in the water body₃ ^－Equivalent N concentration, PO₄ ^3－Equivalent ofP concentration and Fe³⁺Equivalent Fe concentration.

Specifically, the culture temperature of the transgenic synechococcus is 28-30 ℃, and the illumination condition is 100 +/-10 mu E m^-2s^-1。

Specifically, the transgenic synechococcus was cultured with shaking at 110 rpm.

Specifically, before drawing a standard curve, the transgenic synechococcus is cultured in a corresponding nutrient-deficient culture medium and subjected to starvation treatment.

Specifically, the starvation treatment method comprises the following steps: eluting the transgenic synechococcus cultured to logarithmic phase with corresponding nutrient-deficient culture medium, and culturing in the corresponding nutrient-deficient culture medium under the condition of 100 +/-10 mu E m^-2s^-1Carrying out shaking culture at the temperature of 30 ℃ and the rpm of 110; and centrifuging to remove the supernatant after culturing for 24 hours, respectively washing twice with the corresponding nutrient-deficient culture medium (adding the culture medium for resuspension, centrifuging, discarding the supernatant), removing nutrient elements outside the algae cells, and inoculating into the corresponding nutrient-deficient culture medium again for culturing for 24 hours.

The invention has the following beneficial effects:

the method takes the synechococcus 7002 as a core reaction system, and indirectly reflects the concentration of the nutrient salt which is actually available for phytoplankton in the water body by inducing the gene expression sensitive to the deficiency of the nutrient salt (N, P and Fe) in the synechococcus 7002.

Drawings

FIG. 1 is a schematic diagram showing the construction of pAQE19-Luciferase recombinant vector.

FIG. 2 is a schematic diagram showing the construction of pAQE19-Luciferase recombinant expression vector containing a promoter sequence.

FIG. 3 shows the results of preliminary experiments on fluorescence values of different transgenic Synechococcus.

FIG. 4 is a standard curve generated using a transgenic Synechococcus NBU1042 sensitive to N deficiency.

Fig. 5 is a standard curve drawn by using a transgenic synechococcus NBU1046 sensitive to P deficiency, wherein 1, 2, 3, 4 and 5 marked on the left side of the graph correspond to the values of the abscissa, respectively, wherein 1: 0 indicates that the corresponding P concentration for this point is 0, 2: 0.37. mu.M represents a P concentration of 0.37. mu.M corresponding to this point, and so on.

FIG. 6 is a standard curve drawn by using transgenic synechococcus NBU1462 sensitive to Fe deficiency and transgenic synechococcus NBU1050, wherein a blue line is the standard curve drawn by using transgenic synechococcus NBU1462, and a yellow line is the standard curve drawn by using transgenic synechococcus NBU 1050; the

numbers

1, 2 and 3 marked on the left side in the figure correspond to the values on the abscissa, 1: 0.1 μ M represents the corresponding Fe concentration of 0.1 μ M, 2: 1 μ M represents the corresponding Fe concentration of 1 μ M, 3: 10 μ M represents the corresponding Fe concentration of 10 μ M.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available.

Example 1 screening of Gene sensitive to nutrient salt deficiency in Synechococcus 7002

In most of the global oceanic sea ecosystem, the elements that limit phytoplankton growth are mainly nitrogen (N), phosphorus (P) and iron (Fe). In fresh water ecosystems, eutrophication caused by water pollution is usually an excess of N, P elements. Therefore, in order to detect the eutrophication condition in fresh water and the nutrient salt element limitation condition in the ocean, the invention screens the synechococcus 7002 which is lack of sensitivity to N, P and Fe and has higher specificity. Synechococcus 7002 is a prokaryote capable of photosynthesis using inorganic nitrogen and phosphorus and producing organic matters, is one of blue-green algae (also called cyanobacteria), has extremely strong adaptability to the environment, and is expressed in molecular level as gene expression regulation. Meanwhile, as one of model organisms, the synechococcus 7002 has clear genetic background and rapid growth and reproduction, so that the synechococcus 7002 is selected as an engineering strain.

According to the invention, through a large number of experiments, genes capable of regulating expression in N, P and Fe deficiency, namely genes sensitive to N, P and Fe deficiency, are screened from the genome of synechococcus 7002, and the specificity of the genes is high.

The obtained gene sensitive to the N element is numbered A1821 and D0010; wherein, the promoter sequence of the A1821 gene is shown as follows (SEQ ID NO. 1):

CAGTGCTGCCTTCGTGGTTTTCATCGTCTTTGTCCCATTGCATCGTGCCAGCCCAGGTGACATAGGAGCCGCCGACGCTGAGGCTAGCGTCCATGTCGTGCATCTGGCAAATTTCAATGATGCGGGGGTCGTCTTTTTCGAGGGTTTCGACTTGGATATTCGAACCACCGGATTCGGCTCGCCGGAAGGGGAGGTGGTGGGTAACGCGTCGAGACTGCCATTGTCCGGCACTGTATTGGAAAAATTCCTTGGCATCCGCAAAGCTTTGCATATCGAAAAATTGTCCTCTGGGTCTTGGCTGATTACAAAAATATCGTTTTATCGGTGTTTGTTAAAAACATCTTTCAGCTTAACGAATTTCGGGCCGCTCCCTGGAAAATAGGCGATCGCCCCATTGTTTCTTTTTGTTTCAATTTTGACAGAACGATTGACAGAGGTTAGATTAAATGCAGTAGAGACATTCGCAATATTCGCCAGAATTATTGGCAAGGAGCTGCCC

the promoter sequence of the D0010 gene is shown as follows (SEQ ID NO. 2):

GTCCCTGATGTTGGGAATACTCTTGATGACAATTGTGATTGCTCAAAGAAGAAAGAAATTTGGAGTAAATCTCTAAAAGGGGACTGAAATATTTGTATGGTCAGCATGACCACTGAAATGGAGAGAAGTCTAAGACAGTAGATGTCTTAGATATAAGCCTCATTAGAAGCCATGCCATAAAACAGATTTTGTGGATGAAACAACTTGAAATAGTTCAGTTGTAGACCATGTTATAAACATTTATTCTTAACACAGTGACACATTAATGACTCATATATCCGTCCAAAAAAAACTAAAATGTTTGTAAATTTAGTTTTTTTGTGTCGTCAAATATACGGTTTATTTCGTCTTCACATCTTATCTTTATTTTAGTAAGCTGCAGAAAAAACGATATAAGTTAATTTGAGTCATATTGTCCTTTTCGATGTTGTGATGAGCTATCTAACAAAGCAGTTTTTTAATATAAATCCAATTGATAAATTTAGAGCTAGATAGGTGTTTTATGGAGGATAAAATCT

the numbers of the gene sensitive to the P element obtained by the invention are A2284 and A2352; wherein, the promoter sequence of the A2284 gene is shown as follows (SEQ ID NO. 3):

CGCGATTTAAGTCAGTCCTTCAAAAAAAGATTACTTCTTGAACCATCAACAATCTAAATGCCTCCCATGCTGCCCTGAATGTCGTCTAAGATTTTTAGCAGTCAAATCAAATTAAACTGGTCACTGCCTTGATATTTGGCTGAAAATCTCCCCCTGAATTTACCTCGACTTTTGCAAAGATTAACCTTCATTTAACCTCCCTAAAAACTTTGCTTAAGGCTGATGGACTTTTTGGAGAGAGGAGAGAAAAAACAAACATAAATTCTGCATTGATTTTCTGTAGTTATGGTATAAACATCTTGAAAAGTTTTGTGAATCTCAATTCATTTTTTCGAAGATTTACAAATTCATCAGAGCTTCAGAGAGTTTAAGTCTAGAAAAATCGCTCTAATCTTAATCTCTGACTAGCAGTCAATGCCTGAAAGCCTCGATCTCGCTAAAAAGTTTTAATCCATCGCTCACTTACGCTTAATTGCACAGTACACAATAGAGGAAACT

the promoter sequence of the A2352 gene is shown as follows (SEQ ID NO. 4):

CGTGGTGATCTCGCCATCTAGATTGACCCCCGCAAAGGAACCGCGCCAGTTCCCCAGATTTTTTAGAAAATTTTCCCACTGACTGGCCATCGTTATGTTTCCCTGACTAAACTGCACGGTCTTCTATTGTGCCGGAGAAAGAAAAGGGAAAGCAACTCCATCATGGATCCATGCGGGAAGGTCAAGGTTAACAATGCTTCAGCATGGCTCTAATCCCTTCGCTTAATGTAAGACATTATCTTCTTGATTTAATTACTTTTAGTTGCACCTTAGCTAAAAAATATTTGACTAAAAAACAATAATAAAATCACAAAAAATAGTCTTTACAAAATCTAAAATTAAACTTTGCTTAGTTTCTTTTTAACTCAAGCAATTCTCTTTCCATTGTATCGTTGGGGTCGTGGTATTAATCAAATAAATATTAGGTA

the genes sensitive to Fe obtained by the invention are numbered A1291 and G0079; wherein, the promoter sequence of the A1291 gene is shown as follows (SEQ ID NO. 5):

CTGATACCTAGGCGATCGCCTTTTATTGCATGAACACCAACTGATAATTAATAGTGATAAAACTTGTCTGAAATAATTATTGGGTTTCTTCATATCAAAACTGATTAGCAAAAAAGACGTGATCGTTGCGGCGAGAAGTGGAGCGAGAAATTCGTAAAAACTCCTATTTTCTTTGCAGAGATAAGGTTTTTGGTCTCATGGAGTGATTGGCCAGGGCAACTTTTTACAAAAGTTAACTTGACTTTACTGAGAATAATTGTAGGATAAAGCCAATCCTTTATTGCCAAATATATGCGATAAGTGATTAGCCTGATTAGTTTTAACGACCACTCTTTTTAAAATCACGATGCAAACCTACGATAATCCAGACGTTAAATACGAATGGTGGGCAGGCAATGCCCGGTTTGCTGACCTTTCCGGTCAGTTTATTGGTGCCCACGTGGCCCATGCTGCCTTAATTGTTTTCTGGGCAGGGGCCTTCACGTTGTTCGAAATTTCTTACTTTGACCCGACCCTACCC

the promoter sequence of the G0079 gene is shown as follows (SEQ ID NO. 6):

CCGACCGAAAGGTTGAGCAGTAGAGCCGATGTCGCCAAATCTCTTGCGAACCTATTGAGATTGTTTTTGGCTGACATCTGACTTATTTATCAATATAAAGCTAATTAGTTATGTAGTCAACATCTTTGGCTTGCTTTGGTTTGTCCACTTGCCCAAGCAGAATTCAGCGCAAAACGCCTTAAATCTTGTTCTGACCTGACTTGGGTAGCTAGCGATGTCGATCCAGCTTTAATTGAAAAAGATTTCTAGTAGTTTGCTTGACAGGACAAGAATGATCCACTAAAGTCTCTAAGTTAATGCCAATTAATTGCAACTTCAGGGAGATGTCATCAACCCCATGACATTAGTCAATCGCGGTTAATGGGCCATGGGGTTTTTATTTCAGTTAAGTCATCGACGGTTATTTTTCTAAGGTTTTAAAACGTCCTAGGCCCAGTCAATATTTCTGGGCTGTTTATCAGTGGACTTTAATTTTTGCTATTAAATTTCAACTATTTAGATCG

EXAMPLE 2 construction and transformation of recombinant expression vectors

The invention constructs a recombinant expression vector containing a promoter sequence and a fluorescent protein gene fragment of synechococcus gene sensitive to water body nutrient salt deficiency, and then transfers the constructed recombinant expression vector into an engineering strain, namely synechococcus 7002 to obtain the corresponding transgenic synechococcus.

This example illustrates the preparation of the recombinant expression vector and the transgenic synechococcus according to the invention, using the promoter sequence shown in SEQ ID NO.1 as an example.

1. Construction of recombinant expression vectors

(1) Designing a primer by taking a promoter sequence shown in SEQ ID NO.1 as a template, and introducing Kpn I and SalI enzyme cutting sites at two ends of a promoter fragment while amplifying the promoter fragment;

(2) the method comprises the steps of obtaining a pAQE1 vector from synechococcus 7002, and constructing and obtaining a pAQE19 vector by adding enzyme cutting sites and antibiotic resistance genes in the vector, wherein the pAQE19 vector is a gift from Zhao enter eastern academy, the enzyme cutting sites added in the pAQE1 vector are EcoR I and Sal I, and the introduced antibiotic resistance genes are Amp (ampicillin) and Km (kanamycin);

(3) carrying out double enzyme digestion on the constructed pAQE19 vector by using EcoRI and SalI, and purifying after enzyme digestion to obtain a linearized vector with the size of 7.2 k;

(4) carrying out double digestion on the pUC-Luciferase vector by using EcoRI and SalI, and purifying to obtain a fluorescent protein gene (Luciferase, namely the luxAB fluorescent protein gene) fragment;

(5) connecting the linearized pAQE19 vector obtained in the step (3) with the Luciferase fragment obtained in the step (4) to obtain a pAQE19-Luciferase (9.4k) recombinant vector, wherein the construction schematic diagram of the pAQE19-Luciferase (9.4k) recombinant vector is shown in FIG. 1;

(6) carrying out double enzyme digestion on the promoter fragment obtained by amplification in the step (1) and the pAQE19-Luciferase recombinant vector obtained by construction in the step (5) by using Kpn I and Sal I respectively, purifying and recovering a linearized vector and the promoter fragment after enzyme digestion, and connecting the promoter fragment with the linearized pAQE19-Luciferase vector to construct a recombinant expression vector, wherein the construction schematic diagram is shown in FIG. 2.

2. Preparation of transgenic Synechococcus

(1) Taking 1mL of wild synechococcus 7002 algae liquid growing to logarithmic phase, centrifuging at 6000rpm for 2 minutes, and removing supernatant;

(2) adding culture medium to resuspend algae cells, blowing and mixing uniformly, centrifuging at 6000rpm for 2min, and discarding supernatant;

(3) adding the culture medium again to resuspend the algae cells, sucking a small amount of the resuspended algae liquid into a new 1.5mL EP tube, and adding a proper amount of the culture medium to dilute the algae liquid to light green;

(4) adding 200 mu L of diluted algae liquid into a new EP tube, adding 1.5 mu L of the constructed recombinant expression vector, sucking, beating and uniformly mixing;

(5) culturing the algae-recombinant expression vector mixture obtained in the step (4) in a 30 ℃ low-light incubator for 4 hours;

(6) preparing a flat plate, taking out the algae-recombinant expression vector mixture from the incubator, dripping 200 mu L of the mixture on a membrane in the flat plate, and uniformly coating the mixture;

(7) and after the liquid in the plate is dried, closing the plate, placing the plate in an illumination incubator at 30 ℃ for culturing until the grown monoclone grows out, and identifying and passaging the grown monoclone.

According to the invention, by the method, transgenic synechococcus NBU1042 (containing an A1821 promoter-luxAB fluorescent protein gene) and transgenic synechococcus NBU1048 (containing a D0010 promoter-luxAB fluorescent protein gene) which are sensitive to the deficiency of N, transgenic synechococcus NBU1044 (containing an A2284 promoter-luxAB fluorescent protein gene) and transgenic synechococcus NBU1046 (containing an A2352 promoter-luxAB fluorescent protein gene) which are sensitive to the deficiency of P, transgenic synechococcus NBU1462 (containing an A1291 promoter-luxAB fluorescent protein gene) and transgenic synechococcus NBU1050 (containing a G0079 promoter-luxAB fluorescent protein gene) which are sensitive to the deficiency of Fe are respectively obtained.

Example 3 nutrient salt bioavailability survey

This example illustrates the method of detecting bioavailability of a nutritive salt according to the present invention, by way of example of determining N, P, Fe bioavailability. Because of the preference of phytoplankton for the absorption of nutrient salts, different forms of nutrient salts (such as the same nitrogen source, which can be divided into organic and inorganic, and more preferentially phytoplankton for the absorption of inorganic nitrogen) are available to phytoplankton differently, and the eutrophication effect of water bodies brought by different types of nitrogen sources with the same content is quite different. Therefore, the invention detects NO in the water body₃ ^－Equivalent N concentration, PO₄ ^3－Equivalent P concentration and Fe³⁺Equivalent Fe concentration.

The culture medium for culturing synechococcus of the invention is rich nutritive salt (A)⁺) Medium, Normal A⁺The nutrient salt components and the concentrations thereof contained in the culture medium are respectively as follows: NaCl 0.307M, KCl 8mM, NaNO₃Is 12mM, MgSO₄20mM CaCl₂2.5mM, Tris-HCl 8.3mM, KH₂PO₄At 370 μ M, FeCl ₃10 μ M EDTA 80 μ M, VB₁₂Is 3nM, H₃BO₃Is 0.55 μ M, ZnSO₄2.3. mu.M, CuSO₄Is 12nM, MnCl₂Is 20nM, CoCl₂Was 50 nM.

In order to select transgenic synechococcus with higher fluorescence expression for experiment, the invention tests the fluorescence values of different transgenic synechococcus through a preliminary experiment, and the result is shown in figure 3. As can be seen from the results shown in FIG. 3, the fluorescence values of the N-deficient transgenic synechococcus NBU1042 and the P-deficient transgenic synechococcus NBU1046 are relatively higher, and therefore, the N-deficient transgenic synechococcus NBU1042 and the P-deficient transgenic synechococcus NBU1046 are subsequently selected to detect the bioavailability of the nutritive salts.

In order to improve the response speed of the transgenic synechococcus, the invention firstly performs hunger treatment on the transgenic synechococcus before drawing a standard curve of the relation between the nutrient salt concentration and the fluorescence value to ensure that the fluorescence value reaches the maximum, and then the transgenic synechococcus after hunger treatment is placed in a nutrient solution concentration gradient culture medium to ensure that the transgenic synechococcus responds more quickly and achieves the aim of short-time and quick detection.

The transgenic synechococcus (namely the N-deficient sensitive transgenic synechococcus NBU1042, the P-deficient sensitive transgenic synechococcus NBU1046 and the Fe-deficient sensitive transgenic synechococcus NBU1462 obtained in example 2) cultured to the logarithmic phase are respectively eluted by using a culture medium without N, P, Fe and then cultured in corresponding culture media lacking N, P and Fe under the illumination condition of 100 +/-10 mu E m^-2s^-1And carrying out shaking culture at the temperature of 30 ℃ and 110rpm, and measuring fluorescence values by using a Thermo multifunctional microplate reader for 1 hour, 3 hours, 6 hours, 12 hours and 24 hours respectively until the fluorescence value reaches the maximum value.

The fluorescence value measuring method comprises the following steps: and sucking 200 mu L of the cultured algae liquid to a white lightproof 96-well plate, adding 5 mu L of DMSO solution containing 0.1mM decanal before measurement, quickly placing the mixture into a microplate reader, completing the measurement within 1 minute, reading and recording data.

Under the culture conditions, the transgenic synechococcus NBU1042 sensitive to the lack of N reaches the highest fluorescence value at 18 hours, and the transgenic synechococcus NBU1046 sensitive to the lack of P and the transgenic synechococcus NBU1462 sensitive to the lack of Fe reach the highest fluorescence value at 36 hours. When the bioavailability of the nutritive salt in the water body is detected subsequently, the hunger treatment time of the transgenic synechococcus is 48 hours, and the hunger treatment is carried out by two times.

The method specifically comprises the following steps: eluting the transgenic synechococcus cultured to logarithmic phase with corresponding nutrient-deficient culture medium, and culturing in the corresponding nutrient-deficient culture medium under the illumination condition of 100 +/-10 mu E m^-2s^-1Carrying out shaking culture at the temperature of 30 ℃ and the rpm of 110; centrifuging to remove supernatant after culturing for 24 hr, cleaning with corresponding nutrient-deficient culture medium twice (adding culture medium for resuspension, centrifuging, discarding supernatant), removing nutrient elements outside algae cells, inoculating into corresponding nutrient-deficient culture medium, culturing for 24 hr

After the starvation treatment, the standard curve can be drawn:

the transgenic synechococcus NBU1042 sensitive to the lack of N, the transgenic synechococcus NBU1046 sensitive to the lack of P and the transgenic synechococcus NBU1046 sensitive to the lack of FeSensitive transgenic synechococcus NBU1462 and transgenic synechococcus NBU1050 sensitive to Fe deficiency are deficient in N, P and rich in nutrient salts of Fe, respectively (a)⁺) Culture media (e.g. for the cultivation of transgenic Synechococcus NBU1042, then A sensitive to N deficiency⁺No N element was added to the medium) in a medium (light irradiation condition 100. + -. 10. mu. E m)^-2s^-1Shaking culture at 30 deg.C and 110 rpm) for 24 hr, centrifuging to remove supernatant, washing with corresponding nutrient-deficient culture medium twice (adding corresponding nutrient-deficient culture medium for resuspension, centrifuging, discarding supernatant), removing nutrient elements from algae cells, and adjusting OD₇₃₀0.1, corresponding A lacking N, P, Fe was accessed again⁺Culturing in a culture medium;

after culturing for 24h again, diluting the cultured transgenic synechococcus culture fluid and subpackaging the diluted culture fluid into corresponding culture media with different concentration gradients for culturing (OD at the moment)₇₃₀0.02), the fluorescence value was measured and a standard curve was plotted. The concentration gradients of the nutritive salts set in this example are respectively as follows;

the concentration gradient of N is: 12mM, 1.2mM, 120. mu.M, 12. mu.M, 0. mu.M;

the concentration gradient of P is: 370 μ M, 37 μ M, 3.7 μ M, 0.37 μ M, 0 μ M;

the concentration gradient of Fe is: 1000nM, 100nM, 10nM, 1nM, 0 nM.

The standard curve obtained by using the transgenic synechococcus NBU1042 sensitive to the lack of N is shown in fig. 4; the standard curve obtained by using the transgenic synechococcus NBU1046 sensitive to lack of P is shown in fig. 5; the standard curve drawn by using the transgenic synechococcus NBU1462 sensitive to Fe deficiency and the transgenic synechococcus NBU1050 is shown in fig. 6, wherein the blue line is the standard curve drawn by using the transgenic synechococcus NBU1462, and the yellow line is the standard curve drawn by using the transgenic synechococcus NBU 1050.

As can be seen from FIG. 4, the fluorescence value of the transgenic Synechococcus NBU1042 sensitive to N deficiency after being cultured for 24 hours under different N concentration gradients has a good linear relationship with the N concentration. As can be seen from FIG. 5, the fluorescence value of the transgenic synechococcus NBU1046 sensitive to P deficiency after being cultured for 24 hours under different P concentration gradients has a good linear relationship with the P concentration. From FIG. 6, it can be seen that the linear relationship between the fluorescence value and Fe concentration of transgenic Synechococcus NBU1462 and NBU1050 which are sensitive to Fe deficiency and cultured for 24 hours under different Fe concentration gradients is not as good as that of N and P, but can also meet the requirements of the subsequent experiments.

S2, after a standard curve is drawn, placing the transgenic synechococcus which is the same as that in the process of drawing the standard curve into a water body sample to be measured, culturing the synechococcus under the same conditions as that in the process of drawing the standard curve, measuring a fluorescence value, and calculating the concentration of nutrient salt elements corresponding to the standard curve in the measured water body sample by using the obtained standard curve.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> Ningbo university

Guangdong Laboratory of Southern Marine Science and Engineering (Zhuhai)

<120> method for detecting bioavailability of nutritive salt in water body by using promoter of synechococcus gene

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 499

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 1

cagtgctgcc ttcgtggttt tcatcgtctt tgtcccattg catcgtgcca gcccaggtga 60

cataggagcc gccgacgctg aggctagcgt ccatgtcgtg catctggcaa atttcaatga 120

tgcgggggtc gtctttttcg agggtttcga cttggatatt cgaaccaccg gattcggctc 180

gccggaaggg gaggtggtgg gtaacgcgtc gagactgcca ttgtccggca ctgtattgga 240

aaaattcctt ggcatccgca aagctttgca tatcgaaaaa ttgtcctctg ggtcttggct 300

gattacaaaa atatcgtttt atcggtgttt gttaaaaaca tctttcagct taacgaattt 360

cgggccgctc cctggaaaat aggcgatcgc cccattgttt ctttttgttt caattttgac 420

agaacgattg acagaggtta gattaaatgc agtagagaca ttcgcaatat tcgccagaat 480

tattggcaag gagctgccc 499

<210> 2

<211> 518

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 2

gtccctgatg ttgggaatac tcttgatgac aattgtgatt gctcaaagaa gaaagaaatt 60

tggagtaaat ctctaaaagg ggactgaaat atttgtatgg tcagcatgac cactgaaatg 120

gagagaagtc taagacagta gatgtcttag atataagcct cattagaagc catgccataa 180

aacagatttt gtggatgaaa caacttgaaa tagttcagtt gtagaccatg ttataaacat 240

ttattcttaa cacagtgaca cattaatgac tcatatatcc gtccaaaaaa aactaaaatg 300

tttgtaaatt tagttttttt gtgtcgtcaa atatacggtt tatttcgtct tcacatctta 360

tctttatttt agtaagctgc agaaaaaacg atataagtta atttgagtca tattgtcctt 420

ttcgatgttg tgatgagcta tctaacaaag cagtttttta atataaatcc aattgataaa 480

tttagagcta gataggtgtt ttatggagga taaaatct 518

<210> 3

<211> 498

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 3

cgcgatttaa gtcagtcctt caaaaaaaga ttacttcttg aaccatcaac aatctaaatg 60

cctcccatgc tgccctgaat gtcgtctaag atttttagca gtcaaatcaa attaaactgg 120

tcactgcctt gatatttggc tgaaaatctc cccctgaatt tacctcgact tttgcaaaga 180

ttaaccttca tttaacctcc ctaaaaactt tgcttaaggc tgatggactt tttggagaga 240

ggagagaaaa aacaaacata aattctgcat tgattttctg tagttatggt ataaacatct 300

tgaaaagttt tgtgaatctc aattcatttt ttcgaagatt tacaaattca tcagagcttc 360

agagagttta agtctagaaa aatcgctcta atcttaatct ctgactagca gtcaatgcct 420

gaaagcctcg atctcgctaa aaagttttaa tccatcgctc acttacgctt aattgcacag 480

tacacaatag aggaaact 498

<210> 4

<211> 428

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 4

cgtggtgatc tcgccatcta gattgacccc cgcaaaggaa ccgcgccagt tccccagatt 60

ttttagaaaa ttttcccact gactggccat cgttatgttt ccctgactaa actgcacggt 120

cttctattgt gccggagaaa gaaaagggaa agcaactcca tcatggatcc atgcgggaag 180

gtcaaggtta acaatgcttc agcatggctc taatcccttc gcttaatgta agacattatc 240

ttcttgattt aattactttt agttgcacct tagctaaaaa atatttgact aaaaaacaat 300

aataaaatca caaaaaatag tctttacaaa atctaaaatt aaactttgct tagtttcttt 360

ttaactcaag caattctctt tccattgtat cgttggggtc gtggtattaa tcaaataaat 420

attaggta 428

<210> 5

<211> 520

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 5

ctgataccta ggcgatcgcc ttttattgca tgaacaccaa ctgataatta atagtgataa 60

aacttgtctg aaataattat tgggtttctt catatcaaaa ctgattagca aaaaagacgt 120

gatcgttgcg gcgagaagtg gagcgagaaa ttcgtaaaaa ctcctatttt ctttgcagag 180

ataaggtttt tggtctcatg gagtgattgg ccagggcaac tttttacaaa agttaacttg 240

actttactga gaataattgt aggataaagc caatccttta ttgccaaata tatgcgataa 300

gtgattagcc tgattagttt taacgaccac tctttttaaa atcacgatgc aaacctacga 360

taatccagac gttaaatacg aatggtgggc aggcaatgcc cggtttgctg acctttccgg 420

tcagtttatt ggtgcccacg tggcccatgc tgccttaatt gttttctggg caggggcctt 480

cacgttgttc gaaatttctt actttgaccc gaccctaccc 520

<210> 6

<211> 503

<212> DNA

<213> Synechococcus 7002(Synechococcus sp. PCC 7002)

<400> 6

ccgaccgaaa ggttgagcag tagagccgat gtcgccaaat ctcttgcgaa cctattgaga 60

ttgtttttgg ctgacatctg acttatttat caatataaag ctaattagtt atgtagtcaa 120

catctttggc ttgctttggt ttgtccactt gcccaagcag aattcagcgc aaaacgcctt 180

aaatcttgtt ctgacctgac ttgggtagct agcgatgtcg atccagcttt aattgaaaaa 240

gatttctagt agtttgcttg acaggacaag aatgatccac taaagtctct aagttaatgc 300

caattaattg caacttcagg gagatgtcat caaccccatg acattagtca atcgcggtta 360

atgggccatg gggtttttat ttcagttaag tcatcgacgg ttatttttct aaggttttaa 420

aacgtcctag gcccagtcaa tatttctggg ctgtttatca gtggacttta atttttgcta 480

ttaaatttca actatttaga tcg 503

Claims

1. A transgenic synechococcus is characterized in that the transgenic synechococcus contains a recombinant expression element consisting of a promoter sequence of synechococcus gene sensitive to water body nutrient salt deficiency and a fluorescent protein gene fragment.

2. The transgenic synechococcus according to claim 1, wherein the recombinant expression element is a recombinant expression vector containing a promoter sequence of synechococcus gene sensitive to water body nutrient salt deficiency and a fluorescent protein gene fragment.

3. The transgenic synechococcus according to claim 1, wherein said synechococcus gene sensitive to a deficiency in nutritive salts in water is a synechococcus gene sensitive to a deficiency in nitrogen, phosphorus or iron elements.

4. The transgenic synechococcus according to claim 3, wherein said synechococcus group sensitive to nitrogen deficiency is A1821 or D0010, said synechococcus group sensitive to phosphorus deficiency is A2284 or A2352, and said synechococcus group sensitive to iron deficiency is A1291 or G0079.

5. The transgenic synechococcus according to claim 4, wherein the promoter sequence of the A1821 gene is shown as SEQ ID No.1, and the promoter sequence of the D0010 gene is shown as SEQ ID No. 2; the promoter sequence of the A2284 gene is shown as SEQ ID NO.3, and the promoter sequence of the A2352 gene is shown as SEQ ID NO. 4; the promoter sequence of the A1291 gene is shown as SEQ ID NO.5, and the promoter sequence of the G0079 gene is shown as SEQ ID NO. 6.

6. The transgenic Synechococcus according to any one of claims 1 to 5, wherein the Synechococcus is Synechococcus 7002.

7. Use of the transgenic synechococcus according to any one of claims 1 to 6 for detecting the bioavailability of nutritive salts in a water body.

8. A method for detecting bioavailability of nutritive salts in water by using the transgenic synechococcus according to any one of claims 1 to 6, which comprises the following steps:

s2, placing the transgenic synechococcus which is the same as the transgenic synechococcus in the step S1 in the water body sample to be detected, culturing the synechococcus under the same conditions as the step S1, then determining the fluorescence value, and calculating the concentration of nutrient salt elements corresponding to the standard curve in the water body sample to be detected by using the standard curve obtained in the step S1.

9. The method of claim 8, wherein the transgenic Synechococcus is cultured at 28-30 deg.C under 100 + -10 μ E m^-2s^-1。

10. The method of claim 8, wherein the transgenic synechococcus is subjected to starvation in a corresponding nutrient-deficient medium prior to drawing the standard curve.