CN114717327A - Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology - Google Patents
Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology Download PDFInfo
- Publication number
- CN114717327A CN114717327A CN202210237597.6A CN202210237597A CN114717327A CN 114717327 A CN114717327 A CN 114717327A CN 202210237597 A CN202210237597 A CN 202210237597A CN 114717327 A CN114717327 A CN 114717327A
- Authority
- CN
- China
- Prior art keywords
- scar
- rice
- weevil
- reaction
- coi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000000034 method Methods 0.000 title claims abstract description 50
- 241000254152 Sitophilus oryzae Species 0.000 title claims abstract description 47
- 241000607479 Yersinia pestis Species 0.000 title abstract description 6
- 238000005516 engineering process Methods 0.000 title abstract description 6
- 210000001035 gastrointestinal tract Anatomy 0.000 title abstract description 6
- 230000003321 amplification Effects 0.000 claims abstract description 25
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 24
- 241000894007 species Species 0.000 claims abstract description 18
- 241000966204 Lissorhoptrus oryzophilus Species 0.000 claims abstract description 9
- 231100000241 scar Toxicity 0.000 claims abstract description 8
- 108091028043 Nucleic acid sequence Proteins 0.000 claims abstract description 3
- 238000006243 chemical reaction Methods 0.000 claims description 53
- 108020004414 DNA Proteins 0.000 claims description 41
- 239000007795 chemical reaction product Substances 0.000 claims description 24
- 238000001962 electrophoresis Methods 0.000 claims description 20
- 239000011543 agarose gel Substances 0.000 claims description 14
- 230000003187 abdominal effect Effects 0.000 claims description 13
- IJGRMHOSHXDMSA-UHFFFAOYSA-N Atomic nitrogen Chemical compound N#N IJGRMHOSHXDMSA-UHFFFAOYSA-N 0.000 claims description 12
- 230000009545 invasion Effects 0.000 claims description 6
- 239000007788 liquid Substances 0.000 claims description 6
- 229910052757 nitrogen Inorganic materials 0.000 claims description 6
- 239000003153 chemical reaction reagent Substances 0.000 claims description 5
- 238000012360 testing method Methods 0.000 claims description 4
- 239000000047 product Substances 0.000 claims description 3
- 238000004458 analytical method Methods 0.000 claims 1
- 230000000694 effects Effects 0.000 abstract description 7
- 241000254171 Curculionidae Species 0.000 description 13
- 210000001519 tissue Anatomy 0.000 description 12
- 238000000227 grinding Methods 0.000 description 9
- 241000239290 Araneae Species 0.000 description 8
- 241000209094 Oryza Species 0.000 description 7
- 235000007164 Oryza sativa Nutrition 0.000 description 7
- 235000009566 rice Nutrition 0.000 description 7
- 239000002689 soil Substances 0.000 description 7
- 238000001514 detection method Methods 0.000 description 6
- 239000003550 marker Substances 0.000 description 6
- 241000196324 Embryophyta Species 0.000 description 5
- 241001465754 Metazoa Species 0.000 description 5
- 238000000246 agarose gel electrophoresis Methods 0.000 description 5
- 239000000499 gel Substances 0.000 description 5
- 108020004707 nucleic acids Proteins 0.000 description 5
- 102000039446 nucleic acids Human genes 0.000 description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 5
- 241000406668 Loxodonta cyclotis Species 0.000 description 4
- 241001556089 Nilaparvata lugens Species 0.000 description 4
- 239000002773 nucleotide Substances 0.000 description 4
- 125000003729 nucleotide group Chemical group 0.000 description 4
- 241000426497 Chilo suppressalis Species 0.000 description 3
- 229920002101 Chitin Polymers 0.000 description 3
- 241001060517 Dicranolaius bellulus Species 0.000 description 3
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 3
- 241000176086 Sogatella furcifera Species 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- 238000002791 soaking Methods 0.000 description 3
- 239000008223 sterile water Substances 0.000 description 3
- 238000005406 washing Methods 0.000 description 3
- 241000254173 Coleoptera Species 0.000 description 2
- 241000353522 Earias insulana Species 0.000 description 2
- 241001622642 Parnara bada Species 0.000 description 2
- 241000344244 Rhynchophorus Species 0.000 description 2
- 241001078693 Rhynchophorus ferrugineus Species 0.000 description 2
- 241000256251 Spodoptera frugiperda Species 0.000 description 2
- 241000985245 Spodoptera litura Species 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 238000012544 monitoring process Methods 0.000 description 2
- 239000013641 positive control Substances 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 241000887125 Chaptalia nutans Species 0.000 description 1
- 241001498622 Cixius wagneri Species 0.000 description 1
- 240000008301 Rhynchosia minima Species 0.000 description 1
- 241000931987 Sesamia Species 0.000 description 1
- 241000563489 Sesamia inferens Species 0.000 description 1
- 210000001015 abdomen Anatomy 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000002615 epidermis Anatomy 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 239000012535 impurity Substances 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 125000002496 methyl group Chemical group [H]C([H])([H])* 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 230000008186 parthenogenesis Effects 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/40—Monitoring or fighting invasive species
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting invading pest rice water weevil in the intestinal tract of natural enemy based on SCAR-PCR technology, relating to the technical field of agriculture. The primer group comprises SCAR primers LO-COI-F and LO-COI-R with the nucleotide sequences shown as SEQ ID No.1 and SEQ ID No.2 respectively. The primer group has higher specificity, only has a clear and single specific band aiming at the amplification of the rice weevil, has no amplification effect on other species, can effectively identify the larvae and adults of the rice weevil, and can be used for detecting and discriminating the rice weevil and the natural enemies of the rice weevil.
Description
Technical Field
The invention relates to the technical field of agriculture, in particular to a method for detecting invading pest rice weevils in the intestinal tract of natural enemies based on SCAR-PCR technology.
Background
The rice weevil (Lissorhoptrus oryzophilus Kuschel) belongs to Coleoptera (Coleoptera), and the weevil (Curculionidae) is native to north america, and is firstly discovered in the riverside of mississippi in 19 th century, parthenogenesis type rice weevil was discovered in the sakrayto watershed of california in 1959, and is firstly discovered in the down county of northriver in the last 70 th century, and is first discovered in china in the 1988 year in the down sea county of the northriver province. The rice weevil is a quarantine pest in China, mainly harms gramineous crops such as rice and the like, adults eat the upper epidermis and mesophyll of tender leaves, longitudinal specks are left on the leaves to influence the photosynthesis of the crops, and larvae eat the roots of the rice to cause root breaking, lodging and dwarfing of plants when the larvae eat the roots of the rice seriously.
The rice weevil lives in a soil layer with the depth of less than or equal to 3cm most of the time when wintering, and the monitoring difficulty of the overwintering place is higher. At present, the monitoring method comprises a soil inspection method, a hazard state identification method, an observation method and the like. The soil searching method has large workload, a soil layer with the depth of 5cm needs to be dug, soil is screened and then aired in the sun, and the digging difficulty of soil with high humidity and clustered weeds is high. The hazard shape identification method requires that an observer has the capability of accurately distinguishing food-taking traces of the rice weevil on different weeds and rice and removing similar food-taking traces, and the food-taking traces can be repaired or deformed by the plant after a period of time, so that the identification difficulty is increased. The observation method requires a certain professional knowledge of an observer to distinguish the difference between similar weevils and rice weevils, and the rice weevils have small shapes, false death and concealment (the rice weevils fall into soil due to slight shaking), and great observation difficulty.
Therefore, it is highly desirable to provide a convenient, fast and accurate method for identifying the weevil.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention provides a primer group for detecting the rice weevil, which has higher specificity, only has clear and single specific band aiming at the amplification of the rice weevil, has no amplification effect on other species, can effectively identify the larva and imago of the rice weevil, and can be used for detecting and discriminating the rice weevil and the natural enemy of the rice weevil.
In a first aspect of the invention, a primer set for detecting rice weevils is provided, which comprises SCAR primers LO-COI-F and LO-COI-R with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.
In a second aspect of the present invention, there is provided a reagent comprising the primer set according to the first aspect of the present invention.
In some embodiments of the invention, the nucleotide sequence of LO-COI-F is set forth in SEQ ID No. 1; the nucleotide sequence of LO-COI-R is shown in SEQ ID NO. 2.
In a third aspect of the invention, there is provided a use of the primer set according to the first aspect of the invention or the reagent according to the second aspect of the invention in the preparation of a product for detecting rice weevils.
In some embodiments of the invention, the product comprises a kit.
In a fourth aspect of the present invention, there is provided a method for detecting invasion of rice water weevils, comprising the steps of:
s1: extracting the genome DNA of a species sample to be detected;
s2: carrying out SCAR-PCR reaction on the genome DNA by using the SCAR primer pair LO-COI-F/R of claim 1 to obtain a reaction product 1;
s3: carrying out SCAR-PCR reaction on the reaction product 1 in the step S2 by using the SCAR primer pair LO-COI-F/R of claim 1 to obtain a reaction product 2;
s4: taking 5 mu L of the reaction product 2 in the step S3 to carry out electrophoresis in agarose gel, analyzing the electrophoresis result, and judging the invasion condition of the rice weevil;
the species to be detected is the natural enemy of the rice water weevil.
In some embodiments of the invention, in step S1, the genomic DNA of the species sample is extracted by a kit or CTAB extraction method.
In some embodiments of the invention, in the step S1, the sample of the species to be tested is abdominal tissue of the species to be tested or the whole of the species to be tested.
In some embodiments of the present invention, in step S1, the sample of the species to be tested is abdominal tissue of the species. The abdominal tissue is the abdomen of the species.
In some embodiments of the present invention, the method for pre-treating abdominal tissue comprises: the abdominal tissues were ground while kept in a liquid nitrogen environment until the internal tissues were completely detached from the chitin shell. Thereby, the genomic DNA in the sample is sufficiently released.
In some embodiments of the present invention, in the step S2, the reaction system of the scarr-PCR reaction is:
in some embodiments of the present invention, in the step S2, the amplification procedure of the scarr-PCR reaction is: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
In some embodiments of the present invention, in the step S3, the reaction system of the scarr-PCR reaction is:
in some embodiments of the present invention, in the step S3, the amplification procedure of the scarr-PCR reaction is: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
In some embodiments of the invention, the 2 × PCR mix is GenStar 2 × HiFiTaq PCR Starmix.
In some embodiments of the present invention, in the step S4, the concentration of the agarose gel in the agarose gel electrophoresis is 2%.
In some embodiments of the invention, in the step S4, the voltage of the electrophoresis is 100-120V.
In some embodiments of the present invention, in the step S4, the voltage of the electrophoresis is 105-115V.
In some embodiments of the invention, in the step S4, the voltage of the electrophoresis is 110V.
In some embodiments of the present invention, in the step S4, the electrophoresis time is 20-40 min.
In some embodiments of the present invention, in the step S4, the electrophoresis time is 25-35 min.
In some embodiments of the invention, in the step S4, the electrophoresis time is 30 min.
In some embodiments of the present invention, in step S4, the method for analyzing the electrophoresis result is: if the band with the size of about 246bp is displayed, judging that the rice weevil invades; if there is no band with a size of about 246bp, it is judged that there is no invasion of rice water weevil.
The invention has the beneficial effects that:
the invention provides a group of primer groups, which have strong specificity, only aim at the amplification of the rice weevil to obtain clear and single specific bands, have no amplification effect on other species, can effectively identify the larvae and imagoes of the rice weevil, and can be used for detecting and discriminating the rice weevil and the natural enemies of the rice weevil.
The invention also provides a method for detecting the invasion condition of the rice weevil, which has the advantages of simple method, high accuracy and high sensitivity, still has good detection effect when the concentration of the rice weevil methyl genome is as low as 1.031 ng/mu L, and greatly reduces the requirement on the professional knowledge of workers. And the residual DNA of the elephant rice beetles in the intestinal tracts of the natural enemies of the elephant rice beetles in the area is detected by the SCAR-PCR technology, so that whether the epidemic situation of the elephant rice beetles occurs in the area can be judged. In addition, the nutritional relationship between the rice weevil and the natural enemies of the rice weevil is qualitatively and quantitatively evaluated, so that the control effect of various natural enemies on the rice weevil is further defined, the ecological control effect of the natural enemies on the rice weevil can be enhanced, and the accuracy and effectiveness of the evaluation of epidemic prevention and control and yield increase work are improved.
Drawings
The invention is further described with reference to the following figures and examples, in which:
FIG. 1 shows the specificity verification result of LO-COI-F/R provided in the present invention (M is DNA Marker (Marker));
FIG. 2 shows the results of the detection of practical samples by LO-COI-F/R (M is DNA Marker (Marker), 1-16 refer to the genomic DNA of the abdominal tissues of No. 1-16 game spiders, respectively) provided in the present invention;
FIG. 3 shows the sensitivity test results of LO-COI-F/R provided by the present invention (M is DNA Marker (Marker), 1-5 refer to rice water genome DNA with concentrations of 103.114 ng/. mu.L, 51.557 ng/. mu.L, 10.311 ng/. mu.L, 5.156 ng/. mu.L and 1.031 ng/. mu.L, respectively).
Detailed Description
In order to make the technical solutions of the present invention more apparent to those skilled in the art, the following examples are given for illustration. It should be noted that the following examples are not intended to limit the scope of the claimed invention.
The reagents, methods and equipment used in the following examples are all conventional in the art. The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer.
Used in the following examples
The Marine Animal Genomic DNA Kit is provided by Beijing Quanji Biotechnology, Inc., the TS-Gelred nucleic acid gel dye is provided by Beijing Ongkoku Biotechnology, Inc., and the GenStar 2 × HiFiTaq PCR StarMix is provided by Beijing Cunking Chengchengyi Biotechnology, Inc.
Method for detecting rice water weevil
The embodiment provides a method for detecting rice weevils, which comprises the following steps:
(1) by using
And extracting the Genomic DNA of the sample to be detected by the Marine Animal Genomic DNA Kit, and carrying out the steps according to the instruction.
(2) SCAR-PCR reaction
1) First round SCAR-PCR reaction
And (2) carrying out SCAR-PCR reaction on the genome DNA obtained in the step (1) by using an SCAR primer LO-COI-F/R, and obtaining a reaction product after the reaction is finished.
The reaction system of the SCAR-PCR reaction is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
Wherein the nucleotide sequence of the LO-COI-F is as follows: 5'-TCTCTCATCGGAGATGACCA-3' (SEQ ID NO. 1);
the nucleotide sequence of LO-COI-R is as follows: 5'-TGTCCATCCTGTACCTACTCCT-3' (SEQ ID NO. 2);
the LO-COI-F/R amplified sequence (246bp) was: 5'-TCTCTCATCGGAGATGACCAAATTTATAATGTTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGTGGATTCGGAAATTGATTAATTCCTCTAATGTTAGGAGCACCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAACTCTTTTATTAATAAGAAGAATTGTAGAAAAAGGAGTAGGTACAGGATGGACA-3' (SEQ ID NO. 3).
2) Second round SCAR-PCR reaction
Taking the reaction product obtained in the step 1) as a template, carrying out SCAR-PCR reaction according to the following reaction system and amplification program, and obtaining the reaction product after the reaction is finished.
The reaction system of the SCAR-PCR reaction is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
(3) Taking 5 mu L of the reaction product in the step 2), carrying out 2% agarose gel electrophoresis at a constant pressure of 110V for 30 min. After electrophoresis, the agarose gel is soaked in the diluted TS-Gelred nucleic acid gel dye for 30 minutes, and the dyed agarose gel is placed under an ultraviolet lamp for observation.
The method for judging the electrophoresis result comprises the following steps: if the result shows that a single DNA band exists at about 246bp, the sample is judged to contain the Rhynchophorus oryzophilus; if there is no single DNA band at about 246bp, it is judged that the sample does not contain the Rhynchosia Volubilis.
Specificity verification of the method for detecting Rhynchophorus ferrugineus in the above examples
Soaking field captured weevil (RWWW), weevil Larva (Larva of RWW), weevil (RW), Sesamia inferens (PB), Chilo suppressalis (RSB), Sesamia formosana (SB), Rice Leaf Roller (RLR), Spodoptera Frugiperda (FAW), Spodoptera litura (AAW), rice skipper (RPS), Brown Planthopper (BPH) and white-backed planthopper (WBPH) samples in absolute ethyl alcohol, taking the samples back to a laboratory, separating the bodies of the single head worms, respectively washing the samples for 2 times by using sterile water to remove impurities on the surfaces of the samples, putting the samples into a 1.5mL centrifuge tube, adding liquid nitrogen, grinding the samples by using an electric grinding rod until the shells of chitin are completely broken and the internal tissues are completely separated from the shells, and then adopting a liquid nitrogen to grind the shells of the chitin until the shells are completely broken shells and the internal tissues are completely separated from the shells
The Genomic DNA was extracted from the Marine Animal Genomic DNA Kit, respectively, according to the instructions. The integrity of the extracted genomic DNA was checked with 1% agarose gel. The purity and concentration of the genome DNA are detected by a microplate reader and stored at-20 ℃ for later use.
The genomic DNAs of the above-extracted weevil (RWW), weevil larvae (Larva of RWW), weevil (RW), borer (PB), chilo suppressalis (RSB), rice Stem Borer (SB), Rice Leaf Roller (RLR), Spodoptera Frugiperda (FAW), Spodoptera litura (AAW), rice skipper (RPS), Brown Planthopper (BPH) and White Back Planthopper (WBPH) were used as detection targets, and SCAR-PCR was carried out according to the following reaction system and amplification procedure. The reaction system is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And after the reaction is finished, obtaining a reaction product 1.
The reaction product 1 was used as a template to carry out SCAR-PCR reaction according to the following reaction system and amplification procedure.
The reaction system of the SCAR-PCR reaction is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And obtaining a reaction product 2 after the reaction is finished.
mu.L of the reaction product 2 was subjected to 2% agarose gel electrophoresis at a constant pressure of 110V for 30 min. After electrophoresis, the agarose gel is soaked in the diluted TS-Gelred nucleic acid gel dye for 30 minutes, and the dyed agarose gel is placed under an ultraviolet lamp for observation.
The electrophoresis results are shown in FIG. 1.
As can be seen from FIG. 1, only the genomic DNAs of RWW and Larva of RWW were specifically amplified, and the lanes corresponding thereto had a clear, single specific band at about 246 bp. This indicates that the primers LO-COI-F/R provided in the above examples have very high specificity for rice weevils.
Actual detection effects of the method for detecting rice water weevil in the above-described embodiment
Soaking field collected 16 hunting spiders (labeled as: 1, 2, 3.. 16) and rice weevil (RWW) samples in absolute ethanol, taking back to the laboratory, separating monocephalus, washing with sterile water for 2 times, dissecting 16 hunting spiders with forceps, taking out abdominal tissues, placing into 1.5mL centrifuge tube, adding liquid nitrogen, and grinding with electric grinding rodAnd (6) grinding. By using
The Marine Animal Genomic DNA Kit extracts the abdominal tissues of the hunting spider and the Genomic DNA of the Rhynchophorus oryzophilus respectively, and the steps are carried out according to the instruction. The integrity of the extracted genomic DNA was checked with 1% agarose gel. The purity and concentration of the genome DNA are detected by a microplate reader and stored at-20 ℃ for later use.
Wherein, the rice weevil (RWW) is a positive control group.
The abdominal tissues of the 1-16 Hunting spider and genomic DNA of Rhynchus oryzophilus (RWW) obtained by the above extraction were subjected to SCAR-PCR according to the following reaction system and amplification procedure. The reaction system is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And after the reaction is finished, obtaining a reaction product 1.
The reaction product 1 was used as a template to carry out SCAR-PCR reaction according to the following reaction system and amplification procedure.
The reaction system of the SCAR-PCR reaction is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And obtaining a reaction product 2 after the reaction is finished.
mu.L of the reaction product 2 was subjected to 2% agarose gel electrophoresis at a constant pressure of 110V for 30 min. After electrophoresis, the agarose gel is soaked in the diluted TS-Gelred nucleic acid gel dye for 30 minutes, and the dyed agarose gel is placed under an ultraviolet lamp for observation.
The electrophoresis results are shown in FIG. 2.
As is clear from FIG. 2, the genomic DNA of the game spider No. 14 was specifically amplified, and the corresponding lane had a clear, single specific band at about 246bp, which was the same as that of the positive control group. This indicates that the hunting spiders are natural enemies of the weevil, and the 14 # hunting spiders have eaten the weevil, and the epidemic situation of the weevil occurs in this area.
Sensitivity detection of the method for detecting a rice weevil in the above-described examples
Soaking field collected Rhynchophorus ferrugineus (RWW) sample in anhydrous ethanol, taking back to laboratory, separating monocephalus molesta Boone, respectively washing with sterile water for 2 times, placing into 1.5mL centrifuge tube, adding liquid nitrogen, grinding with electric grinding rod, and grinding with electric grinding rod
The Genomic DNA was extracted from the Marine Animal Genomic DNA Kit, respectively, according to the instructions. The integrity of the extracted genomic DNA was checked with 1% agarose gel. The purity and concentration of the genome DNA are detected by a microplate reader and stored at-20 ℃ for later use.
The above-mentioned rice water was diluted to concentrations of 103.114 ng/. mu.L, 51.557 ng/. mu.L, 10.311 ng/. mu.L, 5.156 ng/. mu.L and 1.031 ng/. mu.L like methylgenic DNA. . The diluted genome DNA of the elephant rice was used as a detection target, and the SCAR-PCR reaction was carried out according to the following reaction system and amplification procedure. The reaction system is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And after the reaction is finished, obtaining a reaction product 1.
The reaction product 1 was used as a template to carry out SCAR-PCR reaction according to the following reaction system and amplification procedure.
The reaction system of the SCAR-PCR reaction is as follows:
the amplification procedure was: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
And obtaining a reaction product 2 after the reaction is finished.
mu.L of the reaction product 2 was subjected to 2% agarose gel electrophoresis at a constant pressure of 110V for 30 min. After electrophoresis, the agarose gel is soaked in the diluted TS-Gelred nucleic acid gel dye for 30 minutes, and the dyed agarose gel is placed under an ultraviolet lamp for observation.
The electrophoresis results are shown in FIG. 3.
As can be seen from FIG. 3, the samples with concentrations of 103.114 ng/. mu.L, 51.557 ng/. mu.L, 10.311 ng/. mu.L, 5.156 ng/. mu.L and 1.031 ng/. mu.L all undergo specific amplification reactions, and the corresponding lanes have a single specific band at about 246bp, which indicates that the extracted genomic DNA can still be detected by the method provided in this example even if only 1.031 ng/. mu.L of the genomic DNA of rice weevil is contained therein, as long as the rice weevil is not completely digested after being ingested by natural enemies.
The embodiments of the present invention have been described in detail with reference to the accompanying drawings, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.
Sequence listing
<110> institute for plant protection of academy of agricultural sciences of Guangdong province
<120> a method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tctctcatcg gagatgacca 20
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tgtccatcct gtacctactc ct 22
<210> 3
<211> 246
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tctctcatcg gagatgacca aatttataat gttattgtta cagcccatgc ttttattata 60
atttttttta tagtaatacc cattataatt ggtggattcg gaaattgatt aattcctcta 120
atgttaggag cacctgatat agcttttcca cgtataaata atataagatt ttgactttta 180
cccccctctt taactctttt attaataaga agaattgtag aaaaaggagt aggtacagga 240
tggaca 246
Claims (10)
1. A primer group for detecting rice weevil is characterized by comprising SCAR primers LO-COI-F and LO-COI-R with nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2 respectively.
2. A reagent comprising the primer set according to claim 1.
3. Use of the primer set according to claim 1 or the reagent according to claim 2 for producing a product for detecting rice weevils.
4. A method for detecting the invasion condition of rice weevils is characterized by comprising the following steps:
s1: extracting the genome DNA of a species sample to be detected;
s2: carrying out SCAR-PCR reaction on the genome DNA by using the SCAR primer pair LO-COI-F/R of claim 1 to obtain a reaction product 1;
s3: carrying out SCAR-PCR reaction on the reaction product 1 in the step S2 by using the SCAR primer pair LO-COI-F/R of claim 1 to obtain a reaction product 2;
s4: taking 5 mu L of the reaction product 2 in the step S3 to carry out electrophoresis in agarose gel, analyzing the electrophoresis result, and judging the invasion condition of the rice weevil;
the species to be detected is the natural enemy of the rice water weevil.
5. The method according to claim 4, wherein in step S1, the test species sample is abdominal tissue of the test species or the whole test species; preferably abdominal tissue of the species.
6. The method of claim 5, wherein the pretreatment of the abdominal tissue comprises: the abdominal tissue was ground while being kept in a liquid nitrogen environment.
7. The method according to claim 4, wherein in step S2, the reaction system of the SCAR-PCR reaction is:
8. the method according to claim 4, wherein in step S2, the amplification procedure of the SCAR-PCR reaction is: 5min at 94 ℃; 30 cycles of 94 ℃ for 30s, 60 ℃ for 30s, and 72 ℃ for 30 s; 5min at 72 ℃.
9. The method according to claim 4, wherein in step S3, the reaction system of the SCAR-PCR reaction is:
10. the method according to claim 4, wherein in step S4, the analysis method of the electrophoresis result is: if the band with the size of about 246bp is displayed, judging that the rice weevil invades; if there is no band with the size of about 246bp, the rice weevil is judged not to invade.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210237597.6A CN114717327A (en) | 2022-03-10 | 2022-03-10 | Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210237597.6A CN114717327A (en) | 2022-03-10 | 2022-03-10 | Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114717327A true CN114717327A (en) | 2022-07-08 |
Family
ID=82236830
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210237597.6A Pending CN114717327A (en) | 2022-03-10 | 2022-03-10 | Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114717327A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117327808A (en) * | 2023-12-01 | 2024-01-02 | 浙江大学海南研究院 | Specific primer group for amplifying rice water weevil mitochondrion COI gene sequence and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105079308A (en) * | 2015-09-16 | 2015-11-25 | 张利文 | Common rockvine herb extract as well as preparation method and pharmaceutical application of extract |
| CN110343769A (en) * | 2019-07-11 | 2019-10-18 | 山东省花生研究所 | A kind of COI primer and its application for peanut aphid PCR detection |
| CN113073141A (en) * | 2021-05-20 | 2021-07-06 | 山西省植物保护植物检疫总站 | Specific primer pair for identifying rice weevil and application thereof |
-
2022
- 2022-03-10 CN CN202210237597.6A patent/CN114717327A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105079308A (en) * | 2015-09-16 | 2015-11-25 | 张利文 | Common rockvine herb extract as well as preparation method and pharmaceutical application of extract |
| CN110343769A (en) * | 2019-07-11 | 2019-10-18 | 山东省花生研究所 | A kind of COI primer and its application for peanut aphid PCR detection |
| CN113073141A (en) * | 2021-05-20 | 2021-07-06 | 山西省植物保护植物检疫总站 | Specific primer pair for identifying rice weevil and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| I. A. GIANTSIS: "The distribution of the invasive pest, rice water weevil Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), is expanding in Europe: First record in the Balkans, confirmed by CO1 DNA barcoding", 《PHYTOPARASITICA》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117327808A (en) * | 2023-12-01 | 2024-01-02 | 浙江大学海南研究院 | Specific primer group for amplifying rice water weevil mitochondrion COI gene sequence and application thereof |
| CN117327808B (en) * | 2023-12-01 | 2024-03-08 | 浙江大学海南研究院 | Specific primer group for amplifying rice water weevil mitochondrion COI gene sequence and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2017137790A (en) | MAISA DBN9936 PLANT AND METHOD OF APPLICATION IN DETECTING ITS NUCLEIC ACID SEQUENCE | |
| CN110951838A (en) | Primer, probe, kit and application for detecting meloidogyne hapla based on RPA-LFD technology | |
| CN109280715B (en) | LAMP primer group for detecting peanut black rot, and rapid detection method and kit thereof | |
| CN114717327A (en) | Method for detecting invading pest rice weevil in natural enemy intestinal tract based on SCAR-PCR technology | |
| CN106755342A (en) | Based on the ring mediated isothermal amplification that color judges（LAMP）Technology for detection chestnut phytophthora Heisui River germ | |
| Sabahi et al. | A simple and rapid molecular method for simultaneous identification of four economically important thrips species | |
| CN109825604B (en) | Molecular marker closely linked with peach aphid resistance character, primer, kit and method for detecting peach aphid resistance character and application of primer, kit and method | |
| CN114717328B (en) | Method for detecting feeding habits of oryzophilus davidianus in intestinal tracts of oryzophilus davidianus based on SCAR-PCR technology | |
| CN107904315B (en) | Rusty palm weevil specific primer and rapid molecular detection method | |
| CN104498593B (en) | Identify or auxiliary identify storage bean weevil primer to and test kit | |
| Dai et al. | Rapid detection of the pine wood nematode Bursaphelenchus xylophilus using recombinase polymerase amplification combined with CRISPR/Cas12a | |
| CN111621574B (en) | Primer for identifying sex of ostrich animals, sex identification method and kit | |
| CN104673890B (en) | Cotton black aphid PCR quick determination methods based on specific SS COI primers | |
| Maghrebi et al. | First report of Leptosphaeria maculans and Leptosphaeria biglobosa causing blackleg disease of oilseed rape in Tunisia | |
| CN111500747A (en) | Primer and probe combination for detecting citrus semi-piercing nematodes and application thereof | |
| CN105296482A (en) | Method for authenticating national examination and approval variety of oat for feeding and special primer group thereof | |
| CN106868134B (en) | Real-time quantitative PCR detection method for spores/gametes of ulva aquatica, ulva scleoides and hemerocallis fulva in sea cucumber culture water | |
| Khan et al. | Phylogenetic analysis of red cotton bug species (hemiptera: pyrrhocoridae) in Punjab, Pakistan | |
| Gnanesh et al. | Molecular Diagnostics of Soil-Borne and Foliar Diseases of Mulberry: Present Trends and Future Perspective | |
| Pancaningtyas et al. | DNA Barcoding for Identification of Helopeltis sp. from Kaliwining Experimental Station using Mitochondrial COI Gene | |
| RU2022104321A (en) | NUCLEIC ACID SEQUENCE FOR DETECTING SOYBEAN PLANT DBN8002 AND METHOD FOR ITS DETECTION | |
| Arminudin et al. | Ultrastructure characters and partial mtDNA-COI haplotypes of Asian corn borer, Ostrinia furnacalis (Guenée)(Lepidoptera: Crambidae) from Indonesia | |
| Tayat et al. | Research on the morphological and molecular diagnosis of Hyalopterus pruni (Geoffroy) | |
| CN111961735B (en) | Specific primer pair, kit and method for rapidly identifying fruit fly | |
| CN107723380A (en) | A kind of stem rot of sweet potato bacterium LAMP detection primer and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20220708 |