CN114717245A

CN114717245A - Application of MsbHLH35 gene and protein coded by MsbHLH35 gene in regulation and control of alfalfa yield and stain resistance

Info

Publication number: CN114717245A
Application number: CN202210377938.XA
Authority: CN
Inventors: 胡龙兴; 陈良; 张强; 徐倩; 刘霄霏; 胡瑜
Original assignee: Hunan Agricultural University; Wuhan Botanical Garden of CAS
Current assignee: Hunan Agricultural University; Wuhan Botanical Garden of CAS
Priority date: 2022-04-12
Filing date: 2022-04-12
Publication date: 2022-07-08
Anticipated expiration: 2042-04-12
Also published as: CN114717245B

Abstract

The invention discloses an application of an MsbHLH35 gene of alfalfa and a protein coded by the MsbHLH35 gene in regulation and control of alfalfa yield and stain resistance, and belongs to the technical field of molecular biology. The cDNA sequence of the MsbHLH35 gene is shown as SEQ ID NO. 1; the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2. The invention separates an MsbHLH35 gene from alfalfa, and finds that: the MsbHLH35 gene plays an important role in resisting waterlogging stress of alfalfa; meanwhile, the yield of the alfalfa can be improved. Has very important significance for the production of alfalfa in areas with much rainfall and easy waterlogging.

Description

Application of MsbHLH35 gene and protein coded by MsbHLH35 gene in regulation and control of alfalfa yield and stain resistance

Technical Field

The invention relates to the technical field of molecular biology, in particular to an MsbHLH35 gene from alfalfa and application of a protein coded by the MsbHLH35 gene in regulation and control of alfalfa yield and stain resistance.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Alfalfa (Medicago sativa L.) is an important perennial legume crop, and is one of the world important temperate zone legume crops. The alfalfa has better pasture production potential, and for the alfalfa with rhizomatous tumors, higher pasture dry matter can be obtained under the condition of not applying nitrogen fertilizer. In addition, the alfalfa is also an important multifunctional crop and is rich in minerals such as calcium, magnesium, potassium, iron, zinc and the like and nutrients such as vitamins and the like. The alfalfa also has an important role in ecological systems such as farmland rotation and the like, and can obviously improve soil fertility, soil structure and soil ecology. Thus, there is an increasing demand for alfalfa.

Alfalfa is primarily grown primarily in northern arid or semi-arid regions where the cells are obligately aerobic. With the continuous expansion of planting scale, the alfalfa is also planted in southern areas of China at present. However, water logging disasters are easy to happen in southern areas, alfalfa is very sensitive to water logging stress, and the water logging stress can cause root system rot and germ breeding of the alfalfa, so that the productivity is seriously reduced, and even the alfalfa is out of production. In addition, unreasonable irrigation can also cause waterlogging stress to alfalfa. Thus, waterlogging stress is an important factor that limits alfalfa production. Screening or breeding the alfalfa varieties with strong stain resistance is the key for ensuring the production of the alfalfa in areas with much rainfall and waterlogging, but related research reports are rare at present.

The bHLH basic/helix-loop-helix transcription factors are important transcription factors containing a plurality of members, and the structural domain has the capacity of combining with DNA and forming homodimers or heterodimers with other bHLH proteins, and has very important transcriptional regulation and control functions in animals and plants. However, only a few portions of the bHLH proteins have been discovered and studied, and the functions of a large number of members of this family have not yet been determined. The bHLH proteins in plants are more widely distributed and more functionally diverse than the bHLH family members in animals. There are over 150 bHLH transcription factors in arabidopsis, but only about 30% have been functionally characterized. The identification of the bHLH transcription factor and the function thereof in alfalfa is more rarely reported. Therefore, the research on the regulation mechanism and the stress resistance function of the genes by utilizing the molecular biology technology has very important significance.

Disclosure of Invention

Aiming at the prior art, the invention aims to provide the MsbHLH35 gene and the application of the protein coded by the MsbHLH35 gene in regulating and controlling the yield and the stain resistance of alfalfa. The invention clones and identifies an MsbHLH35 gene specifically expressed by waterlogging stress from alfalfa. Transgenic experiments show that the overexpression of the MsbHLH35 gene can simultaneously improve the yield and the stain resistance of alfalfa, and has very important significance for the production of alfalfa in areas with much rainfall and waterlogging.

The invention is realized by the following technical scheme:

in a first aspect of the invention, an MsbHLH35 gene is provided, wherein the MsbHLH35 gene is a nucleic acid molecule represented by i) or ii) or iii) as follows:

i) the nucleotide sequence is a nucleic acid molecule shown as SEQ ID NO. 1;

ii) a nucleic acid molecule which is 90% or more than 90% identical to the nucleotide sequence of i) and expresses a protein having the same function;

iii) a nucleic acid molecule other than i) which encodes the amino acid sequence shown in SEQ ID NO. 2.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. Identity can be assessed using computer software, for example, as determined using the BLAST algorithm (Altschul et al 1990.journal of Molecular Biology 215: 403-.

In the above nucleic acid molecule, the 90% or more identity may be at least 90%, 91%, 92%, 95%, 96%, 98% or 99% identity.

In a second aspect of the present invention, there is provided a protein encoded by the MsbHLH35 gene, wherein the protein is represented by any one of (a1) or (a 2):

(A1) a protein consisting of an amino acid sequence shown in SEQ ID No. 2;

(A2) a fusion protein obtained by attaching a protein tag to the N-terminus and/or C-terminus of the protein defined in (A1).

Wherein, the proteins (A1) and (A2) can be artificially synthesized, or obtained by synthesizing the coding genes and then carrying out biological expression.

In the above proteins, the protein tag refers to a polypeptide or protein that is expressed by fusion with a target protein by using a DNA in vitro recombination technology, so as to facilitate expression, detection, tracing and/or purification of the target protein. Wherein a tag may be attached to the amino terminus or the carboxyl terminus of the protein of (A1) in order to facilitate purification of the protein of (A1). The tag may be Poly-Arg (typically 6 RRRRR), Poly-His (typically 6 HHHHHHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK) or c-myc (EQKLISEEDL).

In a third aspect of the invention, a recombinant expression vector, a transgenic cell line or a genetically engineered bacterium carrying the MsbHLH35 gene is provided.

Wherein, the recombinant expression vector can be constructed by using the existing plant expression vector. The plant expression vector comprises a binary agrobacterium vector, a vector which can be used for plant microprojectile bombardment and the like, such as pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301 or other derivative plant expression vectors. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters, such as a cauliflower mosaic virus (CaMV)35S promoter, a Ubiquitin gene Ubiquitin promoter (pUbi), a stress-inducible promoter rd29A and the like, can be added before the transcription initiation nucleotide, and can be used alone or in combination with other plant promoters; in addition, when a recombinant expression vector is constructed using the gene of the present invention, an enhancer, including a translation enhancer or a transcription enhancer, may also be used.

In a fourth aspect of the present invention, there is provided a use of the MsbHLH35 gene in at least one of the following (1) to (3):

(1) the yield of the plants is improved;

(2) the stain resistance of the plants is improved;

(3) and (3) cultivating the plant variety with improved yield and stain resistance.

Preferably, the plant is alfalfa or arabidopsis thaliana.

In a fifth aspect of the present invention, there is provided a use of a protein encoded by the MsbHLH35 gene in any one of the following (1) to (4):

(1) the yield of the plants is improved;

(2) preparing a product for increasing plant yield;

(3) the stain resistance of the plants is improved;

(4) preparing products for improving the stain resistance of plants.

Preferably, the plant is alfalfa or arabidopsis thaliana.

The sixth aspect of the invention provides a recombinant expression vector, a transgenic cell line or a genetically engineered bacterium carrying the MsbHLH35 gene, and an application of the recombinant expression vector, the transgenic cell line or the genetically engineered bacterium in at least one of the following (1) to (3):

(1) the yield of the plants is improved;

(2) the stain resistance of the plants is improved;

In a seventh aspect of the present invention, there is provided a method for simultaneously improving plant yield and stain tolerance, comprising: a step of overexpressing the MsbHLH35 gene in the plant.

Among the above methods, a method in which the MsbHLH35 gene is overexpressed in a plant by exogenous transfer into the MsbHLH35 gene; or up-regulating the expression of the MsbHLH35 gene in the genome of the plant.

The method for exogenously transferring the MsbHLH35 gene can be as follows: the plant expression vector carrying the MsbHLH35 gene is used for transforming plant cells or tissues by using a Ti plasmid, a Ri plasmid, direct DNA transformation, microinjection, conductance, Agrobacterium mediation and other conventional biological methods, and the transformed plant cells or tissues are cultivated into plants.

A method of up-regulating expression of an MsbHLH35 gene in a plant genome can comprise: introducing a DNA fragment capable of activating or increasing the transcriptional or translational level or protein activity of the MsbHLH35 gene; or controlling the synthesis of specific small RNA molecules and up-regulating the accumulation of MsbHLH35 gene mRNA.

The eighth aspect of the invention provides a method for cultivating alfalfa varieties with improved yield and stain resistance, which comprises the following steps:

transferring the MsbHLH35 gene into a wild alfalfa plant to allow the MsbHLH35 gene to be overexpressed, and obtaining a transgenic alfalfa plant; the transgenic alfalfa plants have higher canopy height, hay weight and stain resistance than wild alfalfa plants.

In the breeding method, the method for transferring the MsbHLH35 gene into the alfalfa starting plant comprises the following steps: polyethylene glycol method, Agrobacterium mediated method or gene gun bombardment method.

The invention has the beneficial effects that:

the invention separates an MsbHLH35 gene from alfalfa, and finds that: the MsbHLH35 gene plays an important role in resisting waterlogging stress of alfalfa; meanwhile, the yield of the alfalfa can be improved. Has very important significance for the production of alfalfa in areas with much rainfall and easy waterlogging.

Drawings

FIG. 1: conservation analysis of MsbHLH35 and other species of bHLH35 proteins.

FIG. 2: MsbHLH35 evolutionary tree analysis.

FIG. 3: the effect of overexpression of MsbHLH35 on stain resistance in Arabidopsis.

FIG. 4 is a schematic view of: effect of overexpression of MsbHLH35 on arabidopsis MDA content.

FIG. 5 is a schematic view of: effect of overexpression of MsbHLH35 on Arabidopsis SOD activity.

FIG. 6: effect of overexpression of MsbHLH35 on arabidopsis POD activity.

FIG. 7: effect of overexpression of MsbHLH35 on the alfalfa stain-resistant phenotype.

FIG. 8: effect of overexpression of MsbHLH35 on the MDA content of alfalfa.

FIG. 9: effect of overexpression of MsbHLH35 on alfalfa POD activity.

FIG. 10: effect of overexpression of MsbHLH35 on alfalfa CAT activity.

FIG. 11: field growth conditions for wild-type and transgenic alfalfa; OE4 and OE7 represent two transgenic lines of alfalfa, -1 and-2 represent repeats, respectively.

FIG. 12: canopy height and hay weight for wild type and transgenic alfalfa; OE4 and OE7 represent the two transgenic lines of alfalfa, respectively.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As mentioned above, alfalfa is an excellent grass crop and is increasingly in demand. However, the cells of alfalfa are obligately aerobic, and many physiological and biochemical reactions require oxygen as a substrate. However, waterlogging stress can hinder the absorption and utilization of the alfalfa to oxygen, and cause root system rot and germ breeding of the alfalfa, so that the productivity is seriously reduced, and even the alfalfa is out of production. Therefore, waterlogging stress is a main limiting factor influencing the mass production of alfalfa in areas with heavy rainfall and in areas with high water logging tendency.

The bHLH transcription factor plays an important role in the growth, development, regulation and control of eukaryotes and the stress response to adversity. However, the bHLH family members are numerous, and among the currently known bHLH family members, there are differences in their anti-stress functions; and the functionality of a large number of members has not yet been determined. For alfalfa, studies on its bHLH transcription factor have been very rarely reported.

Based on the method, the bHLH transcription factor of the alfalfa is deeply researched, an MsbHLH35 gene specifically expressing waterlogging stress is cloned from a alfalfa variety WL363 with strong waterlogging tolerance, and the nucleotide sequence of the MsbHLH35 gene is shown as SEQ ID No. 1; the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and specifically comprises the following steps:

MENIGDEYKLYWETNMFLQTQELDSWGLDEAFSGYYDSSSPDGAASSGVSSKNIVSERNRRKKLNERLFALRAVVPNISKMDKASIIKDAIEYIKHLHEQEKIIQAEIMELESGMPNNINPNYDFDQELPVLLRSKKKRTDQLYDSVTSRNFPIEVLELRVTYMGENTMVVSLTCNKRADTMVKLCEVFESLKLKIITANITSFSGRLLKTVFIEANEEDRDLLQMKIQTAIAALNDPLSPMSI。

the function of the MsbHLH35 gene is further verified by constructing an overexpression vector of the MsbHLH35 gene. The results show that: the overexpression of the MsbHLH35 gene can obviously improve the stain resistance of alfalfa and can also improve the yield of alfalfa. Therefore, the MsbHLH35 gene has important significance for the mass production of alfalfa in areas with heavy rainfall and waterlogging, and the invention is provided.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention were all conventional in the art and commercially available. The experimental procedures without specifying the detailed conditions were carried out according to the conventional experimental procedures or according to the instructions recommended by the suppliers.

The plant materials used in the embodiment of the invention are alfalfa varieties 'WL 363' and 'alfalfa No. one'. The used expression vectors are all the existing commercial expression vectors or can be constructed by the conventional genetic engineering technical means; the public is available from the applicant for a repeat of the present invention.

Example 1: cloning of MsbHLH35 Gene

1. Extracting total RNA of alfalfa:

adding liquid nitrogen into 0.1g of alfalfa leaves, grinding, transferring to a centrifuge tube containing 1ml of Trizol RNAase-free, standing at room temperature for 5min, adding 0.2ml of chloroform, mixing for 15s, and standing at room temperature for 3 min. Centrifuging at 4 deg.C and 12000rmp for 15min, transferring the supernatant to a new RNAase-free centrifuge tube, adding 0.5ml isopropanol, standing at room temperature for 10min, centrifuging at 4 deg.C and 12000rmp for 10min, removing supernatant, washing precipitate with 75% ethanol, adding 1ml 75% ethanol to 1ml Trizol, centrifuging at 4 deg.C and 12000rmp for 5min, discarding supernatant, reversing centrifuge tube, standing for 5-10min, adding 30 μ L of ddH of RNAase-free₂Dissolving the precipitate to obtain total RNA, and storing at-70 deg.C.

2. Synthesis of cDNA:

using PrimeScript^TM1st Strand cDNA Synthesis Kit reverse transcription Kit (TaKaRa) was used to synthesize the first Strand cDNA, and the following reagents were added in the order named:

(1) 10 μ L of the reaction solution was prepared

(2) Keeping the temperature at 65 ℃ for 5min, and rapidly cooling on ice

(3) Prepare 20. mu.L of reaction solution

(4) Slowly mixing the mixture evenly and then carrying out transcription reaction according to the following conditions: the reaction is finished after 10min at 30 ℃, 60min at 42 ℃ and 5min at 95 ℃.

3. MsbHLH35 cloning primer design:

in the early stage of the laboratory, an alfalfa variety WL363 with strong stain resistance is screened from 312 alfalfa germplasm resources, a stain-resistant related gene is obtained by screening an RNA-seq technology, a stain water stress specific expression gene MsbHLH35 is cloned from the stain-resistant related gene, a pair of amplification primers is designed according to an alfalfa full-length transcription group sequence, and the primer sequences are as follows:

MsbHLH35-F：5’-ATGGAGAACATTGGTGATGA-3’；(SEQ ID NO.3)

MsbHLH35-R：5’-TTAGATGCTCATAGGGCTTA-3’。(SEQ ID NO.4)

4. CDS amplification of MsbHLH 35:

taking cDNA of alfalfa variety WL363 as a template, performing PCR amplification by using a Q5High-Fidelity DNA Polymerase kit (NEB) and MsbHLH35-F and MsbHLH35-R as primers, wherein a reaction system and an amplification program are as follows:

5. the CDS sequence of MsbHLH35 was obtained:

the PCR product after amplification is recovered and connected after agarose gel electrophoresis detection

Simple (full-scale gold) and transformed escherichia coli DH5 alpha, a positive monoclonal strain is selected for sequencing, a CDS full-length sequence of the MsbHLH35 gene is obtained, the CDS full-length sequence comprises a complete open reading frame (735bp, a specific nucleotide sequence is shown as SEQ ID NO. 1), the gene codes 244 amino acids, and the specific amino acid sequence is shown as SEQ ID NO. 2.

6. Sequence analysis:

the MsbHLH35 protein sequence obtained by Blast analysis has extremely high homology with other species bHLH35 sequences (figure 1), and MtbHLH35, CabHLH35, CkbHLH35 and the like are subjected to phylogenetic tree analysis (figure 2), and the MtbHLH35 and MtbHLH35 have the closest relationship.

Example 2: construction of MsbHLH35 Gene overexpression vector

1. 35S construction of MsbHLH35 overexpression vector:

designing a specific primer with an enzyme cutting site according to the coding region sequence of MsbHLH 35:

MsbHLH35-F(OE)：5’-GTCGACATGGAGAACATTGGTGATGA-3’；(SEQ ID NO.5)

MsbHLH35-R(OE)：5’-TTAGATGCTCATAGGGCTTATCTAGA-3’。(SEQ ID NO.6)

the plasmid Blunt-MsbHLH35 connected with the cloning vector is used as a template, High Fidelity enzyme Q5High-Fidelity DNA Polymerase is used for amplification, a product is recovered and connected with the cloning vector, escherichia coli DH5 alpha competent cells are transformed, positive single colonies are sequenced, the plasmid is extracted from a bacterial solution with correct sequencing verification, and the Blunt-MsbHLH35(OE) and the overexpression vector pMD35S are subjected to double enzyme digestion respectively, wherein the system is as follows:

mixing, standing at 37 deg.C for 10 hr, recovering and purifying target fragment. And connecting the recovered MsbHLH35 fragment with a pMD35S enzyme digestion vector, wherein the system is as follows:

uniformly mixing, connecting for 10h at 16 ℃, transforming the connecting product into escherichia coli DH5 alpha competent cells, and extracting plasmids from the positive monoclonal strain through colony detection to obtain pMD35S-MsbHLH 35.

And (3) agrobacterium transformation: taking agrobacterium tumefaciens competent cells EHA105 for thawing on ice at the temperature of minus 80 ℃, adding 2 mu L of plasmid DNA of LpMD35S-MsbHLH35 into every 50 mu L of competence, sequentially freezing for 5min, using liquid nitrogen for 5min, using a metal bath for 5min, adding 500 mu L of LB culture medium without antibiotics after ice bath for 5min, shaking for 2-3h at the temperature of 28 ℃ and 200rpm, centrifuging for 1min at 6000rpm, sucking 100 mu L of supernatant, spreading the supernatant on LB solid culture medium containing 50 mu g/mL kanamycin and 25 mu g/mL rifampicin, and carrying out inversion culture for 48h at the temperature of 28 ℃. The single colony grown is verified to be positive by PCR, the positive single colony is inoculated into LB liquid culture medium (50 mu g/mL kanamycin and 25 mu g/mL rifampicin), the culture is carried out for 48h at the speed of 250rpm at the temperature of 28 ℃, and the bacterial liquid is used for Arabidopsis genetic transformation or is stored at the temperature of-70 ℃ and is named as pMD35S-MsbHLH35-EHA 105.

2. pCAMBIA1301s MsBHLH35 overexpression vector construction:

MsbHLH35-F(OE)：GTCGACATGGAGAACATTGGTGATGA

MsbHLH35-R(OE)：TTAGATGCTCATAGGGCTTATCTAGA

and similarly, taking a Blunt-MsbHLH35 plasmid as a template, amplifying by using Q5High-Fidelity DNA Polymerase, recovering a product, connecting with a cloning vector, transforming escherichia coli DH5 alpha competent cells, extracting plasmids from positive monoclonal bacteria liquid through sequencing verification, and performing double enzyme digestion on the Blunt-MsbHLH35(OE) and an overexpression vector pCAMBIA1301s respectively, wherein the system is as follows:

reagent	Volume (μ L)
		10×buffer	4
XbaI	1
		SalI	1
Blunt-MsbHLH35(OE)/pCAMBIA1301s	Each 15 of
		ddH₂O	Is supplemented to 40

Mixing, standing at 37 deg.C for 10 hr, recovering and purifying target fragment. And connecting the recovered MsbHLH35 fragment with a pCAMBIA1301s enzyme digestion vector, wherein the system is as follows:

mixing, connecting at 16 deg.c for 10 hr, converting the connected product into competent cell of colibacillus DH5 alpha, and colony detection to obtain pCAMBIA1301s-MsbHLH 35.

And (3) agrobacterium transformation: the plasmid DNA is pCAMBIA1301s-MsbHLH35, and the transformed bacterial liquid is preserved at-70 ℃ and named as pCAMBIA1301s-MsbHLH35-EHA105, which is the same as pMD35S-MsbHLH35-EHA105 agrobacterium transformation.

Example 3: arabidopsis genetic transformation and screening identification

1. Floral dip transformation of arabidopsis thaliana:

the constructed overexpression vector pMD35S-MsbHLH35 is used for transforming Arabidopsis, and the specific steps are as follows:

(1) selecting arabidopsis thaliana with a strong inflorescence, cutting off pods for transformation;

(2) sucking 20 mu L of agrobacterium liquid containing pMD35S-MsbHLH35 overexpression vector into LB liquid culture medium containing 50 mu g/mL kanamycin and 25 mu g/mL rifampicin, culturing at 28 ℃, shaking at 200rpm until OD600 is 0.6-0.8, centrifuging at 8000rpm for 8min, and collecting agrobacterium thallus;

(3) resuspending the centrifugally collected agrobacterium with 5% sucrose solution (containing 0.02% Silwet L-77), and mixing uniformly to obtain flower soaking solution;

(4) placing the arabidopsis inflorescence into the flower soaking solution, shaking and dip-dyeing for 2min, culturing the infected arabidopsis for 24h under the dark condition, and then transferring the arabidopsis into a growth chamber for normal culture;

(5) after the seeds are mature, collecting T₀Seeds, drying at 37 deg.CAnd (6) to be screened.

2. Screening and identification of transgenic arabidopsis thaliana:

t to be harvested₀Replacing Arabidopsis seeds, sterilizing with 75% ethanol, uniformly sowing on MS culture medium containing 50 μ g/mL kanamycin, screening, selecting green seedling, transplanting into matrix, culturing, collecting T from individual plant₁And (5) seed generation. Taken T₁The generation seeds are sterilized by 75% ethanol and then are uniformly sown on an MS culture medium containing 50 mug/mL kanamycin to be screened for 7-10d, and in order to ensure single copy insertion, green seedlings are selected: the etiolated seedling is 3: 1, transferring over-expressed Arabidopsis strains OE1 and OE6 into matrix soil for continuous culture, and collecting T from single strain₂Generating Arabidopsis seeds; will T₂And germinating the arabidopsis thaliana seeds in an MS culture medium containing 50 mu g/mL kanamycin, and screening to obtain a homozygous line.

3. Analysis of stain resistance of transgenic Arabidopsis thaliana:

germinating MsbHLH35 transgenic Arabidopsis lines (OE1 and OE6) and seeds of wild type Arabidopsis (WT) on 1/2MS medium for 7-10 d; selecting arabidopsis thaliana with consistent growth, transplanting the arabidopsis thaliana into a 7 x 7cm plastic pot, culturing the arabidopsis thaliana in the growth chamber with nine plants in each pot at the temperature of 23 ℃/18 ℃ for 14h in the daytime and 10h in the dark at night, carrying out waterlogging treatment (WL) when the seedlings are 2 weeks old, photographing the phenotype after 7 days of treatment, and determining the MDA content, the antioxidase SOD and the POD activity of the plants; the Control (CK) was prepared without stain treatment.

The MDA content, SOD and POD activity were measured by the method described in the reference Hu L X, Li H Y, Pang H, et al, responses of antioxidant genes, protein and enzymes to saline stress in two genes of genetic RNA (Long term) differential in saline [ J ]. Journal of Plant Physiology,2012,169: 146-.

The results are shown in FIGS. 3-6. The results show that: there was no significant difference between the wild-type and MsbHLH35 transgenic lines OE1 and OE6 under Control (CK) conditions, but the leaf withering degree of the wild-type plants was more pronounced than that of the MsbHLH35 transgenic line under Waterlogging (WL) conditions. In physiological aspect, the content of wild type MDA is also obviously higher than that of an MsbHLH35 transgenic line, and SOD and POD activities show the same trend, which shows that the tolerance and the antioxidant capacity of an Arabidopsis cell membrane can be obviously improved by over-expressing MsbHLH35, so that the tolerance of Arabidopsis to waterlogging is improved.

Example 4: alfalfa genetic transformation and screening identification

1. And (3) leaf disc method conversion of alfalfa:

(1) preparing bacterial liquid: a small sample of Agrobacterium was taken from-70 ℃ and 10. mu.L of the prepared pCAMBIA1301s-MsbHLH35-EHA105 strain was pipetted into 400. mu.L of LB liquid medium containing kanamycin (50mg/L) and rifampicin (25mg/L) and shaken overnight. Then transferred into a 250ml Erlenmeyer flask containing 100ml LB (50mg/L Kan +25mg/L Rif) to be cultured at 28 ℃ and 200rpm until OD₆₀₀When the concentration is 0.4, acetosyringone (As) (20mg/L) is added and the mixture is cultured to OD₆₀₀＝0.8。

(2) Preparing an explant: selecting fresh leaves of Murraya I (30 pieces), adding 30 μ L Tween, shaking, removing surface active substances, cleaning for 3-4 times, sterilizing with 7.5% sodium hypochlorite solution for 8-10min, and cleaning with sterile water.

(3) And (3) transformation: pouring the sterilized leaves into the prepared bacterial liquid, vacuumizing for 5min, performing ultrasonic treatment for 3-5min, and vacuumizing for 5 min. The bacterial solution is poured off, and the leaves are blotted or air-dried with sterile filter paper.

(4) Co-culturing: the leaves were placed on co-cultivation medium (SH3a + As (100mM)) and incubated in the dark for at least 24 h.

(5) Screening: the co-cultured transformed leaves are transferred to a screening medium (if the co-cultured leaves are large, the leaves should be cut small with scissors, so that callus is easily generated), cultured in the dark, and callus is induced. (alfalfa should be subcultured exactly once every 2 weeks for about 1-2 months).

Screening a culture medium: SH3a + screening agent + bacteriostatic agent;

screening agent: hygromycin is 5 mg/L;

bacteriostatic agent: 400mg/L of timentin 200-.

SH3a medium:

(6) differentiation: the induced calli were transferred to MSBK differentiation medium and after approximately 1-2 weeks green shoots appeared (which if left on MSBK for longer periods of time would result in shoot vitrification or enlargement of the underlying parts of the shoots) were transferred to SH9 differentiation medium. The MSBK differentiation medium is prepared by adding the following screening agent and bacteriostatic agent into MSBK medium. (differentiation time is about 1-2 months).

Screening agent: hygromycin is 5mg/L or PPT is 1 mg/L;

bacteriostatic agent: 400mg/L of timentin 200-.

MSBK medium:

SH9 differentiation medium:

(7) rooting: cutting off the normal bud until the normal bud grows to 1-2cm, and transferring to a rooting culture medium until the normal bud grows to root.

Rooting culture medium: MS0(MS powder 2.23g/L, sucrose 8 g/L).

(8) Transplanting: transplanting the regenerated seedlings with normal growth and healthy root systems into nutrient soil, and continuously culturing.

2. Analysis of the stain resistance of the transgenic alfalfa:

cutting strong transgenic alfalfa (OE4) into 3 stem nodes, sticking rooting powder on the cut branch, cutting in matrix to take root, and performing cuttage on alfalfa I (WT) as wild type control. The rooted plants were cultured to 8 weeks old and then treated with waterlogging, and after 7 days of treatment, the forms (FIG. 7) were photographed to determine the MDA content (FIG. 8) and activities (MDA content, SOD and POD activities) of the plants against the enzymes CAT and POD (FIGS. 9 and 10).

The results show that: under normal conditions, the wild type alfalfa and the transgenic plant line have no obvious difference, but under the waterlogging condition, the withered and yellow wilting phenomenon of wild type alfalfa leaves is more serious, simultaneously, the MDA content is also obviously higher than that of the transgenic plant line, the CAT and POD activities also show the same trend, which shows that the waterlogging causes serious oxidative damage of the alfalfa, and the overexpression of MsBHLH35 can effectively reduce the stress damage and improve the waterlogging resistance of the alfalfa.

Transplanting the wild-type and transgenic alfalfa strains subjected to cuttage rooting into an outdoor test field with fences around at 4 months in 2021, allowing the overground part to die and the underground part to enter dormancy in summer in the year, allowing the plants to grow green again in 2 months in 2022, allowing the plants to grow green again in 15 months in 3 months by using a ruler from the stem base to the top of the grass layer, measuring the height of the canopy, cutting the plants, loading the plants by kraft paper bags, deactivating the green for 15min at 105 ℃, and drying the plants to constant weight at 60 ℃ to obtain the weight of the hay.

The results are shown in FIGS. 11 to 12, respectively. The results show that: overexpression of MsbHLH35 can significantly increase the canopy height and hay weight of alfalfa, thereby increasing the yield of alfalfa.

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Wuhan botanical garden of Hunan agriculture university, Chinese academy of sciences

<120> MsbHLH35 gene and application of protein coded by same in regulation and control of alfalfa yield and waterlogging tolerance

<130> 2022

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 735

<212> DNA

<213> alfalfa (Medicago sativa L.)

<400> 1

atggagaaca ttggtgatga gtacaagctt tactgggaga ccaacatgtt cctccaaacc 60

caagagcttg atagctgggg attggatgag gctttttcag ggtattatga ttcaagctcc 120

ccagatggtg cagcatcatc aggagtttca tctaagaaca ttgtctctga aaggaatagg 180

aggaagaagc ttaatgaaag actctttgca cttagagcag tggtcccaaa cattagcaag 240

atggataaag cttcaattat taaggatgct attgagtaca taaagcactt gcatgaacaa 300

gagaagatta ttcaagctga gataatggaa cttgaatctg ggatgcctaa taatattaat 360

ccaaattatg attttgatca agagcttcct gtgttgctaa ggtccaagaa gaagagaaca 420

gatcagttat atgattctgt cacttcaaga aactttccaa ttgaagtcct tgagcttagg 480

gttacataca tgggagagaa tacaatggta gtgagcttga catgtaacaa aagggcagac 540

acaatggtga aattgtgtga agttttcgaa tctttgaagc ttaaaattat tactgccaac 600

atcacctctt tttcaggcag gcttttgaag acagtcttca ttgaggcaaa tgaggaagat 660

agagatctat tgcaaatgaa gattcaaaca gccattgcag ctcttaatga ccctctaagc 720

cctatgagca tctaa 735

<210> 2

<211> 244

<212> PRT

<213> alfalfa (Medicago sativa L.)

<400> 2

Met Glu Asn Ile Gly Asp Glu Tyr Lys Leu Tyr Trp Glu Thr Asn Met

1 5 10 15

Phe Leu Gln Thr Gln Glu Leu Asp Ser Trp Gly Leu Asp Glu Ala Phe

20 25 30

Ser Gly Tyr Tyr Asp Ser Ser Ser Pro Asp Gly Ala Ala Ser Ser Gly

35 40 45

Val Ser Ser Lys Asn Ile Val Ser Glu Arg Asn Arg Arg Lys Lys Leu

50 55 60

Asn Glu Arg Leu Phe Ala Leu Arg Ala Val Val Pro Asn Ile Ser Lys

65 70 75 80

Met Asp Lys Ala Ser Ile Ile Lys Asp Ala Ile Glu Tyr Ile Lys His

85 90 95

Leu His Glu Gln Glu Lys Ile Ile Gln Ala Glu Ile Met Glu Leu Glu

100 105 110

Ser Gly Met Pro Asn Asn Ile Asn Pro Asn Tyr Asp Phe Asp Gln Glu

115 120 125

Leu Pro Val Leu Leu Arg Ser Lys Lys Lys Arg Thr Asp Gln Leu Tyr

130 135 140

Asp Ser Val Thr Ser Arg Asn Phe Pro Ile Glu Val Leu Glu Leu Arg

145 150 155 160

Val Thr Tyr Met Gly Glu Asn Thr Met Val Val Ser Leu Thr Cys Asn

165 170 175

Lys Arg Ala Asp Thr Met Val Lys Leu Cys Glu Val Phe Glu Ser Leu

180 185 190

Lys Leu Lys Ile Ile Thr Ala Asn Ile Thr Ser Phe Ser Gly Arg Leu

195 200 205

Leu Lys Thr Val Phe Ile Glu Ala Asn Glu Glu Asp Arg Asp Leu Leu

210 215 220

Gln Met Lys Ile Gln Thr Ala Ile Ala Ala Leu Asn Asp Pro Leu Ser

225 230 235 240

Pro Met Ser Ile

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

atggagaaca ttggtgatga 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

ttagatgctc atagggctta 20

<210> 5

<211> 26

<212> DNA

<213> Artificial sequence

<400> 5

gtcgacatgg agaacattgg tgatga 26

<210> 6

<211> 26

<212> DNA

<213> Artificial sequence

<400> 6

ttagatgctc atagggctta tctaga 26

Claims

1. An MsbHLH35 gene, wherein the MsbHLH35 gene is a nucleic acid molecule as shown in i) or ii) or iii) below:

i) the nucleotide sequence is a nucleic acid molecule shown as SEQ ID NO. 1;

A protein encoded by the MsbHLH35 gene, wherein the protein is a protein represented by any one of (A1) or (A2):

(A1) a protein consisting of an amino acid sequence shown in SEQ ID No. 2;

3. A recombinant expression vector, a transgenic cell line or a genetically engineered bacterium carrying the MsbHLH35 gene of claim 1.

4. Use of the MsbHLH35 gene of claim 1 in at least one of (1) - (3) below:

(1) the yield of the plant is improved;

(2) the stain resistance of the plants is improved;

5. The use of the MsbHLH35 gene of claim 2 for a protein encoded by any one of the following (1) to (4):

(1) the yield of the plants is improved;

(2) preparing a product for increasing plant yield;

(3) the stain resistance of the plants is improved;

(4) preparing products for improving the stain resistance of plants.

6. The use of the MsbHLH35 gene-carrying recombinant expression vector, transgenic cell line or genetically engineered bacterium of claim 3 in at least one of the following (1) to (3):

(1) the yield of the plants is improved;

(2) the stain resistance of the plants is improved;

7. The use according to any one of claims 4 to 6, wherein the plant is alfalfa or Arabidopsis thaliana.

8. A method for simultaneously increasing plant yield and stain tolerance, comprising: and (b) overexpressing the MsbHLH35 gene in the plant.

9. The method according to claim 8, wherein the MsbHLH35 gene overexpression in the plant is achieved by exogenously transferring the MsbHLH35 gene or by upregulating the expression of the MsbHLH35 gene in the plant genome.

10. A method for cultivating alfalfa varieties with improved yield and stain resistance simultaneously is characterized by comprising the following steps:

transferring the MsbHLH35 gene into a wild alfalfa plant to allow the MsbHLH35 gene to be overexpressed, and obtaining a transgenic alfalfa plant; the transgenic alfalfa plant has higher canopy height, hay weight and stain resistance than a wild alfalfa plant.