CN114717234A

CN114717234A - Method for synthesizing nano enzyme by rolling circle amplification, nano enzyme and application thereof

Info

Publication number: CN114717234A
Application number: CN202210370139.XA
Authority: CN
Inventors: 王丽华; 陈晓亮; 李江; 樊春海
Original assignee: Shanghai Prospective Innovation Research Institute Co ltd
Current assignee: Shanghai Prospective Innovation Research Institute Co ltd
Priority date: 2022-04-08
Filing date: 2022-04-08
Publication date: 2022-07-08

Abstract

The invention belongs to the field of biomedicine, and discloses a method for synthesizing artificial nanoenzyme, which constructs a single-stranded DNA frame with a periodically repeated poly-adenine (polyA) stem-loop unit through Rolling Circle Amplification (RCA), grows gold nanoparticles on the stem-loop unit by taking the DNA frame as a template, and can regulate and control the number and the space interval of the gold nanoparticles by regulating the sequence length of the frame, the length of a poly A unit interval sequence, the concentration of a gold precursor and the like, thereby constructing the nanoenzyme with programmable catalytic activity. The nano enzyme synthesized by the method has programmable peroxidase catalytic activity and wide application prospect.

Description

Method for synthesizing nano enzyme by rolling circle amplification, nano enzyme and application thereof

Technical Field

The invention belongs to the field of biomedicine, and relates to a method for synthesizing nanoenzyme by rolling circle amplification, nanoenzyme and application thereof, in particular to a synthesis method for regulating and controlling the catalytic activity of nanoenzyme like catalase by regulating and controlling the quantity and space interval of gold nanoparticles in coded nanoenzyme through designing a Rolling Circle Amplification (RCA) template sequence and amplification time.

Background

Due to the characteristics of easy manufacturing, high stability, low cost, etc., metal nanoparticles with catalytic activity have been developed as biomimetic-nanoenzymes of natural enzymes. For example, gold nanoparticles have catalytic activities of glucose oxidase and peroxidase, and have been widely used for signal generation in biosensing, sterilization and cancer treatment based on active oxygen, and power sources in nano robots. The catalytic activity of the gold nanoparticles is highly dependent on the exposed catalytic surface, so that compared with large-size nanoparticles, a plurality of small-size nanoparticles are assembled to form clusters, the specific surface area is larger, and the method is more suitable for developing nano enzymes. In recent years, the research on constructing highly ordered metal nanoparticle clusters through self-assembly from bottom to top has been greatly advanced, however, the method needs to perform high-density modification on the surface of metal nanoparticles by using DNA or protein, and the like, so that the catalytic surface of the metal nanoparticles is covered, and the catalytic activity of nano enzyme is inhibited. The prior art also reports that the in-situ growth and deposition of metal nanoparticles are carried out by utilizing a pre-prepared template, and although the method can protect the catalytic surface of the metal nanoparticles, the method cannot regulate and control the space interval among the nanoparticles and also influences the catalytic activity of the nanoenzyme.

Disclosure of Invention

The invention aims to solve the problem that the quantity and the space interval of nano particles in the existing nano enzyme synthesis cannot be regulated and controlled, and provides a nano enzyme synthesis method which utilizes rolling circle amplification DNA to code the quantity and the space interval of nano particles so as to realize programmable catalytic activity.

One of the objects of the present invention is to provide a nanoenzyme comprising a single-stranded DNA framework having periodically repeating poly-adenine stem-loop units, and gold nanoparticles grown on the stem-loop units of the single-stranded DNA framework.

Another objective of the present invention is to provide a method for synthesizing the nanoenzyme, wherein the method uses a single-stranded DNA framework with periodically repeated poly-adenine stem-loop units as a template, uses the stem-loop units of the single-stranded DNA framework as growth sites, and grows gold nanoparticles on the single-stranded DNA framework to obtain the nanoenzyme.

Another object of the present invention is to provide the nanoenzyme prepared by the method described above.

Another object of the present invention is to provide the use of the nanoenzyme as above as peroxidase.

Compared with the prior art, the invention has the following advantages: the invention regulates and controls the quantity and space interval of metal nano particles in the nano enzyme by designing the sequence of the RCA template, thereby realizing the programmable regulation and control of the catalytic activity of the nano enzyme. Meanwhile, compared with the traditional technology for constructing the nano enzyme based on the DNA modified gold nanoparticles, the nano enzyme constructed by the invention exposes the catalytic surface of the gold nanoparticles to the maximum extent and shows higher catalase catalytic activity.

Drawings

FIG. 1 is a schematic diagram of the process for preparing nanoenzyme of the present invention.

FIG. 2 shows (a) gel electrophoresis images, (b) AFM images, and (c) laser confocal fluorescence images of single-stranded DNA frameworks synthesized by RCA amplification in example 1 of the present invention.

FIG. 3 is (a) AFM image of single-stranded DNA frameworks synthesized by RCA amplification and (b) height statistics, (c) AFM image of synthesized nanoenzymes and (d) height statistics, (e) ratio comparison of single-stranded DNA frameworks of different sizes with nanoenzymes, (f) height comparison of single-stranded DNA frameworks with nanoenzymes, (g) TEM image of nanoenzymes and (h) element distribution analysis and (I) EDX analysis of nanoenzymes in example 1 of the present invention.

FIG. 4 is a TEM image of the nanoenzyme (a) synthesized in example 1 of the present invention (same as FIG. 3g, only different from the observation field), (b) an absorption spectrum, and (c) a dark field micrograph.

FIG. 5 is the TMB color map and chemical reaction equation of the single-stranded DNA framework and nanoenzyme synthesized in example 1 of the present invention.

FIG. 6 shows the optimum pH (a) and the optimum temperature (b) of the catalytic activity of the nanoenzymes synthesized in example 1 of the present invention.

FIG. 7 shows the UV absorption spectrum (a, bottom), TMB color rendering pattern (b, top) and the maximum absorption peak scatter plot (b, bottom) at 652nm of nanoenzymes obtained from different concentrations of gold precursor for the most active nanoenzymes synthesized in example 2 of the present invention.

FIG. 8 shows the synthesis of three single-stranded DNA frameworks (Scaffold) with different sequence lengths for controlling the RCA time in example 3 of the present invention_nAFM maps (a), size distribution statistics maps (c) of 1 to 3), three different nanoenzymes (GNC)_n-1 to 3) TEM images (b), size distribution statistics (d), and a michaelis equation fitting curve (e).

FIG. 9 shows three nanoenzymes (GNC) synthesized in example 3 of the present invention_n-time kinetic spectral absorption curves of the catalyzed TMB color reaction of 1 to 3).

FIG. 10 shows three single-stranded DNA frameworks 1-3 (Scaffold) synthesized according to the present invention_nAFM imaging of-1 to 3) (a to c in sequence) and nanoenzyme 1-3 (GNC)_n-1 to 3) TEM images (d-f in order).

FIG. 11 shows that the length of the spacer sequence of the growth unit is regulated and controlled to synthesize two kinds of nanoenzymes (GNC) according to the invention_n-3 and GNC_n-4) structural schematic diagram and TEM image (a) and particle size distribution statistical diagram (b), absorption spectrum (c), TMB light absorption value change with time graph (d), michaelis equation fitting curve (e) and GNC_n-3 statistical plots (f) of mie constants with Free gold nanoparticles (Free GNPs) and horseradish peroxidase (HRP).

FIG. 12 is a TEM image of nanoenzyme-3 and nanoenzyme-4 synthesized in example 4 of the present invention; wherein a is GNC_nTEM image of-3, panel b is GNC_nTEM image of-4 (larger field of view compared to FIG. 11 a).

FIG. 13 is a schematic diagram of a stem-loop structure formed by the single-stranded DNA template shown in SEQ ID NO. 1.

FIG. 14 is a schematic diagram of a stem-loop structure formed by the single-stranded DNA template shown in SEQ ID NO. 2.

FIG. 15 is a schematic diagram of a stem-loop structure formed by the single-stranded DNA template shown in SEQ ID NO. 3.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The inventor provides a novel method for synthesizing artificial nano enzyme for the first time through countless experimental researches, and the method is characterized in that a long single-strand DNA framework (hereinafter, referred to as DNA framework) with periodically repeated poly-adenine (poly A) stem-loop units is constructed through Rolling Circle Amplification (RCA), the DNA framework is used as a template, the stem-loop units are used as growth sites, and the nano enzyme with programmable catalytic activity is constructed through the quantity and space intervals of the encoded gold nanoparticles. The synthesized nanoenzyme has programmable peroxidase catalytic activity, and can be regulated and controlled by adjusting the sequence length of the framework, the length of the polyA unit spacer sequence, the concentration of the gold precursor and the like.

The invention provides a nano-enzyme, which comprises a single-stranded DNA framework with a periodically repeated poly-adenine stem-loop unit and gold nanoparticles growing on the stem-loop unit of the single-stranded DNA framework.

In some embodiments, the single-stranded DNA framework has a particle size of 50-450 nm.

In some embodiments, the single-stranded DNA framework comprises (i) a loop portion composed of contiguous a bases, (ii) a stem portion formed by complementary pairing of partial sequences at both ends of (i), (iii) a spacer sequence; wherein said (i) and (ii) constitute a stem-loop structure; the number of the A basic groups is X, and X is more than or equal to 10; the base pair number of the complementary pair forming the stem part is Y, and the Y is more than or equal to 2; the number of bases Z in the spacer sequence is 3 to 80 nt.

Wherein, the number of the A basic groups is X, and X is more than or equal to 10; can be 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-100, more than 100; preferably, X is 10 to 50; further preferably, X is 15-30; further preferably, X is 20.

Wherein, for the complementary paired base forming the stem part, the base number is Y, and Y is more than or equal to 2; y is more than or equal to 3, Y is more than or equal to 4, Y is more than or equal to 5, Y is more than or equal to 6, Y is more than or equal to 7, Y is more than or equal to 8, Y is more than or equal to 9, Y is more than or equal to 10, Y is more than or equal to 11, and Y is more than or equal to 12; preferably, Y is 2 to 30; further preferably, Y is 4-20; further preferably, Y is 4 to 10.

Wherein, for the spacer sequence, the number of the basic groups is Z, and the Z is 3-80 nt; can be 3-8, 8-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80 nt; preferably, 4 to 50 nt; further preferably, 8 to 50 nt; even more preferably, 8nt, 21nt, 50 nt; even more preferably, 8 nt.

In some preferred embodiments, the single-stranded DNA framework has the sequence [ CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC]_n、[TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT]_n、[CACGACTAGCTCTGAACACTCTACGCATCCAAAAAAAAAAAAAAAAAAAACGATGCGACGTGAACCTAACCGCCTTGCACT]_nAnd n is more than or equal to 1. Wherein n can be 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-. In the present invention, the number of n in the synthesized single-stranded DNA framework can be controlled depending on the amount of raw materials used, the control of reaction time, the control of enzyme activity, and the like.

Wherein the single-stranded DNA framework comprises repetitive sequences of SEQ ID NO. 7-9, namely CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC (SEQ ID NO.7), TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT (SEQ ID NO.8) and GATTACCACTTCTGATACACCTTACGCATCCAAAAAAAAAAAAAAAAAAAAGGATGCTCTGATACACCTTACATTCACCACT (SEQ ID NO. 9). The sequences of the contained neck ring structural units are respectively selected from any one of SEQ ID NO. 10-12, namely GCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC (SEQ ID NO.10), GGCCAAAAAAAAAAAAAAAAAAAAGGCC (SEQ ID NO.11) and GCATCCAAAAAAAAAAAAAAAAAAAAGGATGC (SEQ ID NO. 12).

In some embodiments, the nanoenzyme has peroxidase-catalytic activity or peroxidase-like catalytic activity.

In some embodiments, the nanoenzyme is one or more of a nanosphere, a nanotube, or a nanorod.

The invention also provides a method for synthesizing the nano enzyme, which takes the single-chain DNA framework with the periodically repeated poly-adenine stem-loop unit as a template, takes the stem-loop unit of the single-chain DNA framework as a growth site, and grows the gold nano particles on the growth site to obtain the nano enzyme.

In some embodiments, the single-stranded DNA framework comprises (i) a loop portion composed of contiguous a bases, (ii) a stem portion formed by complementary pairing of partial sequences at both ends of (i), (iii) a spacer sequence; wherein said (i) and (ii) constitute a stem-loop structure; the number of the A basic groups is X, and X is more than or equal to 10; the base pair number of the complementary pair forming the stem part is Y, and the Y is more than or equal to 2; the number of bases Z of the spacer sequence is 3 to 80nt, preferably 8 to 50 nt.

Wherein, the number of the A basic groups is X, and X is more than or equal to 10; may be from 10 to 100; further preferably, from 10 to 80; further preferably, from 10 to 50; further preferably, from 20 to 40; still more preferably, it is 20.

Wherein, for the complementary paired base forming the stem part, the base number is Y, and Y is more than or equal to 2; y is more than or equal to 3, Y is more than or equal to 4, Y is more than or equal to 5, Y is more than or equal to 6, Y is more than or equal to 7, Y is more than or equal to 8, Y is more than or equal to 9, Y is more than or equal to 10, Y is more than or equal to 11, and Y is more than or equal to 12; preferably, Y is 2-30; further preferably, Y is 4-20; further preferably, Y is 4 to 10.

Wherein, for the spacer sequence, the number of the basic groups is Z, and the Z is 3-80 nt; can be 3-8, 8-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80 nt; preferably, 4 to 50 nt; further preferably, 8 to 50 nt; even more preferably, 8nt, 21nt, 50 nt; still more preferably, 8 nt.

In some preferred embodiments, the single-stranded DNA framework has the sequence [ CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC ]]_n、[TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT]_n、[GATTACCACTTCTGATACACCTTACGCATCCAAAAAAAAAAAAAAAAAAAAGGATGCTCTGATACACCTTACATTCACCACT]_nAnd n is more than or equal to 1. Wherein the single-stranded DNA framework comprises repetitive sequences of SEQ ID NO. 7-9, namely CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC (SEQ ID NO.7), TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT (SEQ ID NO.8) and GATTACCACTTCTGATACACCTTACGCATCCAAAAAAAAAAAAAAAAAAAAGGATGCTCTGATACACCTTACATTCACCACT (SEQ ID NO. 9).

In some embodiments, the single-stranded DNA framework is obtained by rolling circle amplification;

in some embodiments, the step of growing gold nanoparticles comprises: and carrying out reduction reaction on the single-stranded DNA framework and a gold precursor under the action of a reducing agent, so that a gold simple substance grows on a stem-loop unit of the single-stranded DNA framework. The reaction mechanism is that the gold precursor in a free state in the solution is easily enriched on a polyA stem-loop structure, and the gold precursor is reduced into zero-valent gold under the action of a reducing agent, so that simple substance gold nanoparticles are formed on the specific stem-loop structure; and finally synthesizing the nano enzyme by regulating and controlling reaction conditions.

In some embodiments, the step of rolling circle amplification to obtain a single stranded DNA framework comprises: incubating a mixed solution comprising a circular DNA template, DNA polymerase, dNTPs and a buffer solution, and performing rolling circle amplification to obtain the single-stranded DNA framework;

in some embodiments, the gold precursor is a chloroauric acid solution.

In some embodiments, the reducing agent is a weak reducing agent; preferably, the compound is selected from one or more of trisodium citrate, ascorbic acid and hydroxylamine hydrochloride; further preferred is trisodium citrate. The invention adopts weak reducing agent to carry out reduction reaction on the gold precursor, and can control the speed of generating the gold simple substance, the speed of growing on the stem-loop unit and the structure and activity of the generated nano enzyme. If the reducibility of the reducing agent is too strong, impurity gold nanoparticles are easily formed randomly in the solution instead of being incapable of orderly growing in the stem-loop unit.

In some embodiments, the single-stranded DNA framework is present in the reduction reaction system at a final concentration of 0.05 to 0.3 ng/. mu.L; may be 0.05-0.08, 0.08-0.1, 0.1-0.12, 0.12-0.15, 0.15-0.18, 0.18-0.2, 0.2-0.22, 0.22-0.25, 0.25-0.28, 0.28-0.3ng/μ L; preferably, 0.06-0.2 ng/. mu.L; further preferably, 0.08-0.12 ng/. mu.L; further preferably, it is 0.1 ng/. mu.L.

In some embodiments, the final concentration of the gold precursor in the reaction system is 0.2 to 3 mM; may be 0.2-0.5, 0.5-0.8, 0.8-1, 1-1.2, 1.2-1.5, 1.5-1.8, 1.8-2, 2-2.2, 2.2-2.5, 2.5-2.8, 2.8-3 mM; preferably, 0.4-2 mM; further preferably, 0.4-1.2 mM; further preferably, from 0.6 to 1 mM; even more preferably, it is 0.8 mM.

In some embodiments, the reducing agent is at a concentration of 0.5 to 20 mM; may be 0.5-2, 2-4, 4-8, 8-12, 12-16, 16-20 mM; preferably, 2-6 mM; further preferably, it is 4 mM.

In some embodiments, the temperature of the reduction reaction is 20-50 ℃; can be 20-25, 25-30, 30-35, 35-40, 40-45, 45-50 deg.C; preferably, it is from 25 to 45 ℃; further preferably, from 30 to 40 ℃; even more preferably, it is 35 ℃.

In some embodiments, the time for the reduction reaction is 0.5 to 6 hours; can be 0.5-1, 1-1.5, 1.5-2, 2-2.5, 2.5-3, 3-3.5, 3.5-4, 4-4.5, 4.5-5, 5-5.5, 5.5-6 h; preferably, it is 2-4 h; further preferably, 2.5-3.5 h; even more preferably, it is 3 h.

In some embodiments, the circular DNA template is a single-stranded circular DNA.

In some embodiments, the circular DNA template has a final concentration in the rolling circle amplification mix solution of 2-30 nM; preferably, it is 10 nM.

In some embodiments, the DNA polymerase is selected from one or more of phi29 DNA polymerase, Bst 2.0DNA polymerase, Φ 29 polymerase; preferably, phi29 DNA polymerase.

In some embodiments, the final concentration of the DNA polymerase in the mixed solution is 0.5-5U/. mu.L; preferably, it is 2U/. mu.L.

In some embodiments, the dNTPs comprise dATP, dTTP, dCTP, dGTP, each at a concentration of 1.5-4 mM/. mu.L; the concentrations of dATP, dTTP, dCTP and dGTP can be the same or different; preferably, the concentrations of dATP, dTTP, dCTP and dGTP are the same and are all 2.5 mM/. mu.L.

In some embodiments, the buffer is one or more of a sodium phosphate buffer, a TAE buffer, and a TBE buffer; preferably, it is a sodium phosphate buffer.

In some embodiments, the temperature of incubation in the rolling circle amplification is 20-35 ℃; preferably, it is 30 ℃.

In some embodiments, the time of incubation in the rolling circle amplification is 0.5-8 h; preferably, it is 4 h.

In some embodiments, after the rolling circle amplification incubation is completed, a step of performing high temperature denaturation on the DNA polymerase is further included; preferably, the high-temperature denaturation treatment is carried out at 68 ℃ for 15 min; further preferably, the method also comprises the step of removing the polymerase by centrifugation, and the centrifugation condition is 14000rpm/min and 2 min.

In some embodiments, the step of synthesizing the circular DNA template comprises:

(1) carrying out template assembly on single-stranded DNA with the base number of 50-210 bases;

(2) and (3) connecting to form a ring under the action of DNA ligase to obtain the circular DNA template.

In the step (1), the single-stranded DNA is a single-stranded DNA with a modified 5' end, and is specifically one of phosphorylation modification, avidin modification and carboxyl modification. In some preferred embodiments, the single-stranded DNA has a sequence as shown in any one of SEQ ID No.1 to 3; further preferably, the 5' end comprises a modification selected from any one of: phosphorylation modification, avidin modification, and carboxyl modification.

In the step (1), the template assembly means that the single-stranded DNA is subjected to high-temperature treatment in a buffer solution, then slowly cooled to room temperature, and annealed to enable complementary sequences between the single-stranded DNAs to be complementary; preferably, the high temperature treatment is denaturation at 95 ℃ for 5 minutes.

In the step (1), the synthetic DNA framework stem-loop unit spacer sequence is controlled by designing single-stranded DNA.

The single-stranded DNA comprises (i) a loop portion composed of consecutive T bases, (ii) a stem portion formed by complementary pairing of partial sequences at both ends of (i), and (iii) a spacer sequence; wherein said (i) and (ii) constitute a stem-loop structure; the number of the T basic groups is X, and X is more than or equal to 10; the base pair number of the complementary pair forming the stem part is Y, and the Y is more than or equal to 2; the number of bases Z in the spacer sequence is 3 to 80 nt.

Wherein, for T basic groups, the number of the T basic groups is X, and X is more than or equal to 10; may be 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-100, more than 100; preferably, X is 10 to 50; further preferably, X is 15-30; further preferably, X is 20.

In some preferred embodiments, when the spacer sequence is 21nt in length, the single-stranded DNA template sequence is: 5' P-GCATCCGTTTTTTTTTTTTTTTTTTTTCGGATGCGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO. 1).

In FIG. 13, GCATCCG at the 5 ' end of SEQ ID NO.1 was complementarily paired with CGGATGC at the 3 ' end, and twenty-one free base GGGTTAGGGTTAGGGTTAGGG (SEQ ID NO.13) at the 3 ' end formed a 21nt spacer between stem-loop structures in the preparation of single-stranded DNA frameworks.

When the length of the spacer sequence is 8nt, the single-stranded DNA template sequence is: 5' P-ACGTGGCCTTTTTTTTTTTTTTTTTTTTGGCCTAGA (SEQ ID NO. 2); the schematic diagram after looping is shown in fig. 14. In FIG. 14, the 5 'GGCC and 3' GGCC of SEQ ID NO.2 are complementarily paired, and the four free bases ACGT at the 5 'end and TAGA at the 3' end form an 8nt spacer sequence (e.g., TAGAACGT) between the stem-loop structures for preparing single-stranded DNA frameworks.

The sequences of the neck ring structural units contained in the single-stranded DNA template are respectively selected from any one of SEQ ID No. 4-6, namely GCATCCGTTTTTTTTTTTTTTTTTTTTCGGATGC (SEQ ID No.4), GGCCTTTTTTTTTTTTTTTTTTTTGGCC (SEQ ID No.5) and GCATCCTTTTTTTTTTTTTTTTTTTTGGATGC (SEQ ID No. 6).

In the present invention, the single-stranded DNA template mainly comprises 2 parts: the first part is also the most main part-stem-loop structure, which consists of 20nt thymine (T) and partial double-chain structures with different numbers, wherein the base number of the double-chain part of the stem-loop structure is required to be more than or equal to 4nt to ensure the stability of the structure, wherein the 20nt thymine (T) can form a 20nt polyA stem-loop unit structure after being amplified, which is a key position for the nucleation growth of gold nanoparticles in a DNA frame, and if the thymine (T) is replaced by other sequences, the formed stem-loop structure can not realize the nucleation growth effect; the second part, the length of the single-chain sequences at the two ends of the stem-loop directly influences the distance between each polyA stem-loop unit structure, which has a decisive effect on the control of the distance between the gold nano-particles in the nano-enzyme, and further directly influences the catalytic activity of the nano-enzyme.

When the length of the spacer sequence is 50nt, the single-stranded DNA template sequence is: 5' P-AGTGGTGAATGTAAGGTGTATCAGAGCATCCTTTTTTTTTTTTTTTTTTTTGGATGCGTAAGGTGTATCAGAAGTGGTAATC (SEQ ID NO. 3).

The schematic diagram after looping is shown in fig. 15. In FIG. 15, GCATCC at the 5 'end of SEQ ID NO.3 was complementarily paired with GGATGC at the 3' end, and twenty-five free bases were present at each of the 5 'and 3' ends, thereby forming a 50nt spacer between the stem-loop structures for preparing a single-stranded DNA framework. Twenty-five free bases AGTGGTGAATGTAAGGTGTATCAGA (SEQ ID No.14) at the 5 'end and GTAAGGTGTATCAGAAGTGGTAATC (SEQ ID No.15) at the 3' end, forming a 50nt spacer sequence (e.g. GTAAGGTGTATCAGAAGTGGTAATCAGTGGTGAATGTAAGGTGTATCAGA (SEQ ID No.16)) between the stem-loop structures that were prepared to obtain the single stranded DNA framework.

In the step (2), the slow cooling to room temperature means gradually cooling to room temperature within 2 hours.

In the step (2), the ligase is used for generating a phosphodiester bond and is selected from T4 DNA ligase, E.coli DNA ligase and CircLigase^TMII, one or more of single-stranded DNA ligase; preferably, it is T4 DNA ligase.

In the step (2), the temperature of the connection is 10-25 ℃; preferably 16 deg.c.

In the step (2), the connection time is 3-10 h; preferably 5 h.

After ligation with a ligase, the method further comprises (3) a step of denaturing the ligase at an elevated temperature; preferably, the denaturation treatment is carried out by incubation at 65 ℃ for 10 min.

The invention also provides the nano enzyme prepared by the method.

The invention also provides the nano enzyme as described above, which has peroxidase catalytic activity or peroxidase-like catalytic activity; and/or the nano enzyme is one or more of nanospheres, nanotubes or nanorods.

The invention also provides application of the nano enzyme as peroxidase.

In one embodiment, the present invention provides a method for preparing a rolling circle amplification template and a method for synthesizing nanoenzymes by in situ growth thereof, comprising the steps of:

(1) and (3) synthesis of a cyclic template: phosphorylated single-stranded DNA (10. mu.M) (polyA stem-loop spacer length 21nt, template sequence: 5' P-GCATCCGTTTTTTTTTTTTTTTTTTTTCGGATGCGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO: 1)) was mixed with 0.1M phosphoric acidSodium buffer (PBS, 0.1M of NaCl, 10mM of Na)₂HPO₄And NaH₂PO₄pH 7.4), heating at 95 ℃ for 5min and gradually cooling to room temperature within 2 h. Synthesized product and T₄DNA ligase (10U/. mu.L) was incubated at 16 ℃ for 5h, then at 65 ℃ for 10min, and finally gradually cooled to 25 ℃ and the circular template was recovered by polyacrylamide gel electrophoresis purification.

(2) DNA framework synthesis: circular template (10nM), phi29 DNA polymerase (2U/. mu.L) and dNTPs (2.5 mM/. mu.L each) in sodium phosphate buffer (50mM Tris-HCl, 10mM (NH)₄)₂SO₄，10mM MgCl₂And 4mM dithiothreitol) and co-incubation at 30 ℃ for an adjustable incubation time.

(3) The mixed system in (2) was incubated at 68 ℃ for 15min to stop the reaction. After the reaction was completed, the mixture was centrifuged at 14,000g for 2min to remove the denatured enzyme.

(4) The supernatant of (3) was recovered and then dialyzed against a dialysis cartridge (20K MWCO) in deionized water for 48 h. The product was recovered and stored at 4 ℃.

(5) And (3) synthesis of nano enzyme: mixing the obtained DNA frame (0.1 ng/. mu.L) with gold precursor (chloroauric acid solution) of different concentrations, incubating for 5h, and adding reducing agent (trisodium citrate solution, 4mM Na) into the system⁺pH6.0), incubated at 35 ℃ for 3h with continuous shaking.

(6) And (3) purifying the nano enzyme: the synthesized nano enzyme is recovered by centrifugation for 20min at the rotating speed of 10,000g, and the final precipitate is resuspended by deionized water.

In some embodiments, the spacer length of the polyA stem loop is controlled during circular template design (8nt, template sequence: 5 'P-ACGTGGCCTTTTTTTTTTTTTTTTTTTTGGCCTAGA (SEQ ID NO.2)) and (50nt, template sequence: 5' P-AGTGGTGAATGTAAGGTGTATCAGAGCATCCTTTTTTTTTTTTTTTTTTTTGGATGCGTAAGGTGTATCAGAAGTGGTAATC (SEQ ID NO. 3)).

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Unless otherwise indicated, the experimental methods, detection methods, and preparation methods disclosed herein all employ techniques conventional in the art of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related arts.

The present invention will be described in detail with reference to the accompanying drawings.

(1) Synthesis of DNA framework mediated nanoenzyme by RCA amplification

FIG. 1 is a schematic diagram of the synthesis of a coding nano enzyme by rolling circle amplification. Preparing a single-stranded DNA framework with periodically repeated polyA stem-loop units by rolling-loop amplification of an annular template, and carrying out in-situ growth of gold nanoparticles by taking the polyA stem-loop units as nucleation sites to synthesize the nanoenzyme with adjustable space intervals.

(1) And (3) synthesis of a cyclic template: phosphorylated single-stranded DNA (10. mu.M) (polyA stem-loop spacer length 21nt, template sequence: 5' P-GCATCCGTTTTTTTTTTTTTTTTTTTTCGGATGCGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO.1)) was mixed with 0.1M sodium phosphate buffer (PBS, 0.1M of NaCl, 10mM of Na₂HPO₄And NaH₂PO₄pH 7.4), heating at 95 ℃ for 5min and gradually cooling to room temperature within 2 h. The synthesized product andT₄incubating DNA ligase (10U/. mu.L) at 16 ℃ for 5h, incubating at 65 ℃ for 10min, and gradually cooling to 25 ℃ to obtain a circular template; and (4) purifying and recovering the cyclic template by polyacrylamide gel electrophoresis.

(2) RCA reaction synthesis of single-stranded DNA framework: circular template (10nM), phi29 DNA polymerase (2U/. mu.L) and dNTPs (2.5 mM/. mu.L each) in sodium phosphate buffer (50mM Tris-HCl, 10mM (NH)₄)₂SO₄，10mM MgCl₂And 4mM dithiothreitol), incubated at 30 ℃ for 4 h.

(3) The mixed system in (2) was incubated at 68 ℃ for 15min to terminate the reaction, the length of the spacer sequence of the polyA stem loop was controlled to 21nt, and after the reaction was completed, the mixture was centrifuged at 14,000g for 2min to remove the denatured enzyme.

(4) The supernatant of (3) was recovered and then dialyzed against a dialysis cartridge (20K MWCO) in deionized water for 48 h. The product, i.e.the single-stranded DNA framework, was recovered and stored at 4 ℃.

FIG. 2a gel electrophoresis shows the successful preparation of a large size single stranded DNA framework by RCA amplification; FIG. 2b shows AFM results showing amorphous morphology of single-stranded DNA framework, with broadening diameter of 128 + -42 nm and height of 40 + -10 nm; FIG. 2c confocal laser scanning microscopy images show discrete fluorescent spots in RCA amplification products stained with 1 XSSYBR Green, indicating the formation of long single stranded DNA frameworks. These characterization results indicate that the long single-stranded DNA framework can be successfully synthesized by the RCA amplification method.

(5) And (3) synthesis of nano enzyme: after the obtained DNA frame (0.1 ng/. mu.L) was mixed and incubated with 0.8mM gold precursor (chloroauric acid solution) for 5h, a reducing agent (trisodium citrate solution, 500mM Na) was further added to the system⁺pH6.0), and incubated at 35 ℃ for 3h with continuous shaking.

3-4, AFM (FIGS. 3a, c) and TEM (FIGS. 3g, 4a) images show nanoenzymes synthesized by in situ growth of gold nanoparticles using DNA frame as template, with broadening diameter of 167 + -43 nm and height of 55 + -18 nm (FIGS. 3d, f); FIGS. 3b, d, e and f show statistically significant increases in cluster broadening and height before and after the gold growth process, indicating the incorporation of additional materials into the DNA frame after gold growth; the element distribution analysis (fig. 3h) and EDX (fig. 3I) results of the TEM images showed a large amount of Au and P elements in the cluster structure, and the cluster consisted of DNA and gold nanoparticles on the surface. The cluster absorption peak (fig. 4b) is 530nm, red under dark field microscopy (fig. 4c), indicating a red shift in plasmonic properties with respect to the monodisperse gold nanoparticles. In conclusion, the synthesis of the poly alloy nanoparticles, i.e. nanoenzymes, is demonstrated.

Carrying out TMB color reaction on the nanoenzyme, comprising the following steps: usually, a certain amount of TMB (0.2mM), H₂O₂(200mM)、GNC_nThe solution was mixed with 0.2M sodium acetate buffer at a certain pH and temperature. After reacting for 10min, recording the absorbance of the TMB oxidation product at 652nm by an ultraviolet-visible spectrophotometer to monitor the reaction; if the Michaelis constant is measured, the reaction is monitored by recording the dynamic light absorption value of the TMB oxidation product at 652nm along with the time change by an ultraviolet-visible spectrophotometer, and the result is calculated by using a Lineweaver Burk equation.

As shown in the reaction formula in the lower diagram of FIG. 5, the reaction mechanism is based on GNC_nHas catalase catalytic activity, and GNC under low pH condition_nCan catalyze H₂O₂The colorless TMB substrate was rapidly oxidized to produce a blue oxidized oxTMB product, and the solution was observed to exhibit a rapid change from colorless to blue.

As a result, as shown in FIG. 5, TMB color reaction showed that the synthesized nanoenzyme had catalase catalytic activity and the single-stranded DNA framework had no catalase catalytic activity.

The hydrogen peroxide catalytic activity of the nano enzyme under different pH conditions is measured, and the method comprises the following steps: under the same temperature condition, certain amount of TMB (0.2mM), H₂O₂(200mM)、GNC_nThe solutions were mixed with 0.2M sodium acetate buffer at different pH. After 10min of reaction, the reaction was monitored by recording the absorbance of the TMB oxidation product at 652nm by an ultraviolet-visible spectrophotometer.

The results are shown in FIG. 6a, which shows that the optimum pH for the catalytic activity of the nanoenzyme hydrogen peroxide is 3.8.

The method for measuring the hydrogen peroxide catalytic activity of the nano enzyme under different temperature conditions comprises the following steps: adding certain amount of TMB (0.2mM), H₂O₂(200mM)、GNC_nThe solution was mixed with 0.2M sodium acetate buffer at pH 3.8 at different temperatures. After 10min of reaction, the reaction was monitored by recording the absorbance of the TMB oxidation product at 652nm by an ultraviolet-visible spectrophotometer. .

The results are shown in FIG. 6b, which illustrates that the optimum temperature for the catalytic activity of the nanoenzyme hydrogen peroxide is 40 ℃.

Example 2 Effect of different gold precursor concentrations on the quantity of gold nanoparticles in the encoded nanoenzyme and the catalytic Activity of the nanoenzyme

The operation steps are the same as example 1, only the concentrations of the gold precursor (chloroauric acid solution) in the step (5) are respectively adjusted to 0.4mM, 0.6mM, 0.8mM, 1.0mM, 1.2mM and 2.0mM, the number of gold nanoparticles in the synthesized nanoenzyme is controlled, the enzyme activity is regulated and controlled, and the enzymatic activity of the nanoenzyme is measured by TMB color reaction.

The visual image of the nanoenzyme obtained after 3h growth under the same RCA conditions (4h) at different gold precursor concentrations is shown in the upper panel of FIG. 7 a. The ultraviolet absorption spectrum of each nanoenzyme at the wavelength of 400-800nm is shown in the graph below fig. 7a, and it can be seen that the maximum ultraviolet absorption peak of the nanoenzyme gradually red-shifts with the increase of the concentration of the gold precursor, indicating that the size of the nanoenzyme also gradually increases.

Under the same RCA condition (4h), TMB coloration is carried out on the nanoenzyme obtained after the growth for 3h under different concentrations of the gold precursor, and the image observed by naked eyes is shown as the upper image of FIG. 7 b; as shown in the scattergram of the maximum absorption peak at 652nm of each chromogenic solution in FIG. 7b, it was found that a nanoenzyme structure having the best catalytic activity was formed after 0.8mM gold precursor was grown for 3 hours under the same RCA conditions (4 hours). This may be due to the high number of catalytic particles per GNC obtained from sufficient gold precursor. However, as the gold precursor concentration (1.0, 1.2 or 2.0mM) was increased, the catalytic activity of the resulting nanoenzyme decreased, indicating that overgrowth may lead to an increase in the nanoenzyme structure, which is a decrease in relative surface area.

Example 3 Effect of sequence Length of different DNA frameworks on the number of gold nanoparticles encoding nanoenzymes and the enzymatic Activity of the nanoenzymes

The operation steps are the same as example 1, only the RCA reaction time in the step (2) is respectively adjusted to 1h, 2h and 4h, DNA frameworks with different sequence lengths are controlled to be formed, so that the number of gold nanoparticle growth sites (polyA stem loops) is controlled, the concentration of a gold precursor (chloroauric acid solution) in the step (5) is 0.8mM, the number of gold nanoparticles in the final coding nanoenzyme is controlled, and the nanoenzyme 1-3 (GNC) is synthesized_n1 to 3) to realize the regulation and control of the enzyme activity, and the catalytic activity of the nano-enzyme is measured by TMB color reaction.

As shown in the AFM image in FIG. 8a, the broadening of the DNA frame at different RCA times (1, 2 and 4 h; corresponding to the synthetic DNA frame 1-3 and the nanoenzyme 1-3) was 90. + -.32 nm, 126. + -.43 nm and 208. + -.66 nm, respectively (the AFM image of the synthetic DNA frame 1-3 from left to right in the upper panel of FIG. 10, which is larger than the field of view of FIG. 8 a), indicating that the size of the DNA frame can be regulated by the time of RCA. As shown in the TEM image in FIG. 8b, the broadening of nanoenzymes after the gold growth process was 109. + -.36 nm, 140. + -.51 nm, and 234. + -.77 nm, respectively (the TEM image of the synthesized nanoenzymes 1-3 in the sequence from left to right in FIG. 10, with a larger field of view relative to FIG. 8 b), which is positively correlated with the size of the DNA frame before the gold growth. FIG. 9 shows three nanoenzymes (GNC) synthesized in this example_n-1 to 3), the number of gold nanoparticles in the nanoenzyme also increases with nanoenzyme size due to the increase of polyA growth units. The number of gold nanoparticles per nanoenzyme can thus be encoded by the sequence length of the RCA time-controlled DNA framework. As shown in FIG. 8e, the maximum reaction rates of the three nanoenzymes were calculated to be 1.857X 10 respectively^-8，1.536×10^-8And 1.946X 10^-8M.s^-1The Michaelis constant was 0.1058, 0.0519 and 0.0481mM, respectively. In conclusion, the substrate affinity of the nanoenzyme increases with the size of the framework, and the nanoenzyme-3 obtains the maximum substrate affinity, which shows that the number of gold nanoparticles in the nanoenzyme can be regulated and controlled through the length (size) of the framework, so that the catalytic activity of the nanoenzyme can be regulated and controlled。

Example 4 Effect of sequence length between different polyA growth units on spatial separation of encoded gold nanoparticles and Nanocatalytic Activity

The procedure is as in example 1, with only the following parameter conditions being adjusted: in the step (1), when the circular template is designed, the length (8nt, the template sequence: 5 'P-ACGTGGCCTTTTTTTTTTTTTTTTTTTTGGCCTAGA (SEQ ID NO.2)) and (50nt, the template sequence: 5' P-AGTGGTGAATGTAAGGTGTATCAGAGCATCCTTTTTTTTTTTTTTTTTTTTGGATGCGTAAGGTGTATCAGAAGTGGTAATC (SEQ ID NO.3)) of the spacer sequence of the polyA stem loop are respectively controlled, the RCA reaction time in the step (2) is set to be 4h, and a DNA framework template is synthesized; selecting a 0.8mM chloroauric acid solution as a gold precursor, controlling the space interval of gold nanoparticles in the synthesized nano-enzyme, and synthesizing the nano-enzyme 3-4 (GNC)_n-3 to 4), wherein GNC_n-3 corresponding synthesis from the template sequence of SEQ ID NO.2, GNC_n-4 is correspondingly synthesized by a template sequence of SEQ ID NO.3, the regulation and control of the enzyme activity are realized, and the catalytic activity of the nano-enzyme is measured by TMB color reaction.

In FIGS. 11-12, TEM images show that while nanoenzyme-4 (50nt spacing) broadens the distribution to 226. + -.70 nm, comparable to nanoenzyme-3 (8nt spacing), the distribution of gold nanoparticles in nanoenzyme-4 is more discrete; as seen from the absorption spectrum in FIG. 11c, the plasmon resonance peak of nanoenzyme-4 is 528nm, and a blue shift occurs with respect to nanoenzyme-3 with the plasmon resonance peak of 534nm, which indicates that the spatial interval between nanoenzymes can be controlled by controlling the sequence length between polyA growth units in the framework. TMB color reaction (FIG. 11d) and Mie's equation curve (FIG. 11e) fitting both showed nanoenzyme-4 (K)_m0.1136mM) has a lower catalytic activity than nanoenzyme-3 (K)_m0.0481mM), which may be due to a gold precursor concentration of 0.8mM, which is insufficient to overgrow nanoenzyme-3 to mask the catalytic surface. However, the above results still indicate that the catalytic activity of the nanoenzyme can be regulated by regulating the sequence of the framework. And it is worth noting that the catalytic activity of the constructed nano enzyme-3 is obviously superior to that of free gold nanoparticles and horseradish peroxidase.

In conclusion, the method for synthesizing the nanoenzyme by rolling circle amplification can encode the number and the space interval of the gold nanoparticles on the single-stranded DNA framework, and further can be used for constructing the nanoenzyme with programmable catalytic activity. Therefore, the invention effectively overcomes various defects in the prior art and has high industrial utilization value.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which can be made by those skilled in the art without departing from the spirit and technical spirit of the present invention be covered by the claims of the present invention.

Sequence listing

<110> Shanghai Hope Innovation research institute Co., Ltd

<120> method for synthesizing nano enzyme by rolling circle amplification, nano enzyme and application thereof

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcatccgttt tttttttttt tttttttcgg atgcgggtta gggttagggt taggg 55

<210> 2

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acgtggcctt tttttttttt ttttttttgg cctaga 36

<210> 3

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agtggtgaat gtaaggtgta tcagagcatc cttttttttt tttttttttt tggatgcgta 60

aggtgtatca gaagtggtaa tc 82

<210> 4

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcatccgttt tttttttttt tttttttcgg atgc 34

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcctttttt tttttttttt ttttggcc 28

<210> 6

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gcatcctttt tttttttttt ttttttggat gc 32

<210> 7

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccctaaccct aaccctaacc cgcatccgaa aaaaaaaaaa aaaaaaaacg gatgc 55

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tctaggccaa aaaaaaaaaa aaaaaaaagg ccacgt 36

<210> 9

<211> 82

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gattaccact tctgatacac cttacgcatc caaaaaaaaa aaaaaaaaaa aggatgctct 60

gatacacctt acattcacca ct 82

<210> 10

<211> 34

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcatccgaaa aaaaaaaaaa aaaaaaacgg atgc 34

<210> 11

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggccaaaaaa aaaaaaaaaa aaaaggcc 28

<210> 12

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gcatccaaaa aaaaaaaaaa aaaaaaggat gc 32

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gggttagggt tagggttagg g 21

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agtggtgaat gtaaggtgta tcaga 25

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtaaggtgta tcagaagtgg taatc 25

<210> 16

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gtaaggtgta tcagaagtgg taatcagtgg tgaatgtaag gtgtatcaga 50

Claims

1. A nanoenzyme comprising a single-stranded DNA framework having periodically repeating poly-adenine stem-loop building blocks, and gold nanoparticles grown on the stem-loop units of the single-stranded DNA framework.

2. The nanoenzyme of claim 1, comprising at least any one of:

1) the particle size of the single-stranded DNA framework is 50-450 nm;

2) the single-stranded DNA framework comprises (i) a loop part consisting of continuous A bases, (ii) a stem part formed by complementary pairing of partial sequences at both ends of (i), and (iii) a spacer sequence; wherein said (i) and (ii) constitute a stem-loop structure; the number of the A basic groups is X, and X is more than or equal to 10; the base pair number of the complementary pair forming the stem part is Y, and the Y is more than or equal to 2; the number of bases Z of the spacer sequence is 3 to 80 nt;

3) the nanoenzyme has peroxidase catalytic activity or peroxidase-like catalytic activity;

4) the nano enzyme is one or more of nanospheres, nanotubes or nanorods.

3. The nanoenzyme of claim 1 or 2, comprising any one of:

1) x is 10-50;

2) y is 2 to 30;

3) z is 8-50 nt;

4) the sequence of a neck ring structure contained in the single-stranded DNA framework is selected from any one of SEQ ID NO. 10-12; preferably, theThe repetitive sequences contained in the single-stranded DNA framework are respectively selected from any one of SEQ ID NO. 7-9; further preferably, the sequence of the single-stranded DNA framework is selected from [ CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAAAAAAAAAAAAACGGATGC ]]_n、[TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT]_n、[AGTGGTGAATGTAAGGTGTATCAGAGCATCCTTTTTTTTTTTTTTTTTTTTGGATGCGTAAGGTGTATCAGAAGTGGTAATC]_nOne or more of them, wherein n is more than or equal to 1.

4. The method for synthesizing nanoenzyme according to any one of claims 1 to 3, wherein the nanoenzyme is obtained by growing gold nanoparticles on a single-stranded DNA framework having a periodically repeating poly-adenine stem-loop unit as a template and the stem-loop unit of the single-stranded DNA framework as a growth site.

5. The nanoenzyme of claim 4, comprising at least any one of:

1) the particle size of the single-stranded DNA framework is 50-450 nm;

3) the single-stranded DNA framework is obtained by rolling circle amplification;

4) the step of growing gold nanoparticles comprises: carrying out reduction reaction on the single-stranded DNA framework and a gold precursor under the action of a reducing agent to ensure that a gold simple substance is in the single-stranded DNA_FrameGrowth was performed on the stem-loop elements of the scaffold.

6. The method of synthesis of claim 5, comprising any one of:

1) x is 10-50;

2) y is 2 to 30;

3) z is 8-50 nt;

4) the sequence of a neck ring structure contained in the single-stranded DNA framework is selected from any one of SEQ ID NO. 10-12; preferably, the repetitive sequences contained in the single-stranded DNA framework are respectively selected from any one of SEQ ID NO. 7-9; further the sequence of the single-stranded DNA framework is selected from [ CCCTAACCCTAACCCTAACCCGCATCCGAAAAAAAAA ]_AAAAAAAAAAACGGATGC]_n、[TCTAGGCCAAAAAAAAAAAAAAAAAAAAGGCCACGT]_n、[GATTACCACTTCTGATACACCTTACGCATCCAAAAAAAAAAAAAAAAAAAAGGATGCTCTGATACACCTTACATTCACCACT]_nOne or more of the above; wherein n is more than or equal to 1.

7. The method of synthesis of claim 5, comprising at least any one of:

1) the step of obtaining the single-stranded DNA framework by rolling circle amplification comprises the following steps: incubating a mixed solution comprising a circular DNA template, DNA polymerase, dNTPs and a buffer solution, and performing rolling circle amplification to obtain the single-stranded DNA framework;

2) the gold precursor is a chloroauric acid solution;

3) the reducing agent is a weak reducing agent; preferably, the compound is selected from one or more of trisodium citrate, ascorbic acid and hydroxylamine hydrochloride; further preferably, trisodium citrate;

4) the concentration of the reducing agent is 0.5-20 mM; preferably, 4 mM;

5) the final concentration of the single-stranded DNA framework in a reduction reaction system is 0.05-0.3 ng/mu L; preferably, 0.1 ng/. mu.L;

6) the final concentration of the gold precursor in the reaction system is 0.2-3 mM; preferably, 0.8 mM;

7) the temperature of the reduction reaction is 20-50 ℃; preferably, it is 35 ℃;

8) the time of the reduction reaction is 0.5-6 h; preferably, it is 3 h.

8. The method of synthesis of claim 7, comprising at least any one of:

1) the circular DNA template is single-stranded circular DNA;

2) the final concentration of the circular DNA template in the rolling circle amplification mixed solution is 2-30 nM; preferably, 10 nM;

3) the DNA polymerase is one or more of phi29 DNA polymerase, Bst 2.0DNA polymerase and phi29 polymerase; preferably, phi29 DNA polymerase;

4) the final concentration of the DNA polymerase in the mixed solution is 0.5-5U/mu L; preferably, 2U/. mu.L;

5) the dNTPs comprise dATP, dTTP, dCTP and dGTP, and the concentration of the dNTPs is 1.5-4 mM/mu L respectively; preferably, 2.5 mM/. mu.L, respectively;

6) the buffer solution is one or more of sodium phosphate buffer solution, TAE buffer solution and TBE buffer solution; preferably, a sodium phosphate buffer;

7) the temperature of the rolling circle amplification is 20-35 ℃; preferably, it is 30 ℃;

8) the time of rolling circle amplification is 0.5-8 h; preferably, 4 h;

9) after the rolling circle amplification is completed, the method also comprises the step of performing high-temperature denaturation on the DNA polymerase; preferably, the high-temperature denaturation treatment is carried out at 68 ℃ for 15 min; further preferably, the method also comprises the step of removing the polymerase by centrifugation, and the centrifugation condition is 14000rpm/min and 2 min.

9. The method of synthesis of claim 7, wherein the step of synthesizing the circular DNA template comprises:

(1) carrying out template assembly on single-stranded DNA with the base number of 50-210 bases; the single-stranded DNA comprises (i) a loop part consisting of consecutive T bases, (ii) a stem part formed by complementary pairing of partial sequences at both ends of (i), and (iii) a spacer sequence; wherein said (i) and (ii) constitute a stem-loop structure; the number of the T basic groups is X, and X is more than or equal to 10; (iii) the number Y of free bases is 3-80 nt;

10. The method of synthesis of claim 9, comprising at least any one of:

1) in the step (1), X is 10-50;

2) in the step (1), Y is 2-30;

3) in the step (1), Z is 8-50 nt;

4) in the step (1), the template assembly means that the single-stranded DNA is subjected to high-temperature treatment in a buffer solution, then slowly cooled to room temperature, and annealed to enable complementary sequences between the single-stranded DNAs to be complementary; preferably, the high temperature treatment is denaturation at 95 ℃ for 5 minutes;

5) in the step (2), the slow cooling to the room temperature means gradually cooling to the room temperature within 2 hours;

6) in the step (2), the ligase is used for generating a phosphodiester bond and is selected from T4 DNA ligase, E.coli DNA ligase and CircLigase^TMII, one or more of single-stranded DNA ligase; preferably, T4 DNA ligase;

7) in the step (2), the temperature of the connection is 10-25 ℃; preferably 16 ℃;

8) in the step (2), the connection time is 3-10 h; preferably 5 h;

9) in the step (2), after the ligation by the ligase, the method further comprises the step (3) of denaturing the ligase at a high temperature; preferably, the denaturation treatment is carried out by incubation at 65 ℃ for 10 min.

11. The method of synthesis according to claim 9,

in the step (1), the single-stranded DNA is a single-stranded DNA with a modified 5' end, and specifically is one of phosphorylation modification, avidin modification and carboxyl modification; further preferably, the sequence of the single-stranded DNA is shown in any one of SEQ ID NO. 1-3.

12. The nanoenzyme prepared by the method of any one of claims 3 to 11.

13. The nanoenzyme of claim 12, wherein the nanoenzyme has peroxidase-catalytic activity or peroxidase-like catalytic activity; and/or the nano enzyme is one or more of nanospheres, nanotubes or nanorods.

14. Use of a nanoenzyme according to any one of claims 1 to 3, 12 or 13 as a peroxidase.