CN114716549B - Construction method of camel-peak phage display nano antibody - Google Patents

Abstract

The invention discloses a construction method of camel-hump source phage display nano antibody, based on phage display technology, after antibody is generated by using hump-hump immune preparation reaction, the hump-hump source phage display nano antibody is loaded on a phage display carrier, the characteristic that a phage display antibody library can be used for screening to obtain specific antibody is utilized, the prepared antibody is screened to obtain hCD47nb nano antibody with good binding capacity for CD47, and the prepared hCD47nb can effectively promote the phagocytosis capacity of macrophage on cancerated cells, thereby avoiding the inhibition of CD47 on the phagocytosis of macrophage, meanwhile, the hCD47nb nano antibody prepared by the invention is basically not bound with human erythrocytes, can not cause the aggregation of erythrocytes, has small influence on human bodies, and therefore has excellent service performance and market prospect.

Description

Construction method of camel-peak phage display nano antibody

Technical Field

The invention relates to the technical field of biomedicine, in particular to a construction method of a hump-source phage display nano antibody.

Background

In recent years, cancer gradually becomes one of malignant diseases seriously harming the health of people in China, and the incidence rate is frequently innovative. However, in the conventional cancer treatment methods, surgical resection has the most direct and the most rapid curative effect, but has risks in the surgical process, is only suitable for the early cancer stage, and has high surgical risks on sensitive parts and important organs and low success rate; chemotherapy does not face the risk of operation, but has the disadvantages of long time consumption and great side effect on human bodies; the gradually-rising targeted therapy in recent years gradually enters the visual field of people due to the advantages of relatively low dosage and small side effect on human bodies. The research shows that the surface of the cancer cell has a large amount of CD47 protein expression, and the immune escape can be realized by combining macrophage SIRPa protein to start an 'eat me' signal path. If the interaction between the two is blocked, the CD47 protein is used as a target to block, and the immune escape of cancer cells can be prevented. However, further research has revealed that human erythrocytes also express CD47 protein in large quantities, so that after ordinary antibody drugs are infused into a human body, erythrocytes aggregate, and severe anemia side effects occur, even death occurs. Therefore, there is a need for a method for producing antibodies that can rapidly screen specific antibodies, that are directed against only the cancer cell surface CD47 protein and that do not bind to the erythrocyte surface protein, and that can rapidly produce high affinity antibodies.

Disclosure of Invention

The invention aims to provide a construction method of a hump camel phage display nano antibody, to solve the problems set forth in the background art described above.

In order to solve the above-mentioned technical problems, the invention provides the following technical scheme: a construction method of a camel-hump-origin phage display nano-antibody is characterized by comprising the following steps:

s1, constructing a phage library;

s2, panning the phage library;

s3, phage ELISA detection;

s4, expressing hCD47nb;

s5, the hCD47nb which is highly combined with the PATU8988T is screened in a flow mode.

Further, in step S5, the selected hcds 47nb highly binding to PATU8988T are 5 hcds 47nb of A1, C6,2D,2E and 5H, respectively;

further, the DNA sequence of A1 is shown as SEQ ID NO. 1;

further, the DNA sequence of the 2D is shown as SEQ ID NO. 2;

further, the DNA sequence of 2E is shown as SEQ ID NO. 3;

further, the DNA sequence of C6 is shown in SEQ ID NO. 4;

further, the DNA sequence of the 5H is shown as SEQ ID NO. 5.

Further, in the step S1, the construction of the phage library includes the following steps:

s11, selecting healthy bactrian camels for immunization, and collecting blood before primary immunization to reserve negative serum;

s12, primary immunization:

selecting a CD47 antigen, mixing the antigen with complete Freund's adjuvant, emulsifying, and performing subcutaneous multipoint injection on the camel to inoculate the antigen to each camel; after inoculation, collecting peripheral blood and detecting immune response;

s13, second immunization:

mixing CD47 antigen with Freund's complete adjuvant, emulsifying, and performing subcutaneous multipoint injection on camels to inoculate antigen to each camel; after inoculation, collecting peripheral blood and detecting immune response;

s14. Third, fourth and fifth immunization:

repeating the operation of the step S13 for 3 times to finish the third, fourth and fifth immunoreactions of the camel, collecting 50mL of peripheral blood after the fifth immunization is finished, and detecting the immunoreactions;

s15, measuring the antigen immunity titer by adopting a camel VHH specific secondary antibody in a chemiluminescence way;

s16. Isolation of lymphocytes: after 5 times of immunization, collecting whole blood, separating lymphocytes by using percoll, cracking the lymphocytes by using TRIZOL, collecting RNA, performing reverse transcription to form cDNA, and amplifying the cDNA by two rounds of PCR (polymerase chain reaction) through a nested PCR method to obtain an antibody heavy chain variable region VHH gene fragment;

s17 transfer of VHH fragments into TG1 competent cells:

the VHH fragment obtained above was ligated to pADL-23C phage display vector plasmid, then the VHH fragment and pADL-23C vector ligase were ligated, and electrotransformed into TG1 competent cells to prepare a phage library.

Further, in the steps S12 and S13, the volume ratio of the complete Freund' S adjuvant to the antigen is (0.8-1.2): 1.

CD47 is an integrin-associated protein, which is usually expressed on the surface of cancer cells, and in macrophage cancer cell phagocytosis, the CD47 protein is combined with the protein SIRP alpha on the macrophage, so that the phagocytosis of the macrophage on the cancer cells is inhibited, and the cancer cells can rapidly proliferate and spread.

The CD47 antigen expressed by cancer cells is inoculated into a humped camel body, after the humped camel body generates an antibody, RNA in the generated antibody cell is transcribed into a cDNA library by utilizing a phage display technology, partial DNA of a peptide segment of a heavy chain and a light chain combined antigen of the antibody is amplified by a PCR technology, and then prepared exogenous DNA is inoculated into the genome of the phage, so that the phage can express related protein peptide segments on the surface of the phage, and then the CD47 antigen is mixed, and at the moment, the related protein peptide segments expressed on the surface of the phage can be rapidly combined with the CD47 antigen due to the effect on the CD47 antibody, so that related S21 can be coated on an immune tube by the screening antigen, slowly rotate overnight at 4 ℃, and simultaneously, 5 percent of skimmed milk powder is coated in parallel to serve as a control; then the liquid in the overnight coated immune tube is discarded, adding PBS buffer solution, washing the immune tube at room temperature for 2-3 times, and rotating for 4-6min each time;

s22, adding 5% of skimmed milk powder into the immune tube again, rotating and sealing the immune tube at room temperature for 2 hours, discarding liquid in the immune tube after sealing is finished, adding PBS (phosphate buffer solution) to clean the immune tube at room temperature for 2-3 times, rotating for 3-8min each time, adding the PBS, adding the phage library prepared in the step S1, and rotating and incubating at room temperature for 1-1.5 hours;

s23, removing liquid in the immune tube, adding PBST buffer solution to clean the immune tube for 8-10 times at room temperature, removing residual liquid as much as possible, adding Gly-HCl eluent, performing rotary elution at room temperature for 8-10 min, then adding Tris-HCl for neutralizing a buffer solution for neutralization, transferring the solution in the immune tube to a new centrifugal tube, and obtaining a first round of screened phage eluate;

s24, taking the phage eluate of the first round to infect the TG1 strain, and carrying out 10 times of infection in a centrifugal tube ⁵ And 10 ⁶ Diluting with two times of gradient and culturing;

s25, repeating the steps S21-S24 to carry out a second round of panning, and culturing the panned strains.

Further, in step S23, the PBST buffer is a PBS buffer in which Tween20 is dissolved at a mass fraction of 0.1%.

Further, in the step S3, phage ELISA assay comprising the steps of:

s31, selecting the strains subjected to the two rounds of panning for monoclonal culture, adding M13KO7 helper phage when the OD reaches 0.4-0.6, culturing at 25 ℃ overnight, centrifuging and collecting the supernatant

S32, preparing the CD47 into coating liquid with the concentration of 1-5 ng/mu L, inoculating the coating liquid into an ELISA plate, coating the ELISA plate with the CD47 antigen, and coating overnight at 4 ℃;

s33, discarding the coating solution, washing for 2-3 times by using PBST buffer solution, adding skim milk with the mass concentration of 5% into each hole, sealing for 1-1.5h at 37 ℃, washing for 3 times by using PBST buffer solution, adding the supernatant of the phage culture solution into each hole again, and incubating for 1-1.5 hours;

s34, washing the mixture for 3-5 times by using PBST buffer solution, adding an anti-M13 antibody which is diluted by 10000 times by using PBS buffer solution and labeled by horseradish peroxidase, and incubating the mixture for 1-1.5h;

s35, washing for 4-6 times by using PBST buffer solution, adding TMB color development solution for color development, reacting for 5-10min at 37 ℃, adding stop solution to stop the reaction, and testing optical density at the wavelength of 450 nm;

s36, observing the color reaction, detecting whether the prepared phage has the corresponding antibody, and carrying out the next step after color development.

Further, in the step 32, the inoculation amount of the coating solution of the ELISA plate is 100-300 muL/hole; in the step e, the addition amount of the TMB color development liquid is 100-300 mu L/hole, and the addition amount of the stop solution is 20-50 mu L/hole.

Further, in the step S4, the hCD47nb is expressed by using a cell-free protein synthesis kit (product number: profac _ hyd 0510000) provided by kan biotechnology limited, and the method comprises the following steps:

a. preparation of 5' seq primer: the 5' seq primer consists of an upstream primer F1 and a downstream primer R1,

<xnotran> F1 : </xnotran> GGTGATGTCGGCGATATAGG;

the gene sequence of the downstream primer R1 is as follows: ACCAGAACCGTGGTGGTGG;

b. preparation of 3' seq primer: the 3' seq primer consists of an upstream primer F2 and a downstream primer R2;

wherein the upstream primer F2 has the gene sequence of TAAATAAGGATTAATTACTTGGATGCC;

the gene sequence of the downstream primer R2 is TTATTGCTCAGCGGTGGC;

c. preparation of hCD47nb primer: the hCD47nb primer consists of an upstream primer F3 and a downstream primer R3;

wherein the gene sequence of the upstream primer F3 is as follows:

ATCACCACCACCATCACGGGAGCGGCATGGCGGCCCAGCCGGCCATGGCA；

the gene sequence of the downstream primer R3 is as follows:

GGCATCCAAGTAATTAATCCTTATTTACAGATCCTCTTCTGAGATGAGTTTT；

d. preparation of 5 'seq, 3' seq and primer α with hCD47nb primer:

adding 2 muL of purified products of 5 'seq, 3' seq and hCD47nb primers in a 50 muL PCR reaction system, and performing fusion PCR amplification reaction by using an upstream primer F1 and a downstream primer R1;

e. protein expression: adding the primer alpha prepared in the step d into a water-soluble protein factory Rxn reaction system in a proportion of 1/45 v/v, uniformly mixing and adjusting the total reaction system to be 10 mL, placing the reaction solution in a disposable shake flask, mixing uniformly, sealing or covering a cover on a breathable film, and reacting on a shaking table at 30 ℃ and 220 rpm for overnight;

f. magnetic bead purification: preparing protein factory reaction liquid, centrifuging at the speed of 4000rpm for 3min under the environment of 4 ℃, and collecting supernatant; then taking His-Monster beads, washing twice by using Binding Buffer, magnetically collecting the beads, adding the beads into the collected supernatant, fully shaking for 30-45s, and rotationally mixing for 1-3h at the temperature of 4 ℃; magnetically collecting beads of the incubated sample, and absorbing and discarding the supernatant; then adding Washing buffer, fully shaking for 30-45s, magnetically collecting beads, absorbing and discarding supernatant, and repeatedly Washing for 4-6 times; and adding Elution buffer into the beads, sucking and blowing the mixture by using a gun head, uniformly mixing, standing for 1-3min, then magnetically sucking the beads, collecting Elution supernatant, namely hCD47nb antibody protein, repeating the extraction for 5-8 times to extract the hCD47nb antibody protein, and reserving for screening.

Further, the Binding buffer is a buffer solution with pH of 8 and dissolved with 20-30 mM Tris-HCl and 500-700 mM NaCl; the Washing buffer is a buffer solution with pH 8 and dissolved with 20-30 mM Tris-HCl, 500-700 mM NaCl and 20-40 mM Imidazole; the Elution buffer is a buffer solution with pH 8 and dissolved with 20-40 mM Tris-HCl, 500-700 mM NaCl and 250-500 mM Imidazole.

Further, in the step S5, the flow screening of the hCD47nb with high binding to PATU8988T includes the following steps:

s51, digesting PATU8988T human pancreatic cancer cells by pancreatin, counting, re-suspending the cells, and preparing cell suspension;

s52, taking the cell suspension, adding different hCD47nb proteins, and incubating for 30-45min at 4 ℃;

s53, adding 400-fold dilution of Myc-Tag (9B 11) Mouse mAb, and incubating for 30min at 4 ℃;

s54, adding PBS, and centrifuging for 4-5min to obtain PBS for resuspension cells;

s55, taking PBS to resuspend the cells, and screening on a flow machine to obtain the hCD47nb antibody protein with high binding force with PATU8988T cells.

Compared with the prior art, the invention has the following beneficial effects: based on the phage display technology, after an antibody is generated by using a hump-camel immune preparation reaction, the antibody is loaded on a phage display carrier, the characteristic that a specific antibody can be obtained by screening a phage display antibody library is utilized, the prepared antibody is screened, and the hCD47nb nano antibody with good binding capacity for CD47 is obtained, and the prepared hCD47nb can effectively promote the phagocytosis capacity of macrophages on cancerated cells, so that the inhibition of the phagocytosis of the macrophages by CD47 is avoided.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the principles of the invention and not to limit the invention. In the drawings:

FIG. 1 is a graph of first round Elisa results;

FIG. 2 is a graph of second round Elisa results;

FIG. 3 is a graph showing the results of flow screening for the ability to bind to PATU8988T cells;

FIG. 4 is a combined energy diagram of A1 and PATU 8988T;

FIG. 5 is a combined energy diagram of C6 and PATU 8988T;

FIG. 6 is a combined energy diagram of 2D and PATU 8988T;

FIG. 7 is a combined energy diagram of 2E and PATU 8988T;

FIG. 8 is a combined energy diagram of 5H and PATU 8988T;

FIG. 9 is a graph of the binding energy of A1 with BXPC-3;

FIG. 10 is a graph of the binding energy of C6 with BXPC-3;

FIG. 11 is a graph of the binding energy of 2D and BXPC-3;

FIG. 12 is a graph of the binding energy of 2E with BXPC-3;

FIG. 13 is a diagram of the binding energy of 5H with BXPC-3;

FIG. 14 is a binding energy diagram of A1 and SW 1990;

FIG. 15 is a binding energy diagram of C6 and SW 1990;

FIG. 16 is a binding energy diagram of 2D and SW 1990;

FIG. 17 is a binding energy diagram of 2E and SW 1990;

FIG. 18 is a binding energy diagram of 5H and SW 1990;

FIG. 19 is a binding energy diagram of A1 and BGC 823;

FIG. 20 is a combination energy diagram of C6 and BGC 823;

FIG. 21 is 2D and BGC823 a binding energy diagram of;

FIG. 22 is a binding energy diagram for 2E and BGC 823;

FIG. 23 shows 5H and BGC823 a binding energy diagram of;

FIG. 24 is a binding energy diagram of A1 with HT 29;

FIG. 25 is a chart of the binding capacity of C6 to HT 29;

FIG. 26 is a diagram of the binding capacity of 2D with HT 29;

FIG. 27 shows 2E vs HT29 a binding energy diagram of;

FIG. 28 is a binding energy diagram of 5H and HT 29;

FIG. 29 is a graph of the binding capacity of A1 to erythrocytes;

FIG. 30 is a graph of the binding capacity of C6 to red blood cells;

FIG. 31 is a 2D binding energy diagram with erythrocytes;

FIG. 32 is a graph of the binding capacity of 2E to erythrocytes;

FIG. 33 is a binding energy diagram of 5H with red blood cells;

FIG. 34 is a graph showing the effect of coagulation of donor1 red blood cells;

FIG. 35 is a graph showing the effect of coagulation of donor2 red blood cells;

FIG. 36 is a graph showing the effect of coagulation of donor3 red blood cells;

FIG. 37 is a graph showing the effect of coagulation of donor4 red blood cells;

FIG. 38 is a graph showing the results of ELISA assay;

FIG. 39 is a graph showing the phagocytic effect of mouse-derived macrophages on PATU8988T cells;

FIG. 40 is a graph showing the phagocytic effect of PATU8988T cells by human-derived macrophages;

figure 41 is the effect of 5 hCD47nb on phagocytic effect of murine macrophages;

FIG. 42 is a graph of the affinity results for A1;

FIG. 43 is a graph of affinity results for C6;

FIG. 44 is a graph of affinity results for 2D;

FIG. 45 is a graph of affinity results for 2E;

FIG. 46 is a graph of the affinity results for 5H.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

It is noted that, herein, relational terms such as first and second, and the like may be used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions. Also, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

The embodiment is as follows:

and S1. Antibody repertoire constructing;

s11, selecting healthy bactrian camels for immunization, 5mL of blood is collected before primary immunization and is reserved as negative serum;

s12, primary immunization:

selecting CD47 antigen, mixing with antigen 1:1 with Freund's complete adjuvant, emulsifying, and performing subcutaneous multipoint injection on camels with inoculation amount of 0.5mg antigen inoculated to each camel; after inoculation, collecting 5ml of peripheral blood, and detecting the immune response;

s13, second immunization:

mixing CD47 antigen with complete Freund's adjuvant 1:1, emulsifying, and performing subcutaneous multipoint injection on camels with inoculation amount of 0.2mg antigen inoculated to each camel; after inoculation, collecting 5ml of peripheral blood, and detecting the immune response;

s14, immunization for the third, fourth and fifth times:

repeating the operation of the step S13 for 3 times, finishing the third, fourth and fifth immunoreactions of the camel, collecting 50mL of peripheral blood after the fifth immunization, and detecting immunoreactions;

s15, determining the antigen immunity titer by adopting a01861 camel VHH specific secondary antibody of Kingsler;

s16. Isolation of lymphocytes: after 5 times of immunization, collecting 200mL of whole blood, separating lymphocytes by using percoll, cracking the lymphocytes by using TRIZOL, collecting RNA, performing reverse transcription to obtain cDNA, and amplifying the cDNA by two rounds of PCR (polymerase chain reaction) through a nested PCR method to obtain an antibody heavy chain variable region VHH gene fragment; performing first round of PCR amplification, recovering 500-750bp PCR bands, selecting and using the recovered complete heavy chain antibody and gene fragment of the heavy chain variable region thereof as a template, and performing second round of PCR amplification by using VHH two-round primers to obtain a VHH target gene fragment;

s17, transferring the VHH target gene segment into TG1 competent cells: the VHH fragment obtained above was ligated to pADL-23C phage display vector plasmid (digested with Bgl 1), then VHH fragment and pADL-23C vector ligase were ligated and electrotransformed into TG1 competent cells.

S2, panning the phage library;

s21, coating the immune tube with the screened antigen, slowly rotating overnight at 4 ℃, and simultaneously coating 5% of skimmed milk powder in parallel as a control; then, liquid in the immune tube coated with the liquid is discarded, 3ml of PBS buffer solution is added to wash the immune tube at room temperature for 3 times, and the immune tube is rotated for 5min each time;

and S22, adding 2ml of 5% skimmed milk powder into the immune tube again, rotating and sealing at room temperature for 2h, discarding liquid in the immune tube after sealing is finished, adding 2ml of PBS buffer solution, cleaning the immune tube at room temperature for 3 times, rotating for 5min each time, adding 2ml of PBS buffer solution, adding 1ml of the phage library prepared in the step S1, and rotating and incubating at room temperature for 1h:

s23, discarding liquid in the immune tube, adding 2ml of PBST buffer solution to clean the immune tube for 9 times at room temperature, removing residual liquid as much as possible, adding 500 muL of Gly-HCl eluent, carrying out rotary elution at room temperature for 8min, then adding 500 muL of Tris-HCl neutralizing buffer solution for neutralization, transferring the solution in the immune tube to a new 1.5ml centrifugal tube, and obtaining a first round of screened phage eluent;

s24, taking the phage eluate of the first round to infect the TG1 strain, and carrying out 10 times of infection in a centrifugal tube ⁵ And 10 ⁶ Diluting with two times of gradient and culturing;

and S25, repeating the steps S21-S22 to perform a second round of panning, and culturing the panned strains.

S3, phage ELISA detection;

s31, selecting the strains subjected to the two rounds of panning for monoclonal culture, adding M13KO7 helper phage when the OD reaches 0.5, culturing at 25 ℃ overnight, centrifuging and collecting the supernatant

S32, preparing the CD47 into coating liquid with the concentration of 1 ng/[ mu ] L, inoculating the enzyme-linked immunosorbent assay (ELISA) plate, coating the ELISA plate with the CD47 antigen overnight at 4 ℃, wherein the inoculation amount of a coating solution of the ELISA plate is 100 mu L/hole;

s33, discarding the coating solution, washing for 3 times by using PBST buffer solution, adding 300 mu L of skimmed milk with the mass concentration of 5% into each hole, sealing for 1h at 37 ℃, washing for 3 times by using the PBST buffer solution, adding 100 mu L of phage culture solution supernatant into each hole again, and incubating for 1h;

s34, washing the mixture for 5 times by using PBST buffer solution, adding an anti-M13 antibody which is diluted by 10000 times by using PBS buffer solution and labeled by horseradish peroxidase, and incubating for 1h;

s35, washing for 6 times by using a PBST buffer solution, adding a TMB (tetramethylbenzidine) color development solution for color development, reacting for 7min at 37 ℃, adding a stop solution to stop the reaction, and testing the optical density at a wavelength of 450 nm; wherein the addition amount of the TMB color development liquid is 100 mu L/hole, and the addition amount of the stop solution is 50 mu L/hole;

s36, observing the color reaction, detecting whether the prepared phage has the corresponding antibody, and carrying out the next step after color development, wherein the color development result is shown in figures 1 and 2.

S4, expressing hCD47nb;

hCD47nb is expressed by using a cell-free protein synthesis kit (product number: profac _ hyd 0510000) provided by Kangma (Shanghai) Biotechnology Ltd;

s41, preparing a 5' seq primer: the 5' seq primer consists of a D2P _1.08e _Fprimer and a GSG-8HIS _R,

wherein the D2P _1.08e \Fgene sequence is: GGTGATGTCGGCGATATAGG;

the GSG-8HIS _Rgene sequence is ACCAGAACCGTGGTGGTGG

S42, preparing a 3' seq primer: the 3 'seq primer consists of a D2P _3' UTR _Fprimer and a D2P _1.08e _Rprimer; wherein the gene sequence of D2P _3' UTR _Fis TAAATAAGGATTAATTACTTGGATGCC

The D2P _1.08e \ R gene sequence is TTATTGCTCAGCGGTGGC

S43, preparation of hCD47nb primer: the hCD47nb primer consists of an F primer and a D primer;

wherein the gene sequence of the F primer is as follows:

ATCACCACCACCATCACGGGAGCGGCATGGCGGCCCAGCCGGCCATGGCA；

the gene sequence of the R primer is as follows:

GGCATCCAAGTAATTAATCCTTATTTACAGATCCTCTTCTGAGATGAGTTTT；

wherein the PCR reaction conditions of the 5 'seq primer and the 3' seq primer are as follows:

the PCR reaction conditions of the hCD47nb primer are as follows:

s44, preparing 5 'seq, 3' seq and primer alpha with hCD47nb primer:

preparing a D2P _1.08e \ u F primer and a D2P _1.08e \ -u R primer,

wherein the gene sequence of the D2P _1.08e_F primer is as follows: GGTGATGTCGGCGATATAGG; the gene sequence of the D2P _1.08e \ u R primer is TTATTGCTCAGCGGTGGC;

then, adding 2 muL of purified products of 5 'seq, 3' seq and hCD47nb fragments in a 50 muL PCR reaction system, and carrying out fusion PCR amplification reaction by using a D2P _1.08e_F primer and a D2P _1.08e _Rprimer;

wherein the PCR reaction conditions are as follows:

s45. Protein expression: d, adding the primer alpha prepared in the step d into a water-soluble protein factor Rxn reaction system in a ratio of 1/45 v/v, uniformly mixing, adjusting the total reaction system to be 10 mL, placing the reaction solution into a disposable shake flask, uniformly mixing, sealing or covering a cover on a breathable film, and reacting on a shaking table at 30 ℃ and 220 rpm overnight;

s46, magnetic bead purification: preparing 1.5mL of protein factory reaction solution, centrifuging at 4000rpm for 3min at 4 ℃, and collecting supernatant; then, taking 1000 microliter of His-Monster beads, washing twice by using 5ml Binding Buffer, magnetically collecting the beads, adding the beads into the collected supernatant, fully shaking for 30s, and carrying out rotary mixing for 1h at the temperature of 4 ℃; magnetically collecting beads of the incubated sample, and absorbing and discarding the supernatant; adding 1000 mul Washing buffer, fully shaking for 30s, magnetically collecting beads, absorbing and discarding supernatant, and repeatedly Washing for 5 times; adding 500 mu.l of Elution buffer into beads, sucking and blowing the mixture by using a gun head, uniformly mixing, standing for 1min, magnetically sucking the beads, collecting Elution supernatant, namely hCD47nb protein, repeating the extraction for 5-8 times to extract the hCD47nb protein, and reserving for screening;

wherein the Binding buffer is a buffer solution with pH 8 and 20 mM Tris-HCl dissolved therein and 500 mM NaCl; the Washing buffer is a buffer solution with pH 8 and dissolved with 20 mM Tris-HCl, 500 mM NaCl and 20 mM Imidazole; the Elution buffer is a buffer solution of 20 mM Tris-HCl, 500 mM NaCl, 250 mM Imidazole and pH 8.

S5, screening hCD47nb highly bound to PATU8988T by flow method:

s51, trypsinizing the PATU8988T human pancreatic cancer cells, counting and resuspending the cells into a cell suspension with the density of 1 × 105/50 μ L;

s52, adding 10 mu g of different hCD47nb proteins into 50 mu L of cell suspension, and incubating for 30min at 4 ℃;

s53, adding Myc-Tag (9B 11) Mouse mAb (1;

s54, adding 2ml PBS and 400g, and centrifuging for 5min to obtain PBS for resuspension cells;

s55, taking 100 mu l of PBS to resuspend cells, screening on a flow machine to obtain hCD47nb protein with high binding force with PATU8988T cells, and screening A1, C6, 1C, 1D, 2A, 2D,2E, 2F, 3G, 4C, 4G, 5B, 5D, 5H, 6C, 6F, 6G, 7H, 8A, 8H, 9G, 10C, 10F, 11A, 11D, 11B and 12F by taking no hCD47nb as a negative control; wherein the first round of Elisa result diagram naming rules are numbers + letters, and the second round of Elisa result diagram naming rules are letters + numbers;

and 5 groups of hCD47nb with better performance were selected from the group, namely A1, C6,2D,2E and 5H, and the results are shown in FIG. 3.

And (3) detection:

one flow test method for the binding capacity of 5 kinds of hCD47nb to different tumor cells is as follows:

pancreatin digestion of different tumor cells including PATU8988 human pancreatic cancer cell, SW1990 human pancreatic cancer cell, BXPC-3 human pancreatic cancer cell, BGC823 human gastric adenocarcinoma cell, HT29 human colon cancer cell, counting, resuspension cell, configuring at a density of 1 × 10 ⁵ 50 μ l of cell suspension; 50 mul of 5 kinds of hCD47nb proteins with different concentrations are added into 50 mul of cell suspension, after incubation for 30min at 4 ℃, 2ml PBS and 400g are added for centrifugation for 5min to obtain the resuspended cells, the hCD47nb is not added on a flow machine as a negative control group, the binding capacity is tested, and the result is shown in the attached figures 2-6.

According to FIGS. 4-8, the 5 kinds of hCD47nb screened out finally have better binding ability with SW1990 human pancreatic cancer cells;

from FIGS. 9-13, it can be seen that the 5 hCD47nb screened finally have better binding ability with SW1990 human pancreatic cancer cells;

according to FIGS. 14-18, it can be found that the 5 kinds of hCD47nb screened finally have better binding ability with BXPC-3 human pancreatic cancer cells;

according to the results in FIGS. 19-23, the 5 kinds of hCD47nb screened out finally have better binding ability with BGC823 human gastric adenocarcinoma cells;

according to the results in FIGS. 24-28, it can be found that the 5 hCD47nb finally screened has better binding ability with HT29 human colon cancer cells;

from the above, it can be seen that the finally screened 5 kinds of hCD47nb have better binding ability to human cancer cells, and the IC50 is also relatively small.

Secondly, the binding capacity of 5 hCD47nb and erythrocytes were detected by flow method, and the detection results are as follows:

resuspending red blood cells at a density of 1 × 10 ⁵ 50 μ l of red blood cell suspension; adding 50 mul of 5 kinds of hCD47nb proteins with different concentrations into 50 mul of erythrocyte suspension, incubating for 30min at 4 ℃, adding 400-fold diluent of Myc-Tag (9B 11) Mouse mAb, and incubating for 30min at 4 ℃; adding 2ml PBS,400g and centrifuging for 5mObtaining PBS for resuspension of cells in vitro, taking 100 μ l PBS for resuspension of cells, performing flow-type machine, using no hCD47nb as negative control, using CD47-APC flow antibody as positive control, and detecting the binding capacity of 5 hCD47nb prepared with the red blood cells, wherein the detection results are shown in FIGS. 27-31.

From FIGS. 29-33, it can be seen that A1, C6,2D and 2E do not bind substantially to erythrocytes, while 5H binds to erythrocytes at higher concentrations.

Thirdly, the method comprises the following steps: 5 hCD47nb were detected to cause erythrocyte aggregation by the following method:

resuspending the red blood cells with PBS, setting Donor1, donor2, donor3 and Donor4 experimental groups, and preparing 2% red blood cell suspension according to the red blood cell volume; the starting amount of 5 hCD47nb was 80 μ g, after which it was diluted in 2-fold gradients for 8 concentration gradients. Hu5F9 as a positive control with a maximum concentration of 100. Mu.g/ml, followed by 2-fold gradient dilution; adding 50 mu L of the antibodies with different concentrations into a round bottom 96-well plate, then adding 50ul of the 2% erythrocyte suspension, uniformly mixing, and standing at room temperature; observing whether an agglutination phenomenon exists after 2 hours; the results are shown in FIGS. 34 to 37.

Conclusion the method comprises the following steps: antibodies added to the 96-well plate from left to right were A1, C6,2d,2e,5h and Hu5F9, respectively. Wherein the Hu5F9 positive control group can obviously cause erythrocyte agglutination, the PBS represents a blank control group, the erythrocytes in the holes are in small round dots, and the edges are neat and do not cause agglutination; 5 hCD47nb did not cause agglutination of red blood cells, and the red blood cells in the wells were small round dots with neat edges. The 5 hCD47nb were shown to be relatively safe and not damaging to erythrocytes.

ELISA detects the affinity of 5 kinds of hCD47nb by the following method:

CD47 antigen coated ELISA plate (100 ng/ml, 100. Mu.l/well), 4 ℃ coated overnight; discard coating solution, wash 3 times with TBST, add 100 μ l 5% BSA per well, block 3h at 4 ℃; washing 3 times with TBST, adding 100. Mu.l of 5 kinds of hCD47nb per well, and incubating 2h at 4 ℃; washed 5 times with TBST, added with horseradish peroxidase-labeled anti-Myc antibody (diluted with TBST at 1: the concentration of the suspension was 100. Mu.l/well, incubating 1h at 4 ℃; the plates were washed 5 times with TBST. Adding TMB color development liquid for color development, and reacting at room temperature for 30min at 100 μ L/hole; the reaction was stopped by adding stop solution in an amount of 50. Mu.l/well, and the optical density was measured at a wavelength of 450nm, the results are shown in FIG. 38.

And (4) conclusion: the 5 hCD47nb and CD47 antigens all have better binding capacity.

And fifthly, the RTCA detects the capacity of 5 kinds of hCD47nb for enhancing the phagocytosis of tumor cells by macrophages according to the following detection method:

separately isolating mouse-derived macrophages and human-derived macrophages and polarizing the macrophages, then adding 50. Mu.l of culture medium to the wells of E-Plate 16, measuring the baseline to ensure that the well Plate is normally usable, and adding 50. Mu.l (20000 cells) of PATU8988T cell suspension and 100. Mu.l (4000. Mu.l cells) of macrophage suspension to the wells; after being placed in an ultra-clean bench at room temperature for 30min, placing the cell in a culture box for RTCA detection to detect phagocytosis of tumor cells by macrophages; the results are shown in FIGS. 39-40.

And (4) conclusion: all 5 hCD47nb can promote phagocytosis of PATU8988T tumor cells by mouse-derived macrophages and human-derived macrophages.

And sixthly, detecting the phagocytosis capacity of the 5 hCD47 nb-promoted murine macrophages by the following detection method:

spreading mouse-derived macrophage on a 24-well plate (1 × 10) ⁵ Culturing the cells overnight; PATU8988T cells were pre-labeled with 2.5. Mu.M CFSE, counted and added 4X 10 ⁵ Adding 1.6 μ g of A1, C6,2D,2E,5H and a positive control Hu5F9 into macrophages, setting a negative control, after 2h, carrying out trypsinization for 1min, removing adherent tumor cells, washing for 2 times by PBS, and carrying out fluorescence photographing; the results are shown in FIG. 41.

And (4) conclusion: compared with the control, all 5 hCD47nb can promote phagocytosis of PATU8988T tumor cells by murine macrophages.

Seventhly, five kinds of hCD47nbI affinity detection are carried out by the following detection method:

capturing Human CD47/Biotinylated with SA probe in PBS solution and reacting well with the sample; the solid phase conjugate obtained from the above reaction was analyzed by dissociation in PBS buffer, and the results were analyzed by data analysis software to obtain the binding rate, dissociation rate, and affinity constant, and the results of the detection are shown in fig. 42 to 46 and tables 1 to 5.

Sample(s)	Concentration (nM)	Affinity constant (M)	Binding constant (1/Ms)	Dissociation constant (1/s)	Square of R
						A1
	500	6.22E-09	1.08E+04	6.73E-05	0.9996
						A1	250	6.22E-09	1.08E+04	6.73E-05	0.9996
A1	125	6.22E-09	1.08E+04	6.73E-05	0.9996
						A1	62.5	6.22E-09	1.08E+04	6.73E-05	0.9996
A1	31.25	6.22E-09	1.08E+04	6.73E-05	0.9996

TABLE 1 affinity results for A1

Sample (I)	Concentration (nM)	Affinity constant (M)	Binding constant (1/Ms)	Dissociation constant (1/s)	<xnotran> R </xnotran>
						C6	500	9.25E-09	1.89E+04	1.75E-04	0.9986
C6	250	9.25E-09	1.89E+04	1.75E-04	0.9986
						C6	125	9.25E-09	1.89E+04	1.75E-04	0.9986
C6	62.5	9.25E-09	1.89E+04	1.75E-04	0.9986
						C6	31.25	9.25E-09	1.89E+04	1.75E-04	0.9986

TABLE 2 affinity results for C6

Sample (I)	Concentration (nM)	Affinity constant (M)	Binding constant (1/Ms)	Dissociation constant (1/s)	Square of R
						2D
	500	2.57E-09	7.43E+03	1.91E-05	0.9996
						2D	250	2.57E-09	7.43E+03	1.91E-05	0.9996
2D	125	2.57E-09	7.43E+03	1.91E-05	0.9996
						2D	62.5	2.57E-09	7.43E+03	1.91E-05	0.9996
2D	31.25	2.57E-09	7.43E+03	1.91E-05	0.9996

Table 3.2D affinity results

Sample (I)	Concentration (nM)	Affinity constant (M)	Binding constant (1/Ms)	Dissociation constant (1/s)	Square of R
						2E
	500	1.98E-09	1.07E+04	2.11E-05	0.9993
						2E	250	1.98E-09	1.07E+04	2.11E-05	0.9993
2E	125	1.98E-09	1.07E+04	2.11E-05	0.9993
						2E	62.5	1.98E-09	1.07E+04	2.11E-05	0.9993
2E	31.25	1.98E-09	1.07E+04	2.11E-05	0.9993

Table 4.2 affinity results for E

Sample (I)	Concentration (nM)	Affinity constant (M)	Binding constant (1/Ms)	Dissociation constant (1/s)	Square of R
						5H
	500	3.74E-09	2.21E+04	8.25E-05	0.9978
						5H	250	3.74E-09	2.21E+04	8.25E-05	0.9978
5H	125	3.74E-09	2.21E+04	8.25E-05	0.9978
						5H	62.5	3.74E-09	2.21E+04	8.25E-05	0.9978
5H	31.3	3.74E-09	2.21E+04	8.25E-05	0.9978

Affinity results of Table 5.5H

And (4) conclusion: the 6 curves in FIG. 40 are the results of antibody measurements with different concentration gradients (sensorA 7 for antibody with a concentration of 500nM, sensorB7 for antibody with a concentration of 250nM, sensorC7 for antibody with a concentration of 125nM, sensorD7 for antibody with a concentration of 62.5nM, sensorE7 for antibody with a concentration of 31.25nM, and sensorF7 for antibody with a concentration of 0 nM), with the abscissa of the time axis (0-1000 s) and the ordinate of the time axis during the experimentMachine-read reaction value (Response). According to the experimental design, 594.5 s-599.5 s is zero treatment for the starting point of the binding signal, and the complete experimental flow of the interaction is Baseline (Baseline) 600 s, binding 180 s, and dissociation 300 s. See the cut lines in the figure. The binding constant (1/Ms) was obtained from the change of the machine-read value with time during the binding. The dissociation constant (1/s) can be obtained from the change of the reading value with time during the dissociation process. According to the formula: affinity constant = dissociation constant/association constant, the affinity constants of CD47 antibodies can be determined using different concentrations. The detection results under various concentration gradients are consistent, and the experimental results are reliable (refer to the fitted curve in the figure and the following table, R2>0.99). The results show that: the 5 hCD47nb antibodies all have affinity constants less than 1x10 ^-9 (nM grade), 1x10 superior to most existing antibodies ^-8 And the affinity constant is higher than that of the prior art.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Zxfoom

<110> Hangzhou Ronggu Biotechnology Ltd

<120> construction method of camel-derived phage display nano antibody

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 353

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaggtgcagc tgctggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60

tcctgtacag cctctgaaaa caacctcgct acgaagttcg tgggctggtt ccgccaggct 120

ccaggaaagg agcgcgagag ggtcgcagcc atttttgttg ggagtggttt cacatcgtat 180

gccgactccg tgaagggccg gttcaccatc tcccgggaca acgccaagaa cacggtctat 240

ctgcaaatga acagcctgac acctgaggac actgccatgt actactgttc gacaggaggg 300

actctggccc tacaaagtta ctggggccag gggacccagg tcaccgtctc ctc 353

<210> 2

<211> 353

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaggtgcagc tggtggagtc tgggggaggc tcggtgcagg ctggagggtc tctgtggctc 60

tcctgtacag cctctggatc ggacctcgct acgaagttcg tgggctggtt ccgccaggct 120

ccagggaagg agcgcgagag ggtcgcagcc atttttcttg ggactggttt cacatcgtat 180

gccgactccg tgaagggccg gttcaccatc tcccgggaca acgccaagaa cacggtctat 240

ctgcaaatga acagcctgac acctgaggac actgccatgt actactgttc gacaggaggg 300

actctggccc tacaaagtta ctggggccag gggacccagg tcaccgtctc ctc 353

<210> 3

<211> 353

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gatgtgcagc tgcaggagtc tggaggaggc tcggtgcagg ctggagggtc tctgagactc 60

tcctgtaaag tctctgaata caacatcgct agcaagttcg tgggctggtt ccgccaggct 120

ccagggaagg agcgcgagag ggtcgcagcc atttttgttg ggactggttt cacatcgtat 180

gccgactccg tgaagggccg gttcaccatt tctcgggaca acgccaagaa tatggtctat 240

ctgcaaatga acagcctgac acctgaggac actgccatgt actactgttc gacaggaggg 300

actctggccc tacaaagtta ctggggccag gggacccagg tcaccgtctc ctc 353

<210> 4

<211> 353

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gatgtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60

tcctgtacag cctctggatc caacctcgct accaagttcg tgggctggtt ccgccaggct 120

ccagggaagg agcgcgagag ggtcgcagcc atttttgttg ggagtggtat cacatcgtat 180

gccgactccg tgaagggccg gttcaccatc tcccgggaca acgccaagaa cacggtctat 240

ctgcaaatga acagcctgac acctgaggac actgccatgt actactgttc cacaggaggg 300

actctggccc tacaaagtta ctggggccag gggacccagg tcaccgtctc ctc 353

<210> 5

<211> 377

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gatgtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggaggaac tctgggactc 60

tcctgtgcgg cctctggatt cacgtttgct ggctactgca tggcgtggtt ccgccaggct 120

ccagggaagg agcgcgagag ggtcgcagtg ctttatcctg gtgatggtac ggcagtctat 180

gccgacgccg tgcagggccg attcaccatc tcccaagaca acgccaagaa cacgctgtat 240

ctgcaaatga acagcctgaa aactgaggac actgccgtgt actactgtgc ggcaggaagg 300

aggccaaacg gtggtacctg tttgccttcg agtcgttata actactgggg ccagggggcc 360

caggtcaccg tctcctc 377

Claims (9)

1. A CD47 nanobody, characterized by: the CD47 nano antibody is any one of A1, C6,2D,2E and 5H;

wherein the DNA sequence of A1 is shown as SEQ ID NO. 1;

wherein the DNA sequence of the 2D is shown as SEQ ID NO. 2;

wherein the DNA sequence of the 2E is shown as SEQ ID NO. 3;

wherein the DNA sequence of the C6 is shown as SEQ ID NO. 4;

wherein the DNA sequence of the 5H is shown as SEQ ID NO. 5.

2. The CD47 nanobody of claim 1, wherein: the construction method of the CD47 nano antibody comprises the following specific steps:

s1, constructing a phage library;

s2, panning the phage library;

s3, phage ELISA detection;

s4, expressing hCD47nb;

s5, the hCD47nb which is highly combined with the PATU8988T is screened in a flow mode.

3. The method of claim 2A CD47 nanometer antibody is disclosed, which comprises a CD47 nanometer antibody, the method is characterized in that: in step S1, the construction of the phage library includes the following steps:

s11, selecting healthy bactrian camels for immunization, and collecting blood before primary immunization to reserve negative serum;

s12, primary immunization:

selecting a CD47 antigen, mixing the antigen with complete Freund's adjuvant, emulsifying, and performing subcutaneous multipoint injection on the camel to inoculate the antigen to each camel; after inoculation, peripheral blood is collected, detecting the immune response;

s13, second immunization:

mixing CD47 antigen with Freund's complete adjuvant, emulsifying, and performing subcutaneous multipoint injection on camels to inoculate antigen to each camel; after inoculation, collecting peripheral blood and detecting immune response;

s14. Third, fourth and fifth immunization:

repeating the operation of the step S13 for 3 times to finish the third, fourth and fifth immunoreactions of the camel, collecting 50mL of peripheral blood after the fifth immunization is finished, and detecting the immunoreactions;

s15, measuring the antigen immunity titer by adopting a camel VHH specific secondary antibody in a chemiluminescence way;

s16. Isolation of lymphocytes: after 5 times of immunization, collecting whole blood, separating lymphocytes by using percoll, cracking the lymphocytes by using TRIZOL, collecting RNA, performing reverse transcription to form cDNA, and amplifying the cDNA by two rounds of PCR (polymerase chain reaction) through a nested PCR method to obtain an antibody heavy chain variable region VHH gene fragment;

s17 transfer of VHH fragments into TG1 competent cells:

the VHH fragment obtained above was ligated to pADL-23C phage display vector plasmid, then the VHH fragment and pADL-23C vector ligase were ligated, and electrotransformed into TG1 competent cells to prepare a phage library.

4. The CD47 nanobody of claim 3, wherein: in the steps S12 and S13, the volume ratio of the complete Freund' S adjuvant to the antigen is (0.8-1.2): 1.

5. The CD47 nanobody of claim 2, wherein: in the step S2, the phage library panning comprises the following steps:

s21, coating the immune tube with the screened antigen, slowly rotating overnight at 4 ℃, and simultaneously coating 5% of skimmed milk powder in parallel as a control; then, liquid in the immune tube coated with the liquid is discarded, PBS buffer solution is added to wash the immune tube for 2-3 times at room temperature, and the immune tube is rotated for 4-6min each time;

s22, adding 5% of skimmed milk powder into the immune tube again, rotating and sealing the immune tube at room temperature for 2 hours, discarding liquid in the immune tube after sealing is finished, adding PBS (phosphate buffer solution) to clean the immune tube at room temperature for 2-3 times, rotating for 3-8min each time, adding the PBS, adding the phage library prepared in the step S1, and rotating and incubating at room temperature for 1-1.5 hours;

s23, discarding liquid in the immune tube, adding PBST buffer solution to clean the immune tube for 8-10 times at room temperature, removing residual liquid as much as possible, adding Gly-HCl eluent, carrying out rotary elution for 8-10 min at room temperature, then adding Tris-HCl neutralizing buffer solution to neutralize, transferring the solution in the immune tube to a new centrifugal tube, and obtaining a first round of screened phage eluent;

s24, taking the phage eluate of the first round to infect the TG1 strain, and carrying out 10 times of infection in a centrifugal tube ⁵ And 10 ⁶ Diluting with two times of gradient and culturing;

s25, repeating the steps S21-S24 to carry out a second round of panning, and culturing the panned strains.

6. The CD47 nanobody of claim 5, wherein: in step S23, the PBST buffer is a PBS buffer in which Tween20 with a mass fraction of 0.1% is dissolved.

7. The CD47 nanobody of claim 2, which is characterized by: in the step S3, the phage ELISA detection comprises the following steps:

s31, selecting the strains subjected to the two rounds of panning for monoclonal culture, adding M13KO7 helper phage when the OD reaches 0.4-0.6, culturing at 25 ℃ overnight, centrifuging and collecting the supernatant

S32, preparing the CD47 into coating liquid with the concentration of 1-5 ng/mu L, inoculating the coating liquid into an ELISA plate, coating the ELISA plate with the CD47 antigen, and coating overnight at 4 ℃;

s33, discarding the coating solution, washing the coating solution for 2-3 times by using a PBST buffer solution, adding skim milk with the mass concentration of 5% into each hole, sealing the skim milk at 37 ℃ for 1-1.5 zxft 8978, washing the coating solution for 3 times by using the PBST buffer solution, adding the supernatant of the phage culture bacterium solution into each hole again, and incubating for 1-1.5 hours;

s34, washing the mixture for 3-5 times by using PBST buffer solution, adding 10000 times of horseradish peroxidase-labeled anti-M13 antibody diluted by using PBS buffer solution, and incubating the mixture for 1-1.5h;

s35, washing for 4-6 times by using PBST buffer solution, adding TMB color development solution for color development, reacting at 37 deg.C for 5-10min, adding stop solution to stop reaction, and measuring optical density at 450nm wavelength;

s36, observing the color reaction, detecting whether the prepared phage has the corresponding antibody, and carrying out the next step after color development.

8. The CD47 nanobody of claim 7, wherein: in the step 32, the inoculation amount of the coating solution of the ELISA plate is 100-300 mu L/hole; in the step S35, the addition amount of the TMB color developing solution is 100-300 mu L/hole, and the addition amount of the stop solution is 20-50 mu L/hole.

9. The CD47 nanobody of claim 2, wherein: in the step S5, the flow screening of hCD47nb highly bound to PATU8988T comprises the following steps:

s51, digesting PATU8988T human pancreatic cancer cells by pancreatin, counting, re-suspending the cells, and preparing a cell suspension;

s52, taking the cell suspension, adding different hCD47nb proteins, and incubating for 30-45min at 4 ℃;

s53, adding 400-fold diluent of Myc-Tag (9B 11) Mouse mAb, and incubating for 30min at 4 ℃;

s54, adding PBS, and centrifuging for 4-5min to obtain PBS for resuspension cells;

s55, taking PBS to resuspend the cells, and screening on a flow machine to obtain the hCD47nb antibody protein with high binding force with PATU8988T cells.

Images