CN114717255A - Method for improving and cultivating eggplant by RNAi - Google Patents
Method for improving and cultivating eggplant by RNAi Download PDFInfo
- Publication number
- CN114717255A CN114717255A CN202111022223.4A CN202111022223A CN114717255A CN 114717255 A CN114717255 A CN 114717255A CN 202111022223 A CN202111022223 A CN 202111022223A CN 114717255 A CN114717255 A CN 114717255A
- Authority
- CN
- China
- Prior art keywords
- smhqt
- gene
- seq
- eggplant
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Nutrition Science (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a core fragment of a cultivated eggplant SmHQT gene, an RNAi expression vector containing the core fragment, and construction and application of the RNAi expression vector, wherein the core fragment of the cultivated eggplant SmHQT gene is shown as SEQ ID No. 3. The invention cultures the cultivated eggplant variety with reduced chlorogenic acid synthesis by silencing SmHQT gene, thereby achieving the purpose of reducing browning of the pulp of the cultivated eggplant, and the new cultivated eggplant variety has good market prospect and economic value.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and relates to a cultivated eggplant SmHQT gene, an RNAi vector constructed by using the gene and application thereof, and a construction method of the RNAi vector.
Background
The cultivated eggplant (SolanummelongenaL) plays an important role in the vegetable market in China, the color and the nutrient content of the fruit are key factors determining the commodity value of the cultivated eggplant as a vegetable with outstanding economic benefit, while the chlorogenic acid enriched and synthesized in the pulp is oxidized into quinone substances when meeting oxygen to be a key factor causing the pulp browning, and the factors seriously hinder the improvement and the later processing of the nutritional quality of the cultivated eggplant.
As an important phenylpropanoid substance in solanaceae plants, chlorogenic acid is widely accumulated in the plants, and the content of the chlorogenic acid in fruits is the highest (the content of the chlorogenic acid can account for 70% -90% of the polyphenol content of the fruits). Chlorogenic acid is very easily oxidized to become brown quinone substances when exposed to air, so that browning is caused. The brown substance seriously affects the commodity value and later processing of the cultivated eggplant. Therefore, the excessive content of chlorogenic acid in the pulp is an important factor influencing the quality improvement of the cultivated eggplant.
Chlorogenic acid is synthesized from phenylalanine through a series of enzymatic reactions in cytoplasm, but the synthesis route is very numerous and complicated, and key enzymes for controlling synthesis of chlorogenic acid of eggplants are not clear in the prior art.
Disclosure of Invention
In view of the above, one of the purposes of the invention is to provide a core fragment of the cultivated eggplant SmHQT gene, and the nucleotide sequence is shown as SEQ ID No. 3.
The other purpose of the present invention is to provide a recombinant vector containing a SmHQT gene core fragment, such as an RNAi expression vector for the SmHQT gene core fragment.
The RNAi expression vector can be constructed by using a pBin19 vector as a skeleton vector and inserting a CaMV35S promoter, a reverse sequence of a core fragment of a cultivated eggplant SmHQT gene, a PDK intron, a reverse sequence of the core fragment of the cultivated eggplant SmHQT gene and an Nos terminator expression cassette which are sequentially connected at a polyclonal enzyme cutting site.
It is still another object of the present invention to provide a microbial transformant containing the RNAi expression vector, which can be transformed with agrobacterium as a receptor. The agrobacterium may be LBA 4404.
The fourth purpose of the invention is to provide the cultivated eggplant SmHQT gene core fragment, the RNAi expression vector thereof or the microbial transformant, which is used for at least one of the following purposes:
1) reducing the expression level of SmHQT gene in the cultivated eggplant;
2) reducing the synthetic amount of chlorogenic acid in the cultivated eggplant;
3) reducing the browning degree and/or the browning speed of the cultivated eggplant pulp in an aerobic environment.
Alternatively, the present invention provides a method for cultivating cultivated eggplant having a low SmHQT gene expression level, a low chlorogenic acid synthesis level, and/or a low browning level of pulp in an aerobic environment, comprising using said cultivated eggplant SmHQT gene core fragment, an RNAi expression vector thereof, or said microbial transformant.
The reduction in the expression level or the amount of synthesis may be expressed in at least one of young leaves, mature leaves and fruits of cultivated eggplant.
The fifth object of the present invention is to provide a method for preparing the RNAi expression vector, comprising the steps of:
a. using a recombinant plasmid containing SEQ ID No.3 as a template, using SEQ ID No.2 and SEQ ID No.1 as primers to carry out PCR amplification, purifying an amplification product, carrying out double enzyme digestion by HindIII and Xba I, and connecting with a pHBLD vector subjected to the same double enzyme digestion to obtain a recombinant plasmid pHBLD-SmHQT;
b. performing PCR amplification according to the method of the step a or directly using the PCR amplification product obtained in the step a, purifying the amplification product, performing double enzyme digestion by Kpn I and Xho I, and connecting the product with the recombinant plasmid pHBLD-SmHQT subjected to the same double enzyme digestion to obtain the recombinant plasmid pHBLD-SmHQT;
c. and c, carrying out double enzyme digestion on the recombinant plasmid pHBLD-SmHQTi obtained in the step b by using Sac I and Spe I, and then connecting the recombinant plasmid pHBLD-SmHQTi with a pBin19 vector subjected to double enzyme digestion by using Sac I and Xba I to obtain an RNAi expression vector.
The sixth purpose of the invention is to provide a preparation method of the recombinant plasmid containing the SEQ ID No.3, which comprises the following steps: using cDNA containing the gene sequence (such as the sequence with GenBank number KT259042.1) of cultivated eggplant SmHQT (such as the cDNA of cultivated eggplant) as a template (for example, extracting the total RNA of the mature leaves of the cultivated eggplant, carrying out reverse transcription to obtain cDNA, using the obtained cDNA as the template), using SEQ ID No.2 and SEQ ID No.1 as primers to carry out amplification, and connecting the amplified product with a pMD-19 vector to obtain the recombinant plasmid containing SEQ ID No. 3.
For the purposes of any of the foregoing inventions, the cultivars Solanum melongena may be Solanum melongena var.
The invention has the beneficial effects that: the invention develops a new method, and finally, the invention obtains the core fragment of the cultivated eggplant SmHQT gene for constructing the RNAi vector for silencing the cultivated eggplant SmHQT gene through a large number of complicated trial and error and screening, the RNAi vector is transferred into the cultivated eggplant, the expression of the SmHQT gene in the obtained positive transgenic cultivated eggplant plant is obviously reduced compared with that of a non-transgenic plant, the content of chlorogenic acid in each tissue of the plant is reduced, the browning degree of the cultivated eggplant is obviously reduced, and the invention is very difficult to predict for technical personnel in the field of higher plant genetic engineering.
Drawings
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings, in which:
FIG. 1 is the agarose gel electrophoresis analysis of core fragment of the amplified product of cultivated eggplant SmHQT gene, wherein 437bp of the agarose gel electrophoresis analysis indicates the core fragment of the cultivated eggplant SmHQT gene, and M indicates the DNA molecular weight standard (Marker).
FIG. 2 is a schematic diagram of the construction of the recombinant plasmid pHBLD-SmHQT.
FIG. 3 is a schematic diagram of the construction of the recombinant plasmid pHBLD-SmHQTi.
FIG. 4 is a schematic diagram of the construction of recombinant plasmid pBin 19-SmHQTi.
FIG. 5 shows the identification of the silencing effect of SmHQT gene in transgenic cultivated eggplant positive plants (WT is non-transgenic cultivated eggplant, RNAi No. 24,36 and 66 are different transgenic cultivated eggplant positive lines).
FIG. 6 shows the content analysis of chlorogenic acid in wild type and transgenic eggplant, WT is non-transgenic eggplant, 24,36 and 66 are different positive lines of transgenic eggplant, YL (young leaf) refers to young leaf, ML (mature leaf) refers to mature leaf, FR (fruit) refers to fruit, and the test results of each group are listed in the order of WT, 24,36 and 66 on the horizontal axis.
FIG. 7 is the browning degree analysis of the fruit flesh of wild type and transgenic cultivated solanaceous melons.
Detailed Description
The present invention will be described in detail below with reference to the accompanying drawings. The experimental procedures, for which specific conditions are not specified, are generally carried out according to conventional conditions or according to conditions recommended by the manufacturers.
The cultivar Solanum melongena used in the examples of the present invention is "Solanum melongena l.cv.sanyueqie". The pMD19-T vector is a product of TaKaRa company, and pHBLD vector, pBin19 vector, Escherichia coli DH5 alpha, Escherichia coli 'helper' bacterium (shortly, helper) containing motile plasmid pRK2013 and Agrobacterium tumefaciens LBA4404 are materials commonly used in the field; RNA extraction kit, restriction enzyme, PremixTaqTM(TaKaRaTaqTMVersion 2.0)、
Max DNA Polymerase is all products of TaKaRa company.
Cloning of core fragment of cultivated eggplant SmHQT gene
According to the SmHQT gene sequence (KT259042.1), specific primers SmHQT-F and SmHQT-R for amplifying and cultivating the SmHQT gene core fragment plus enzyme cutting sites are designed, and the specific sequences are as follows:
SmHQT-F:TGCACTCGAGTCTAGATTGGAACTTAGGAAACTTATTC(SEQ ID No.1)，SmHQT-R:CTGAGGTACCAAGCTTCAACGCCAGATGTGGG(SEQ ID No.2)，
extracting total RNA of mature eggplant leaves, carrying out reverse transcription to obtain cDNA, carrying out PCR amplification on core fragments of the SmHQT gene of the cultured eggplant by taking the cDNA as a template and the SmHQT-F and SmHQT-R as primers, wherein the PCR reaction system is as follows: ddH2O7. mu.L, 100. mu.M upstream and downstream primers 1.0. mu. L, cDNA template 1.0. mu.L, Taq mix 10. mu.L, 10. mu.L total. The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; then denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 35 cycles; final extension at 72 ℃ for 10 min. The obtained PCR amplification product is identified by agarose gel electrophoresis, then the amplification band is recovered and purified by a purification kit, the purified cultivated eggplant SmHQT gene core fragment is connected with a pMD19-T vector to obtain a recombinant plasmid pMD19-T-SmHQT, the 437bp cultivated eggplant SmHQT gene core fragment (SEQ ID No.3) is used, and the electrophoretic identification is shown in figure 1.
Second, constructing RNAi expression vector containing cultivated eggplant SmHQT gene
The PCR amplification is carried out by taking SmHQT as a template and SmHQT-F and SmHQT-R as primers, wherein the PCR reaction system is as follows: 18 mu L of ddH2O 18,
Max DNA Polymerase 10 uL, upstream and downstream primers 0.5 uL, plasmid template 1.0 uL, total 20 uL, PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min, followed by denaturation at 94 ℃ for 30 sec, annealing at 60 ℃ for 30 sec, and extension at 72 ℃ for 1 min for 40 cycles; final extension at 72 ℃ for 10 min. The amplified PCR product is SmHQT gene core fragment with Kpn I/HindIII and Xho I/Xba I enzyme cutting sites on two sides; purifying, performing double enzyme digestion with HindIII and Xba I, and connecting with pHBLD vector subjected to the same double enzyme digestion under the action of T4 DNA ligase to obtain recombinant plasmid pHBLD-SmHQT, wherein the structure diagram of the recombinant plasmid is shown in FIG. 2; in addition, the above-mentionedThe purified PCR product was double-digested with Kpn I and Xho I, and then ligated with the recombinant plasmid pHBLD-SmHQT double-digested with the same DNA ligase under the action of T4 to obtain the recombinant plasmid pHBLD-SmHQT, the structure diagram of which is shown in FIG. 3. As can be seen from FIG. 3, the core fragment of the SmHQT gene in pHBLD-SmHQT was inserted into the pHBLD vector in the forward and reverse directions on both sides of the PDK intron. Finally, the recombinant plasmid pHBLD-SmHQTi is subjected to double enzyme digestion by Spe I and Sac I, and then is connected with the plant expression vector pBin19 subjected to double enzyme digestion by Xba I and Sac I under the action of T4 DNA ligase to obtain the recombinant plasmid pBin19-SmHQTi, which is shown in figure 4. The recombinant plasmid pBin19-SmHQT is an RNAi vector of the cultivated eggplant SmHQT gene, which contains an hpRNA expression cassette, namely a CaMV35S promoter, a forward reverse fragment of a SmHQT gene core fragment (SEQ ID No.3), a DET intron, a reverse fragment of the SmHQT gene core fragment (SEQ ID No.3) and a Nos terminator which are connected in sequence and are named as pBin 19-HQT.
Fourth, RNAi expression vector transformation agrobacterium containing cultivated eggplant SmHQT gene
By combining the transfer technology with the help of Escherichia coli Helper, a silent vector pBin19 is transferred into an Agrobacterium LBA4404 strain by SmHQTi, and the specific experimental steps are as follows:
(1) the agrobacterium LBA4404 strain is streaked on a YEB solid culture medium containing 50mg/L rifampicin and 500mg/L streptomycin sulfate, the strain is placed into a biochemical incubator in an inverted mode, and the strain is cultured for 2-3 days under the dark condition at the temperature of 28 ℃ until a single colony grows on the YEB solid culture medium.
(2) Escherichia coli Helper strain, and Escherichia coli DH 5. alpha. strain containing pBin19-SmHQTi plasmid were streaked on LB solid medium containing 50mg/L kanamycin, respectively. The culture was carried out in a biochemical incubator at 37 ℃ for 16 hours.
(3) Selecting a circle with the size of a coin on an LB solid culture medium, marking the circle with a marking pen, selecting single colonies on the bacterial plates of the 3 bacteria, uniformly coating the single colonies in the circle, and culturing for 24 hours in a biochemical incubator at 28 ℃ in the dark.
(4) The colonies co-cultured in the above circles were picked, streaked on YEB solid medium containing 50mg/L rifampicin, 500mg/L streptomycin sulfate, and 50mg/L kanamycin, and placed upside down in a biochemical incubator, and cultured in the dark at 28 ℃ for 2 to 3 days.
(5) Picking single colony on the YEB solid culture medium, adding the picked single colony into the YEB solid culture medium containing 50mg/L rifampicin, 500mg/L streptomycin sulfate and 50mg/L kanamycin, performing shake culture at 28 ℃ in the dark and 200rpm for 2.5 days, extracting plasmids, and performing enzyme digestion verification.
Fifthly, the agrobacterium-mediated RNAi expression vector containing the SmHQT gene of the cultivated eggplant transforms the cultivated eggplant
Preparation of agrobacterium liquid
The agrobacterium strain containing pBin19-SmHQTi plasmid is streaked on YEB solid culture medium containing 50mg/L rifampicin, 500mg/L streptomycin sulfate and 50mg/L kanamycin, and the streaked strain is placed into a biochemical incubator in an inverted mode and cultured for 2-3 days at 28 ℃ in the dark until a single colony grows out. Single colonies were picked and inoculated into 30mL YEB liquid medium containing 50mg/L rifampicin, 500mg/L streptomycin sulfate, and 50mg/L kanamycin, and shake-cultured at 28 ℃ in the dark at 200rpm for 36 h. 10ml of the above-mentioned culture broth was pipetted into 100ml of YEB liquid medium containing 50mg/L rifampicin, 500mg/L streptomycin sulfate and 50mg/L kanamycin, and shake-cultured at 28 ℃ in the dark at 200rpm for 1.5 days until OD600 became 1.8-2.0.
② obtaining explant of cultivated eggplant
Soaking the cultured eggplant seed in sterile ultrapure water for half an hour, washing with sterile ultrapure water for 3 times, soaking the cultured eggplant seed in 75% alcohol for 1 minute, and washing with sterile ultrapure water for 3 times. Then soaking the cultivated eggplant seeds in sodium hypochlorite with 1% of available chlorine for 15 minutes (shaking by hands all the time), washing with sterile ultrapure water for 5 times, pouring the seeds into sterilized ultrapure water, putting into a refrigerator with 4 ℃ for 24 hours, putting into a refrigerator with 28 ℃, shaking and cultivating for 4-5 days at 200rpm until the cultivated eggplant is exposed, sowing the exposed cultivated eggplant seeds on a solid MS culture medium, and cultivating in a light incubator under the conditions of 28 ℃ (16 hours light) in the daytime and 18 ℃ (8 hours dark) at night until two cotyledons of the cultivated eggplant are flattened; cotyledons were cut and the cotyledon tips were cut off, leaving each cotyledon with two wounds. Soaking the cotyledon in liquid MS culture medium containing 0.2 mg/L2, 4-D and 0.1mg/L KT hormone for one hour, spreading the soaked cotyledon with wound facing downwards on solid MS culture medium containing 1mg/L IAA and 1.75mg/L ZT hormone, and pre-culturing for 24 hours under weak light condition.
③ obtaining explants for eggplant dip-dyeing cultivation and transgenic seedlings by agrobacterium tumefaciens
And (3) centrifuging the obtained agrobacterium liquid at 6000rpm at room temperature for 8 minutes, pouring out supernatant, and resuspending agrobacterium thalli at the bottom of a centrifugal tube by using YEB liquid culture medium. Centrifuging the resuspended bacteria liquid at 6000rpm at room temperature for 8 minutes, pouring out the supernatant, and resuspending the agrobacterium at the bottom of the centrifuge tube by using a 100Ml MS salt culture medium; pouring the resuspended thallus into a culture dish, placing the precultured eggplant cotyledons into the agrobacterium liquid in the culture dish, soaking for 10 minutes, sucking the liquid on the cultured eggplant cotyledons with filter paper, then placing the eggplant cotyledons with the wound surface of the cotyledons facing upwards on the original MS solid culture medium, culturing for 48 hours under the conditions of 28 ℃ (16 hours) in the daytime and 18 ℃ (8 hours) in the nighttime, inserting the cotyledons into the solid MS culture medium containing 2mg/L zeatin, 150mg/L kanamycin and 500mg/L carbenicillin, culturing in a light culture box under the conditions of 28 ℃ (16 hours) in the daytime and 18 ℃ (8 hours in the nighttime until callus grows out, then cutting the callus into small blocks, inserting the small blocks into the solid MS culture medium containing 2mg/L zeatin, 100mg/L kanamycin and 300mg/L carbenicillin, culturing in an illumination incubator with conditions of 28 ℃ in the day (16 hours of illumination) and 18 ℃ in the night (8 hours of darkness) until shoots grow, cutting off shoots containing buds, inserting the shoots into a solid MS medium containing 50mg/L kanamycin and 200mg/L carbenicillin, and culturing in an illumination incubator with conditions of 28 ℃ in the day (16 hours of illumination) and 18 ℃ in the night (8 hours of darkness) until roots grow. Sixth, screening of transgenic cultivated eggplant positive plants
qPCR detection of expression of SmHQT gene in transgenic cultivated eggplant plant
According to the gene sequence of the cultivated eggplant SmHQT and the reference gene sequence of the cultivated eggplant, the following primers are designed:
qSmHQT-F：CGGCTACACCAATGGCTACATC(SEQ ID No.4)
qSmHQT-R：CGAATCAGGGTTGATAGGTCAGG(SEQ ID No.5)
qSmCAC-F：CCTGATCTGAAGTTGGGCTTAAATG(SEQ ID No.6)
qSmCAC-R：TGGTGGAAAGTAACATCATCGAGC(SEQ ID No.7)
respectively picking up wild type cultivated eggplant mature leaves and transgenic cultivated eggplant mature leaves, extracting total RNA of the mature leaves, reversely transcribing the total RNA into cDNA, taking the obtained cDNA as a template, respectively taking qSmHQT-F, qSmHQT-R, qSmCAC-F and qSmCAC-R as primers to perform qPCR, and detecting the expression level of the SmHQT gene in the cultivated eggplant mature leaves. False positive plants are excluded, the result is shown in figure 5, and the gene silencing efficiency is higher when the eggplant positive strains are cultivated by transgenosis.
Seventhly, phenotype analysis of transgenic cultivated eggplant positive plants
The cultured eggplant lines and wild lines with higher silencing efficiency are planted in soil for culture, chlorogenic acid in young leaves, mature leaves and fruits of the cultured eggplant is respectively extracted by 50% methanol, and the content of chlorogenic acid in each tissue is analyzed by high performance liquid chromatography, and the result is shown in figure 6. The flesh was cut into small pieces and exposed to air for 2 hours, and the flesh browning was as shown in fig. 7 (representative results of 5 or more replicate samples are shown, 2 on the left side being wild type cultivated eggplant samples, 2 on the right side being transgenic samples).
The results show that the content of chlorogenic acid in each tissue of the transgenic cultivated eggplant is generally reduced, the browning degree of the cultivated eggplant fruits is weakened, and the aim of reducing the browning of the cultivated eggplant fruits is successfully fulfilled.
<110> Zhengzhou university
<120> RNAi method for improving cultivated eggplant
<160>7
<210>1
<211>38
<212> DNA
<213> Artificial sequence
<220>
<223> primer SmHQT-F
<400>1
tgcactcgagtctagattggaacttaggaaacttattc 38
<210>2
<211>32
<212> DNA
<213> Artificial sequence
<220>
<223> primer SmHQT-R
<400>2
ctgaggtaccaagcttcaacgccagatgtggg 32
<210>3
<211>437
<212> DNA
<213> cultivation of eggplant (Solanum Melongena L. cv. Sanyueqie)
<220>
<223> cultivation of eggplant SmHQT Gene core fragment
<400>3
ttccacacgttatctgatggtctttcatccatccactttatcaacacgtggtcggacatc 180
actcgtggcctatccgtcgcgatcccaccattcatcgatcggaccctccttcgtgcacgg 240
gacccgccaacgccttcttttgagcatgtcgagtatcatcctccacctaccctcaactca 300
tcgaaaaaccatgagtccacgggcccaaagcccaataccacggccatgttgaaattctcg 360
actgaacaactcgcgcttcttaagtccaagtacgagggtagcacttatgaaatccttgcg 420
gcccacatctggcgttg 437
<210>4
<211>22
<212> DNA
<213> Artificial sequence
<220>
<223> primer qSmHQT-F
<400>4
cggctacaccaatggctacatc 22
<210>5
<211>23
<212> DNA
<213> Artificial sequence
<220>
<223> primer qSmHQT-R
<400>5
cgaatcagggttgataggtcagg 23
<210>6
<211>25
<212> DNA
<213> Artificial sequence
<220>
<223> primer qSmCAC-F
<400>6
cctgatctgaagttgggcttaaatg 25
<210>7
<211>24
<212> DNA
<213> Artificial sequence
<220>
<223> primer qSmCAC-R
<400>7
tggtggaaagtaacatcatcgagc 24
Claims (10)
1. The RNAi expression vector of the core fragment of the SmHQT gene of the cultivated eggplant has the sequence shown in SEQ ID No. 3.
2. The RNAi expression vector of claim 1, wherein the RNAi expression vector is constructed by: a pBin19 vector is used as a skeleton vector, and a CaMV35S promoter, a forward sequence of a core fragment of a cultivated eggplant SmHQT gene, a DET intron, a reverse sequence of the core fragment of the cultivated eggplant SmHQT gene and an Nos terminator expression box which are sequentially connected are inserted into a polyclonal enzyme cutting site.
3. The RNAi expression vector of any preceding claim, constructed to include:
a. carrying out PCR amplification by taking a recombinant plasmid containing a sequence shown in SEQ ID No.3 as a template and SEQ ID No.2 and SEQ ID No.1 as primers, carrying out double enzyme digestion on an amplification product by using HindIII and XbaI, and connecting the amplification product with a pHBLD vector subjected to the same double enzyme digestion to obtain a recombinant plasmid pHBLD-SmHQT;
b. carrying out PCR amplification according to the method of the step a or directly using the PCR amplification product obtained in the step a, carrying out double enzyme digestion on the amplification product by KpnI and XhoI, and then connecting the amplification product with the recombinant plasmid pHBLD-SmHQT subjected to the same double enzyme digestion to obtain a recombinant plasmid pHBLD-SmHQT;
c. and c, carrying out double enzyme digestion on the recombinant plasmid pHBLD-SmHQTi obtained in the step b by using SacI and SpeI, and then connecting the recombinant plasmid pHBLD-SmHQTi with a pBin19 vector subjected to double enzyme digestion by using SacI and XbaI to obtain the RNAi expression vector.
4. The RNAi expression vector of the preceding claim, wherein the recombinant plasmid comprising the sequence of SEQ ID No.3 is prepared by a method comprising: the cDNA containing the gene sequence of the cultivated eggplant SmHQT is taken as a template, SEQ ID No.2 and SEQ ID No.1 are taken as primers for amplification, and an amplification product is connected with a pMD-T19 vector to obtain the recombinant plasmid containing the sequence shown in SEQ ID No. 3.
5. The RNAi expression vector of the preceding claim, wherein the SmHQT gene has GenBank number KT 259042.1.
6. A microbial transformant comprising the RNAi expression vector of any preceding claim.
7. The microbial transformant of the preceding claim, which is transformed with agrobacterium as recipient, wherein agrobacterium may be LBA 4404.
8. A method for cultivating cultivated eggplant having a low chlorogenic acid synthesis level and/or a low browning rate of pulp in an aerobic environment, which comprises interfering with the expression of SmHQT gene.
9. The method according to the preceding claim, characterized in that the low synthetic yield is expressed in at least one of young, mature and fruit of cultivated eggplant.
10. The method of any preceding claim, wherein the nucleic acid fragment of SEQ ID No.3, the RNAi expression vector of any preceding claim, and/or the microbial transformant of any preceding claim is used.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111022223.4A CN114717255A (en) | 2018-02-09 | 2018-02-09 | Method for improving and cultivating eggplant by RNAi |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810136195.0A CN108165555B (en) | 2018-02-09 | 2018-02-09 | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof |
| CN202111022223.4A CN114717255A (en) | 2018-02-09 | 2018-02-09 | Method for improving and cultivating eggplant by RNAi |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810136195.0A Division CN108165555B (en) | 2018-02-09 | 2018-02-09 | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114717255A true CN114717255A (en) | 2022-07-08 |
Family
ID=62513615
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111022223.4A Pending CN114717255A (en) | 2018-02-09 | 2018-02-09 | Method for improving and cultivating eggplant by RNAi |
| CN201810136195.0A Expired - Fee Related CN108165555B (en) | 2018-02-09 | 2018-02-09 | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810136195.0A Expired - Fee Related CN108165555B (en) | 2018-02-09 | 2018-02-09 | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN114717255A (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904067B (en) * | 2019-12-20 | 2022-08-26 | 中国烟草总公司郑州烟草研究院 | Tobacco chlorogenic acid synthetic gene NtHQT and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060150268A1 (en) * | 2002-06-21 | 2006-07-06 | Martin Catherine R | Plant-derived transferase genes |
| CN103525828A (en) * | 2013-10-17 | 2014-01-22 | 重庆大学 | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof |
| CN107099543A (en) * | 2017-06-21 | 2017-08-29 | 山东中医药大学 | Honeysuckle clone LjHQT genes, cloning process, plant expression vector and purposes |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1971687A2 (en) * | 2006-01-12 | 2008-09-24 | Devgen NV | Dsrna as insect control agent |
| CN102533853B (en) * | 2012-03-02 | 2014-03-05 | 江苏省农业科学院 | Method for cultivating anti-TYLCV (Tomato Yellow Leaf Curl Virus) tomato plant by using RNAi technology |
| CN104774869A (en) * | 2015-04-20 | 2015-07-15 | 重庆大学 | Method for cultivating long-storage tomato plants by virtue of silent tomato gene SlNZG |
| CN106947770B (en) * | 2017-03-18 | 2020-03-17 | 郑州大学 | Kohlrabi gene and application thereof in cultivation of purple mini tomatoes |
-
2018
- 2018-02-09 CN CN202111022223.4A patent/CN114717255A/en active Pending
- 2018-02-09 CN CN201810136195.0A patent/CN108165555B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060150268A1 (en) * | 2002-06-21 | 2006-07-06 | Martin Catherine R | Plant-derived transferase genes |
| CN103525828A (en) * | 2013-10-17 | 2014-01-22 | 重庆大学 | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof |
| CN107099543A (en) * | 2017-06-21 | 2017-08-29 | 山东中医药大学 | Honeysuckle clone LjHQT genes, cloning process, plant expression vector and purposes |
Non-Patent Citations (4)
| Title |
|---|
| DOCIMO, T. ET AL.: ""Solanum melongena hydroxycinnamoyl coenzyme A-quinate transferase mRNA，complete cds"，Accession Number：KT259042.1" * |
| RICARDA NIGGEWEG ET AL.: ""Engineering plants with increased levels of the antioxidant chlorogenic acid"" * |
| T. DOCIMO ET AL.: ""Insights in the Fruit Flesh Browning Mechanisms in Solanum melongena Genetic Lines with Opposite Postcut Behavior"" * |
| 王星 等: ""茄科蔬菜苯丙烷类代谢及相关酶基因研究进展"" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108165555B (en) | 2021-08-27 |
| CN108165555A (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111635902B (en) | Method for improving resistance of black spot disease of chrysanthemum through artificial interference | |
| CN103525828B (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN107446928B (en) | Cauliflower organ development regulation miRNA sequence and application thereof | |
| CN117683109A (en) | Application of ScF3' H gene in improving cold resistance of potatoes | |
| CN108165555B (en) | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| CN110951771B (en) | Chinese cymbidiummiR390aApplication in controlling plant root system development | |
| CN103014030B (en) | RNAi (Ribonucleic acid interference) carrier of three genes of collard DWARF, SP and GA20ox, and building method and application thereof | |
| CN109536514B (en) | Chinese cabbage gynoecium development related gene BrCRF6 and application thereof | |
| Zhang et al. | An efficient regeneration protocol for Agrobacterium-mediated transformation of melon (Cucumis melo L.) | |
| CN106947770B (en) | Kohlrabi gene and application thereof in cultivation of purple mini tomatoes | |
| CN107723293A (en) | A kind of cotton fiber development related gene GbWRKY32 and its expression vector and application | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN117721111B (en) | Mangrove plant avicennia marina endogenous promoter AMGT P5 and application thereof | |
| CN110982921B (en) | Application of cymbidium miR159a in accelerating plant life cycle | |
| AU2021106992A4 (en) | Peanut adversity stress gene ahmyb30 and application thereof | |
| CN116063433B (en) | Gene for regulating oil content of rape seeds and application thereof | |
| CN116375835B (en) | Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology | |
| CN116179590B (en) | Application of cymbidium miR396 gene in regulation and control of thickening of plant stems | |
| CN110904110B (en) | Application of OsHAP3C gene expression reduction in rice variety with shortened heading period and prolonged growth period | |
| CN116837000A (en) | Gene, expression vector and application for regulating chrysanthemum flowering phase | |
| CN104558131B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN117821496A (en) | Application of over-expressed auxin transporter PtoPIN1a gene in improving biomass of populus tomentosa | |
| CN117821472A (en) | Lotus NnAP2 gene and encoding protein, primer, vector construction and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |