CN114731987B

CN114731987B - Craniosynostosis mice model, construction method and application thereof

Info

Publication number: CN114731987B
Application number: CN202210543331.4A
Authority: CN
Inventors: 田静; 王志浩; 张东伟
Original assignee: Huaxin Microfish Suzhou Biotechnology Co ltd
Current assignee: Huaxin Microfish Suzhou Biotechnology Co ltd
Priority date: 2022-05-19
Filing date: 2022-05-19
Publication date: 2023-06-23
Anticipated expiration: 2042-05-19
Also published as: CN114731987A

Abstract

The application particularly relates to a craniosynostosis mouse model, a construction method and application thereof, wherein the construction method comprises the following steps: s1, providing Rosa26 ^FGFR2 And Sp7-CRE mice; s2, rosa26 ^FGFR2 The mice were selfed to give Rosa26 ^FGFR2 Positively expressed F1 mice; selfing the Sp7-CRE mice to obtain F1 generation mice positively expressed by the Sp 7-CRE; s3, rosa26 ^FGFR2 Hybridization of the-F1 mice with Sp7-CRE-F1 mice gave F2 mice, which were expressed as Rosa26 ^FGFR2 And Sp7-CRE double positive is the craniosynostosis mice model. The mouse model with stable craniosynostosis pathological phenotype can be screened by the mouse model with the craniosynostosis constructed by the construction method, and the action mechanism of the FGFR2 gene in the hereditary craniosynostosis of the mouse can be conveniently researched in practical application.

Description

Craniosynostosis mice model, construction method and application thereof

Technical Field

The application relates to the field of biotechnology, in particular to a craniosynostosis mouse model, a construction method and application thereof.

Background

Congenital craniocerebral osteosynthesis is a premature bony fusion of one or more craniocerebral sutures, and the growth of the cranium and brain tissue beside the craniocerebral sutures is limited, resulting in diseases of narrow cranial and orbital cavities, intracranial hypertension, craniomaxillofacial deformity. Craniofacial osteosynthesis premature closure is one of the most common congenital craniofacial deformities, with a morbidity of 0.03% -0.05% in newborns, at position 2 (about 1/2000, second only to cleft lip and palate deformity) of the common craniofacial developmental deformity. Craniosynostosis occurs in embryonic stages and is progressively exacerbated by age after birth. The craniofacial osteogenesis is abnormal due to the premature closure of the craniofacial suture, and more serious, the brain development of the sick children is limited. Is particularly important for early diagnosis and early treatment of congenital craniocerebral premature closure, ensuring the growth and development of the brain, visual functions and the like.

There is a need to provide a mouse model with a stable craniocerebral premature closure pathology phenotype and a corresponding construction method, based on which the present application is filed.

Disclosure of Invention

The application aims to provide a craniosynostosis mouse model, a construction method and application thereof, and the mouse model with stable craniosynostosis pathological phenotype can be screened.

In order to achieve the above purpose, the present application provides the following technical solutions:

in a first aspect, a method for constructing a craniosynostosis mouse model is provided, comprising:

s1, providing Rosa26 ^FGFR2 Mice and Sp7-CRE mice;

s2, rosa26 ^FGFR2 Selfing the mice to obtain Rosa26 ^FGFR2 -F1 mice; selfing the Sp7-CRE mice to obtain Sp7-CRE-F1 generation mice;

s3, rosa26 ^FGFR2 Hybridization of the-F1 mice with Sp7-CRE-F1 mice gave F2 mice, which were expressed as Rosa26 ^FGFR2 Sp7-CRE double positive is the craniosynostosis mice model.

In some possible embodiments, the Rosa26 ^FGFR2 The genotypes of the mice and Sp7-CRE mice were Rosa26, respectively ^FGFR2/+ And Sp7-CRE ^+/- 。

In some possible embodiments, the providing Rosa26 ^FGFR2 Mice and Sp7-CRE mice included:

construction of LoxP-FGFR2 conditional overexpression mice in Rosa26 genes by CRISPR/Cas9 technology to obtain Rosa26 ^FGFR2/+ A mouse;

sp7-CRE heterozygous mice carrying CRE elements in the Sp7 gene promoter region were constructed using CRISPR/Cas9 technology.

In some possible embodiments, loxP-FGFR2 conditional overexpression mice in the construction of Rosa26 genes using CRISPR/Cas9 technology, obtaining Rosa26 ^FGFR2/+ In mice, the sequences of the detection primers WT-F, WT-R, FGFR2-F and FGFR2-R are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively.

In some possible embodiments, in Sp7-CRE heterozygous mice carrying CRE elements in the constructed Sp7 gene promoter region using CRISPR/Cas9 technology, the detection primers used, transgene-F, transgene-R, control-F and Control-R, have the sequences shown in SEQ ID NO.5 through SEQ ID NO.8, respectively.

In some possible embodiments, in step S3, further comprising performing PCR on the Rosa26 ^FGFR2 And Cre-Sp ⁷ Double positive mice are identified and screened, and when the target bands verified by PCR comprise two bands from SEQ ID NO.3 to SEQ ID NO.6, rosa26 is considered to be obtained ^FGFR2 Sp7-CRE double positive mice.

In some possible embodiments, the Rosa26 ^FGFR2 Genotypes of the F1 mice include Rosa26 ^FGFR2/+ And Rosa26 ^FGFR2/FGFR2 The method comprises the steps of carrying out a first treatment on the surface of the And/or, the genotype of the Sp7-CRE-F1 generation mouse comprises Sp7-CRE ^+/- And Sp7-CRE ^-/- 。

In some possible embodiments, the genotype of the craniosynostosis mouse model comprises Rosa26 ^FGFR2/+ :Sp7-CRE ^+/- 、Rosa26 ^FGFR2/FGFR2 :Sp7-CRE ^+/- 、Rosa26 ^FGFR2/+ :Sp7-CRE ^-/- And Rosa26 ^FGFR2/FGFR2 :Sp7-CRE ^-/- 。

In a second aspect, the present application provides a mouse model or progeny thereof obtained according to the described construction method.

In a third aspect, the present application provides an application of the construction method or the mouse model or the offspring thereof in the related field of the craniosynostosis syndrome without the aim of diagnosing and treating diseases, wherein the application comprises the application in preparing or screening medicines for preventing, diagnosing or treating the craniosynostosis syndrome.

Compared with the prior art, the invention has the beneficial effects that:

the mouse model with stable craniosynostosis pathological phenotype can be screened by the mouse model with the craniosynostosis constructed by the construction method, and the action mechanism of the FGFR2 gene in the hereditary craniosynostosis of the mouse can be conveniently researched in practical application. Meanwhile, the mouse model provided by the application eliminates the influence caused by the position mutation in the FGFR2 gene point mutation model, can provide a stable and effective research model, and has great significance in researches on pathogenesis, treatment methods, drug screening, craniocerebral suture early closure operation and the like.

The foregoing description is only an overview of the present invention, and is intended to provide a better understanding of the present invention, as it is embodied in the following description, with reference to the preferred embodiments of the present invention and the accompanying drawings.

Drawings

FIG. 1 is a schematic diagram of a genetic craniosynostosis mouse model construction strategy provided in an embodiment of the present application;

FIG. 2 is a diagram of the result of PCR detection screening provided in the example of the present application, wherein (A) is the result of double positive model mouse PCR, and (B) is the result of single positive control mouse PCR;

fig. 3 is a phenotype diagram of a genetic craniosynostosis mouse model provided in an embodiment of the present application, wherein (a) is a side view, (B) is a top view, (C) is a side profile comparison view, and (D) is a top profile comparison view.

Detailed Description

The following describes in further detail the embodiments of the present invention with reference to the drawings and examples. The following examples are illustrative of the invention and are not intended to limit the scope of the invention.

It should be noted that: in this application, "accuracy" refers to the degree to which the number of measurements or calculations (test report values) matches their actual (or true) values. Clinical accuracy refers to the ratio of true output (true positive (TP) or True Negative (TN) to misclassified output (false positive (FP) or False Negative (FN)) and may be expressed as sensitivity, specificity, positive Predictive Value (PPV) or Negative Predictive Value (NPV), matheus Correlation Coefficient (MCC), or likelihood, yield ratio, receiver Operating Characteristic (ROC) curve, area Under Curve (AUC), among other measures.

For diagnostic (or prognostic) interventions of the present application, since each output (which may be TP, FP, TN, or FN in a disease classification diagnostic test) bears a different cost, the health economic utility function may be based on clinical conditions and individual output costs and values, preferably prone to sensitivity over specificity, or PPV over NPV, thus providing another measure of health economic performance and value, which may be different from the more direct clinical or analytical performance measure. These different measures and relative tradeoffs will generally only converge with perfect tests with zero error rate (also known as zero predicted object output misclassifications or FP and FN), all performance measures will tend to be imperfect, but to a different extent.

"measuring," "determining," "detecting," or "examining" refers to evaluating the presence, absence, quantity, or amount (which can be an effective amount) of a given substance or subject-derived sample (including the derivation of a qualitative or quantitative concentration level of such a substance) in a clinic, or otherwise assessing the value or classification of a non-analyte clinical parameter or clinical-determinant of a subject.

A "sample" in the context of the present application is a biological sample isolated from a subject and can include, for example, but is not limited to, whole blood, serum, plasma, saliva, mucus, respiratory air, urine, CSF, saliva, sweat, stool, hair, semen, biopsies, rhinorrhea, tissue biopsies, cytological samples, platelets, reticulocytes, white blood cells, epithelial cells, or whole blood cells.

The term "treatment" as used herein means slowing, interrupting, arresting, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease, but does not necessarily refer to the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

Data in the context of this application all meet statistical requirements (statistical significance), by "statistically significant" is meant that the change is greater than what might be expected by chance alone (which may be a "false positive"). The statistical significance can be determined by any method known in the art. A common measure of significance comprises a p-value that represents the probability that at least the limit value will achieve a result at a given data point, assuming that the data point is a single occasional result. The p value is 0.05 or less, and the result is generally considered to be high in significance.

It is to be noted that the following examples do not specify a specific technique or condition, and are carried out according to a technique or condition described in the literature in the field, or according to a product specification. The reagents or equipment used were conventional products available for purchase by regular vendors, with no manufacturer noted.

Example one construction of a craniosynostosis mouse model

Referring to FIG. 1, in this example, a CRISPR/Cas9 technology was used to construct a loxP-FGFR2 conditional overexpression mouse in a Rosa26 gene to obtain Rosa26 ^FGFR2/+ The mice were selfed to obtain Rosa26 ^FGFR2 F1-generation mice (Rosa 26) ^FGFR2/+ And Rosa26 ^FGFR2/FGFR2 ) The detection primers in this procedure are shown in Table 1 and SEQ ID NO.1 to SEQ ID NO. 4.

Table 1 detection primers (SEQ ID NO.1 to SEQ ID NO. 4)

Name of the name	Primer(s)	Sequence(s)
			WT	F	tcagattcttttataggggacaca
WT	R	taaaggccactcaatgctcactaa
			FGFR2	F	ggcatgcagtgccctcccagagaccaacg
FGFR2	R	gttccgctgcctgcaaagggtcgctacag

Construction of Sp7-CRE heterozygous mice carrying CRE elements in Sp7 Gene promoter region by CRE/Cas 9 technique, selfing the mice to obtain Sp7-CRE-F1 mice (Sp 7-CRE) ^+/- And Sp7-CRE ^-/- ) The detection primers in this procedure are shown in Table 2 and SEQ ID NO.5 to SEQ ID NO. 8.

Table 2 detection primers (SEQ ID NO.5 to SEQ ID NO. 8)

Name of the name	Primer(s)	Sequence(s)
			Transgene	F	tcgatgcaacgagtgatgag
Transgene	R	tccatgagtgaacgaacctg
			Control	F	caaatgttgcttgtctggtg
Control	R	gtcagtcgagtgcacagttt

Rosa26 ^FGFR2 Crossing the F1 generation mice with Sp7-CRE-F1 generation mice,f2 mice were obtained and expressed as Rosa26 ^FGFR2 Sp7-CRE double positive is the craniosynostosis mice model, which comprises the following four genotypes: rosa26 ^FGFR2/+ :Sp7-CRE ^+/- 、Rosa26 ^FGFR2/FGFR2 :Sp7-CRE ^+/- 、Rosa26 ^FGFR2/+ :Sp7-CRE ^-/- And Rosa26 ^FGFR2/FGFR2 :Sp7-CRE ^-/- 。

In this embodiment, the CRISPR/Cas9 technology is a technology that is currently mature and is not described in detail herein; meanwhile, the application is directed to Rosa26 ^FGFR2 The methods of construction of the mice and Sp7-CRE mice are not critical and in other embodiments not shown, rosa26 may be constructed using other methods known to those skilled in the art ^FGFR2 Mice and Sp7-CRE mice were constructed.

Example two mice genotyping primers and detection

To obtain Rosa26 ^FGFR2 Sp7-CRE double-positive mice, tail cutting is carried out on F2 generation young mice produced after hybridization, PCR verification is carried out after genome DNA is extracted, the target bands comprise FGFR2 and CRE double bands, namely two bands which comprise primer sequences verified as shown in SEQ ID NO.3 to SEQ ID NO.6, namely double-positive heterozygous mice of a craniosynostosis model, and the detection result is shown in figure 2.

In this example, the reaction system and reaction conditions of PCR are shown in tables 3 and 4, respectively.

TABLE 3 PCR reaction System

Reaction Component	Volume(μl)
		ddH ₂ O	14.9
10x Taq PCR Buffer	2
		2.5mM dNTP	1
Primer I(10pmol/μl)	0.5
		Primer II(10pmol/μl)	0.5
Taq DNA Polymerase	0.1
		genomic DNA	1
Total	20

TABLE 4 PCR reaction conditions

Referring to fig. 3, the screened dual-positive heterozygous mice of the craniosynostosis model have obvious craniosynostosis phenotype, are different from those of single-positive mice of a control group in aspects of skull appearance, mandibular height, parietal bone height and the like, and meanwhile, due to the development problem of the skull, the model mice have wide interocular distance, shortened interocular and nasal distance and shortened maxillofacial bone, and have a plurality of similarities with the reported human craniosynostosis, so that the mouse model is a suitable model of the craniosynostosis early-closure syndrome.

Based on the above embodiments, the construction method, the mouse model or the progeny thereof provided by the application can provide a stable and effective research model for researches on pathogenesis, treatment method, drug screening, craniocerebral premature closure operation and the like, and particularly can be applied to preparation/screening of drugs for preventing, diagnosing or treating craniocerebral premature closure syndrome.

To sum up:

It should be understood that the term "and/or" is merely one association relationship describing the associated object, and means that there are three relationships, e.g., a and/or B, representing: there are three cases where A alone exists, where A and B exist together, and where A, B are singular or plural.

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> Suzhou Nostoc New drug development Co., ltd

<120> craniosynostosis mice model, construction method and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

tcagattctt ttatagggga caca 24

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

taaaggccac tcaatgctca ctaa 24

<210> 3

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggcatgcagt gccctcccag agaccaacg 29

<210> 4

<211> 29

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gttccgctgc ctgcaaaggg tcgctacag 29

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tcgatgcaac gagtgatgag 20

<210> 6

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tccatgagtg aagaacctg 19

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

caaatgttgc ttgtctggtg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gtcagtcgag tgcacagttt 20

Claims

1. A method for constructing a craniosynostosis mouse model, comprising: s1, providing Rosa26 ^FGFR2 Mice and Sp7-CRE mice;

s2, rosa26 ^FGFR2 Selfing the mice to obtain Rosa26 ^FGFR2 Positively expressed F1 mice; selfing the Sp7-CRE mice to obtain F1 generation mice positively expressed by the Sp 7-CRE;

s3, rosa26 ^FGFR2 Hybridization of the-F1 mice with Sp7-CRE-F1 mice gave F2 mice, which were expressed as Rosa26 ^FGFR2 Sp7-CRE double positive is the craniosynostosis mice model;

wherein the Rosa26 ^FGFR2 The genotypes of the mice and Sp7-CRE mice were Rosa26, respectively ^FGFR2/+

And Sp7-CRE ^+/- Providing the Rosa26 ^FGFR2 The steps of the mice and the Sp7-CRE mice include: constructing a LoxP-FGFR2 conditional overexpression mouse in a Rosa26 gene by using a CRISPR/Cas9 technology,

obtaining Rosa26 ^FGFR2/+ A mouse;

construction of Sp7 Gene promoter Using CRISPR/Cas9 technologySp7-CRE with CRE element in the promoter region ^+/-

Heterozygous mice.

2. The construction method of claim 1, wherein the LoxP-FGFR2 overexpressing mice in the construction of Rosa26 gene using CRISPR/Cas9 technology yields Rosa26 ^FGFR2 In mice, the sequences of the detection primers WT-F, WT-R, FGFR2-F and FGFR2-R are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively.

3. The construction method of claim 2, wherein the construction of Sp7-CRE with CRE elements in the Sp7 gene promoter region using CRISPR/Cas9 technology ^+/- In heterozygous mice, the sequences of the adopted detection primers, namely, transgene-F, transgene-R, control-F and Control-R, are shown as SEQ ID NO.5 to SEQ ID NO.8 respectively.

4. The construction method according to claim 3, further comprising the step of performing PCR on the Rosa26 in step S3 ^FGFR2 And Sp7-CRE double-positive mice, and when the target band verified by PCR comprises two bands from SEQ ID NO.3 to SEQ ID NO.6, rosa26 is considered to be obtained ^FGFR2 Sp7-CRE double positive mice.

5. The method of construction of claim 1, wherein the Rosa26 ^FGFR2 Genotypes of the F1 mice include Rosa26 ^FGFR2/+ And Rosa26 ^FGFR2/FGFR2 The method comprises the steps of carrying out a first treatment on the surface of the And/or, the genotype of the Sp7-CRE-F1 generation mouse comprises Sp7-CRE ^+/- And Sp7-CRE ^-/- 。

6. The method of claim 5, wherein the genotype of the craniosynostosis mouse model comprises Rosa26 ^{FGFR2/+:Sp7-CRE+/-} 、Rosa26 ^FGFR2/FGFR2 :Sp7-CRE ^+/- 、Rosa26 ^{FGFR2/+:Sp7-CRE-/-} And Rosa26 ^FGFR2 ^/FGFR2 :Sp7-CRE ^-/- 。

7. Use of a mouse model or its progeny according to the construction method of any one of claims 1 to 6 in the field related to craniosynostosis syndromes not aimed at diagnosis and treatment of the disease, characterized in that said use comprises the use in the preparation or screening of a medicament for the prevention, diagnosis or treatment of craniosynostosis syndromes.