CN114703308B

CN114703308B - Primer probe composition for detecting canine platycerus and babesia, nucleic acid detection kit and preparation method thereof

Info

Publication number: CN114703308B
Application number: CN202210485643.4A
Authority: CN
Inventors: 田永帅; 杨帆; 朱青; 刘嘉男; 刘万建; 宋金铃; 左雪梅
Original assignee: Qingdao Hightop Biotech Co ltd; Shandong Kanghua Biomedical Technology Co ltd
Current assignee: Qingdao Hightop Biotech Co ltd; Shandong Kanghua Biomedical Technology Co ltd
Priority date: 2022-05-06
Filing date: 2022-05-06
Publication date: 2023-05-26
Anticipated expiration: 2042-05-06
Also published as: CN114703308A

Abstract

The invention provides a primer probe composition for detecting canine platyedge insects and babesia, a nucleic acid detection kit and a preparation method thereof, wherein the primer probe composition comprises an upstream primer for detecting canine platyedge insects, a downstream primer for detecting canine platyedge insects, a fluorescent probe for detecting canine platyedge insects, an upstream primer for detecting canine babesia, a downstream primer for detecting canine babesia, a fluorescent probe for detecting canine babesia, an upstream primer for external reference, a downstream primer for external reference and a fluorescent probe for external reference. The primer and the probe have high conservation and do not have cross reaction with other pathogens. The nucleic acid detection kit has strong specificity and high sensitivity.

Description

Primer probe composition for detecting canine platycerus and babesia, nucleic acid detection kit and preparation method thereof

Technical Field

The invention relates to the technical field of nucleic acid detection, in particular to a primer probe composition for detecting canine platyedge worms and babesia, a nucleic acid detection kit and a preparation method thereof.

Background

Sheet-shaped winged insect for dogsAnaplasma platys) Is a pathogen causing periodic thrombocytopenia of dogs, mainly dogs in tropical and warm areas are susceptible to disease, which is a kind of diseaseA widely spread disease, the genus leather is considered to be a transmission vehicle for canine sheet-like marginalis. Symptoms of the sheet-like side worm infection include fever, anorexia, somnolence, clotting abnormality, moderate anemia and the like. Current methods for the diagnosis of sheet-like side worms include blood smears, serum diagnostics and molecular diagnostics.

The canine babesia is due to babesia Bei Sichong%Babesiagibsoni) A serious blood protozoal disease caused by parasitizing erythrocytes of a host dog can cause symptoms such as fever, anemia, jaundice, splenomegaly, hemoglobinuria, visual mucosa pallor and the like, and can be accompanied with acute renal failure, acute respiratory distress syndrome, disseminated intravascular coagulation, liver diseases and nervous syndrome. The babesia belongs to the order PiropriodaPiroplasmida) Bei Sike Bao Bei SikeBabesiidae) Babesia genus ]Babesia) Ticks are used as intermediate hosts and transmission media, and are widely popular throughout the world. The current diagnosis methods for babesia canis include clinical diagnosis, blood routine examination, urine examination, blood smear examination, etc.

The best way to diagnose the canine sheet-like and babesia is currently molecular diagnosis, especially by polymerase chain reaction (polymerase chain reaction, PCR), a more sensitive and specific technique. However, the existing PCR detection kit for the canine leaf-like limit insects and babesia has the following technical defects: the primer probe has poor conservation and the detection sensitivity of the kit is low; the sheet-shaped limit insects and the babesia canis cannot be detected at the same time, which is time-consuming and labor-consuming.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a primer probe composition for detecting the canine platyceros and babesia, a nucleic acid detection kit and a preparation method thereof, and the following aims are achieved: the conservation and the detection sensitivity of the primer probe are improved, and the sheet-shaped limit insects and babesia canis can be detected simultaneously, thereby being convenient and quick.

In order to achieve the above object, the present invention adopts the following technical scheme:

the sequences of the primers probe of the canine leaf-like side worms, the babesia and the external reference are respectively designed, and nine sequences are provided as follows:

upstream primer for detecting canine leaf-like limit insects: 5'-gcctaccaaggcagtgatctat-3', SEQ ID NO. 1.

Downstream primers for detection of canine leaf beetles: 5'-cccattgtccaatattccccactg-3', SEQ ID NO. 2.

Fluorescent probe for detecting canine leaf-like limit insects: 5'-cagccacactggaactgagatacggtc-3', SEQ ID NO:3, wherein the probe is labeled at the 5 'end with a FAM fluorescent group and at the 3' end with a BHQ1 quenching group.

Upstream primer for detecting babesia canis: 5'-ccgtgctaattgtagggctaatac-3', SEQ ID NO. 4.

Downstream primers for detection of babesia canis: 5'-gctgccttccttagatgtggt-3', SEQ ID NO. 5.

Fluorescent probe for detecting babesia canis: 5'-tttggcggcgtttattagttctaaacctccc-3', SEQ ID NO. 6, wherein the probe is labeled with a CY5 fluorophore at the 5 'end and a BHQ2 quencher at the 3' end.

The outer reference upstream primer: 5'-cccatgtggatgcttcttatagtc-3', SEQ ID NO. 7.

Downstream primer of external reference: 5'-ccatccaatcagtgtcgaagagaa-3', SEQ ID NO. 8.

Fluorescent probe for external reference: 5'-ctgcactaaactggatcgcttggttcc-3', SEQ ID NO 9, wherein the probe is labeled with a VIC fluorophore at the 5 'end and a BHQ1 quencher at the 3' end.

In the amplification reaction system, the final concentration of each component is as follows:

the final concentration of the PCR Buffer in the reaction system is 1×;

the final concentration of the primers SEQ ID NO. 1 and SEQ ID NO. 2 for detecting the canine leaf-like side worms in the reaction system is 0.2 mu M;

the final concentration of the primers SEQ ID NO. 4 and SEQ ID NO. 5 for detecting the babesia in the reaction system is 0.2 mu M;

the final concentration of the probe SEQ ID NO. 3 for detecting the canine sheet-like side worms, the probe SEQ ID NO. 6 for detecting the babesia and the primer probe SEQ ID NO. 7-SEQ ID NO. 9 for external reference in the reaction system is 0.2 mu M;

the final concentration of the enzyme mixture in the reaction system was 1×.

The reaction procedure for the combined detection of the canine leaf-like side worms and babesia nucleic acid is as follows: the first step: 2 min at 50 ℃, the second step: 94 ℃ for 5 min, the third step: 95 ℃ for 15s, the fourth step: and (3) 30s at 60 ℃, wherein the third step and the fourth step are cycled 40 times, and fluorescent signals are collected in the fourth step.

Through the design, a pair of specific primer probes for the canine platycladus, a pair of specific primer probes for the canine babesia and a pair of specific primer probes for external reference are obtained.

Meanwhile, the PCR reaction system and the reaction program can be adjusted according to the basic requirements of real-time fluorescence quantitative PCR, and the detection requirements can be met.

The reaction system and the reaction program designed by the invention optimize the amplification conditions of the reaction system and the reaction program, and realize the following beneficial effects of the combined detection kit for the canine sheet-like margarita and the babesia nucleic acid:

(1) According to the invention, the primer probe is designed in a region with high conservation of genes of the canine leaf-like margarita and the babesia, and the designed primer and probe have high conservation and do not have cross reaction with other pathogens. The kit has the characteristics of strong specificity and high sensitivity.

(2) The gene sequences of the canine distemper, the canine babesia and the external reference in the kit are specific, three fluorescent probes are respectively marked by three different fluorescent groups, and the respective fluorescent signals cannot interfere with each other, so that the detection specificity is ensured.

(3) The introduced external reference can monitor whether the reaction system has the phenomenon of reaction inhibition, thereby avoiding false negative caused by the reaction inhibition, avoiding misdiagnosis caused by inaccurate detection result and obviously improving the detection accuracy.

(4) The method is simple to operate, time-saving and labor-saving, has low reagent consumable cost, can directly detect the nucleic acid extracted from the suspected diseased dog blood sample, has low requirements on a detection platform and an artificial technology, and can be widely popularized in conventional detection. The invention can simultaneously realize the detection of two pathogens, namely the canine leaf-like margarita and the canine babesia, thereby greatly shortening the detection time and reducing the detection cost. And the subsequent treatment is not needed after the PCR, the operation is simpler and faster, and the method is safe and pollution-free.

Drawings

FIG. 1 is a standard graph of fluorescence quantification for detecting canine sheet-like limit insects by using the kit of the invention;

FIG. 2 is a standard graph of fluorescence quantification for babesia canis detection using the kit of the present invention;

FIG. 3 shows the detection of 1X 10 in example 3 using the kit of the invention ³ Amplification graph of the cobies/mL concentration of the canine distichthys platyphylla synthetic plasmid;

FIG. 4 shows the detection of 1X 10 in example 3 using the kit of the invention ³ Amplification plot of cobies/mL concentration of babesia canis synthetic plasmid;

FIG. 5 is a diagram showing the results of a specific experiment for detecting the canine distemper using the kit of the present invention in example 4;

FIG. 6 is a graph showing the results of a specific experiment for detecting babesia canis using the kit of the present invention in example 4.

Detailed Description

The present invention will be specifically described with reference to the following examples. It should be understood that these embodiments are merely illustrative of the present invention and are not intended to limit the scope of the present invention. Furthermore, it should be noted that after reading what is stated in the present invention, those skilled in the art can make various technical changes or modifications to the present invention through the technical common knowledge, and these equivalent forms are also within the scope defined in the appended claims of the present application.

Example 1 primer probe composition for detection of canine distichondrin and babesia

Specific sequences of primer probe compositions for detecting canine sheet-like side worms and babesia are shown in table 1:

TABLE 1

The primer probe is entrusted to be synthesized by Shanghai biological engineering technology Co.

Example 2 nucleic acid detection kit for detecting canine distichondria and babesia and preparation method thereof

The nucleic acid detection kit for detecting the canine distemper and the babesia comprises 1 tube of PCR reaction liquid, 1 tube of enzyme mixed liquid, 1 tube of negative control and 1 tube of positive control.

The PCR reaction liquid comprises a PCR reaction Buffer and a primer probe composition for detecting the canine platycercosis and babesia; the sequences of the primer probe compositions used to detect the canine distichia and babesia are shown in table 1. Enzyme mixed solution: comprises Taq polymerase and UDGase; mixing solution and PCR reaction Buffer: purchased from fei peng biosystems, inc.

Negative control: TE buffer.

Positive control: the canine sheet-like marginata detection target gene sequence (SEQ ID NO: 10), the babesia detection target gene sequence (SEQ ID NO: 11) and the external reference detection target gene sequence (SEQ ID NO: 12) are respectively inserted into pUC 57 vector plasmids, and the canine sheet-like marginata artificial synthetic plasmids, the babesia artificial synthetic plasmids and the external reference artificial synthetic plasmids are respectively obtained through amplification culture, identification and plasmid extraction. Mixing the three synthetic plasmids to obtain positive control, wherein the concentrations of the canine platycladi synthetic plasmid, the babesia synthetic plasmid and the external reference synthetic plasmid are all 1×10 ⁶ copy/mL.

The preparation method of the nucleic acid detection kit for detecting the canine leaf-like limit insects and the babesia comprises the following steps:

step 1, designing a primer probe

By inquiring the gene sequences of the sheet-like side worms and the babesia in GeneBank, the conserved sequence of the sheet-like side worm 16S ribosomal RNA gene gene of the dog is selected, and is marked as SEQ ID NO 10, the conserved sequence of the babesia Bei Sichong small subunit ribosomal RNA gene is marked as SEQ ID NO 11, and the conserved sequence of the external reference is marked as SEQ ID NO 12.

SEQ ID NO. 10 sequence:

tacctagtagtatgggatagccactagaaatggtgggtaatactgtataatccctgcggg

ggaaagatttatcgctattagatgagcctatgttagattagctagttggtagggtaaagg

cctaccaaggcagtgatctatagctggtctgagaggatgatcagccacactggaactgag

atacggtccagactcctacgggaggcagcagtggggaatattggacaatgggcgcaagcc

tgatccagctatgccgcgtgagtgaggaa。

SEQ ID NO. 11 sequence is:

ttggtattcgttttccatggataaccgtgctaattgtagggctaatacaagttcgaggcc

tttttggcggcgtttattagttctaaacctcccttggttttcggtgattcataataaact

cgcgaatcgcttttagcgatggaccattcaagtttctgacccatcagcttgacggtaggg

tattggcctaccgaggcagcaacgggtaacggggaattagggttcgattccggagaggga

gcctgagaaacggctaccacatctaaggaaggcagcaggcgcgcaaactacccaatcctg

acacagggaggtagtgacaagaaataacaatacagggcaattgtcttgtaattggaatga

tggtgacgtaaaatctcaccagagtaacaattggagggcaagtctggtgccagcagccgc

ggtaattccagctccaatagcgtatattaaacttgttgcagttaaaaagctcgtagttga

atttctgcgttgcccgactcggctacttgcctt。

SEQ ID NO. 12 sequence:

tcaaggaactaaaaagacccatgtggatgcttcttatagtcactgcactaaactggatcg

cttggttccctttccttctcttcgacactgattggatgggccgtgaggtgtacggagtgg

accattcgacgaactattcggtggtggaaacattccagcatttgtgttaggagcgattgc

ggcagcggtaagtggtgtattggcgttgacggtgttgc。

designing primer probes SEQ ID NO. 1-SEQ ID NO. 3 aiming at a segment of conserved sequence SEQ ID NO. 10 in the sequence of the platy margarita 16S ribosomal RNA gene; designing a primer probe SEQ ID NO. 4-SEQ ID NO. 6 aiming at a segment of conserved sequence SEQ ID NO. 11 of canine bar Bei Sichong small subunit ribosomal RNA gene; the reporter group used by the probe of the canine sheet-shaped side worm is a FAM fluorescent group, the reporter group used by the probe of the canine babesia is a CY5 fluorescent group, meanwhile, an external reference primer probe SEQ ID NO. 7-SEQ ID NO. 9 is designed aiming at the sequence SEQ ID NO. 12 of the Arabidopsis SUC2 gene, and the reporter group used by the external reference probe is a VIC fluorescent group.

The method comprises the following steps:

upstream primer for detecting canine leaf-like limit insects: 5'-gcctaccaaggcagtgatctat-3', the sequence of which is shown in SEQ ID NO. 1.

Downstream primers for detection of canine leaf beetles: 5'-cccattgtccaatattccccactg-3', the sequence of which is shown in SEQ ID NO. 2.

Fluorescent probe for detecting canine leaf-like limit insects: 5'-cagccacactggaactgagatacggtc-3', the sequence of which is shown in SEQ ID NO:3, wherein the 5 '-end of the probe is marked with FAM fluorescent group and the 3' -end is marked with BHQ1 quenching group.

Upstream primer for detecting babesia: 5'-ccgtgctaattgtagggctaatac-3', the sequence of which is shown in SEQ ID NO. 4.

Downstream primer for detecting babesia: 5'-gctgccttccttagatgtggt-3', the sequence of which is shown in SEQ ID NO. 5.

Fluorescent probe for detecting babesia: 5'-tttggcggcgtttattagttctaaacctccc-3', the sequence of which is shown in SEQ ID NO. 6, wherein the probe is marked with a CY5 fluorescent group at the 5 'end and a BHQ2 quenching group at the 3' end.

The outer reference upstream primer: 5'-cccatgtggatgcttcttatagtc-3', the sequence of which is shown in SEQ ID NO. 7.

Downstream primer of external reference: 5'-ccatccaatcagtgtcgaagagaa-3', the sequence of which is shown in SEQ ID NO. 8.

Fluorescent probe for external reference: 5'-ctgcactaaactggatcgcttggttcc-3', the sequence of which is shown in SEQ ID NO 9, wherein the probe is marked with a VIC fluorescent group at the 5 'end and a BHQ1 quenching group at the 3' end.

Step 2, constructing a reaction system:

the final concentration of the PCR Buffer in the reaction system is 1×;

the final concentration of the enzyme mixture in the reaction system was 1×.

Step 3, establishing a reaction program

The fluorescent quantitative standard curve for detecting the canine sheet-like limit insects by adopting the kit is shown in the attached figure 1;

the fluorescent quantitative standard curve of the kit for detecting the babesia canis is shown in figure 2.

Example 3 sensitivity verification experiment of nucleic acid detection kit for detecting the Grandis canina and Babesia

The canine leaf-like marginator detection target gene sequence, the babesia detection target gene sequence and the external reference detection target gene sequence are respectively inserted into pUC 57 vector plasmids, and the canine leaf-like marginator artificial synthetic plasmids, the babesia artificial synthetic plasmids and the external reference artificial synthetic plasmids are respectively obtained through amplification culture, identification and plasmid extraction.

The canine sheet-like marginalis artificial synthetic plasmid is prepared to the concentration of 1 multiplied by 10 ³ The copies/mL is used as a target A to be detected.

The synthetic plasmid of babesia was formulated to a concentration of 1×10 ³ The copies/mL is used as a target B to be detected.

Test method kit and method of use Using example 2, for 1X 10 ³ Detecting the artificially synthesized plasmid (target A to be detected) of the canine leaf-like marginalis at the concentration of cobies/mL, setting 7 repeats to obtain an amplification curve, wherein an amplification curve is shown in figure 3; as can be seen from FIG. 3, 7 replicates were provided, and all of the 7 amplification curves peaked, indicating that detection of 1X 10 using the detection kit of the present invention ³ The detection rate of the copies/mL of the canine platyedge insects is 100%, namely the whole platyedge insects can be detected, so that the minimum detection limit for detecting the canine platyedge insects by adopting the detection kit can reach 1 multiplied by 10 ³ The copies/mL is accurate in detection and good in repeatability.

1X 10 of the test kit of example 2 and methods of use thereof ³ Detecting the artificially synthesized plasmid of the babesia canii with the concentration of cobies/mL (target B to be detected), setting 7 repeats to obtain an amplification curve, wherein an amplification curve is shown in figure 4; as can be seen from FIG. 4, 7 replicates were provided, and all of the 7 amplification curves peaked, indicating that 1X 10 was detected using the detection kit of the present invention ³ The detection rate of the cobies/mL babesia canis is 100%, namely the babesia canis can be detected completely, so that the minimum detection limit of the babesia canis detected by the detection kit can reach 1X 10 ³ The copies/mL is accurate in detection and good in repeatability.

Example 4 specificity verification experiment of nucleic acid detection kit for detecting Plasmodium canicola and Basidiomycetes

The kit adopts a reaction system of 25 mu L, and the reaction system is shown in Table 2:

TABLE 2

A specific experimental group for detecting the canine sheet-like limit insects is arranged, 8 PCR small tubes are arranged in the experimental group, and 2 repeats are arranged in the experimental group. The target pathogen, namely, canine leaf-like margarita and other interfering pathogens (canine parainfluenza virus, canine adenovirus type 2, canine mycoplasma, canine leptospira, canine rickettsia, canine ehrlichia and canine distemper virus) are respectively added into 8 PCR small tubes, and the concentration of all the pathogens is 1 multiplied by 10 ³ cobies/mL; and (3) performing fluorescent quantitative PCR, and adding other components according to a reaction system to perform amplification. The detection result diagram of the specificity experiment for detecting the canine leaf-like side worms is shown in fig. 5.

A specific experimental group for detecting babesia canina was set, 8 PCR vials were set for the experimental group, and 2 replicates were set. Target pathogen Babesia canis and other interfering pathogens (parainfluenza canine, adenovirus type 2, mycoplasma canis, leptospira canis, rickettsia canis, epstein-Barr canine, and canine distemper virus) were added to 8 PCR vials, respectively, at a concentration of 1×10 ³ cobies/mL; respectively performing fluorescent quantitative PCR, and adding other components according to a reaction system to perform amplification. Each experimental group was set with 8 PCR vials and 2 replicates. The detection result diagram of the specificity experiment for detecting the babesia canis is shown in figure 6.

As can be seen from fig. 5, the fluorescence quantitative PCR is performed by using the target pathogen (canine leaf-like margarita) and other interfering pathogens, and the interfering pathogen curve does not peak except for the canine leaf-like margarita amplification curve, which indicates that the kit has obvious specificity in detecting canine leaf-like margarita.

As can be seen from fig. 6, the fluorescence quantitative PCR was performed with the target pathogen (canine babesia Bei Sichong) and other interfering pathogens, and the interfering pathogen curves did not peak except for the amplification curves of canine babesia, which indicates that the kit has significant specificity for detecting canine babesia.

The above-described embodiments of the present invention should not be construed as limiting the scope of the present invention. All technical schemes obtained by adopting equivalent substitution or equivalent transformation are included in the protection scope of the invention.

Sequence listing

<110> Shandong Kang Hua biomedical technology Co., ltd

Qingdao Han Tang Biotechnology Co.Ltd

<120> primer probe composition for detecting canine platyceros and babesia, nucleic acid detection kit and preparation method thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gcctaccaag gcagtgatct at 22

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cccattgtcc aatattcccc actg 24

<210> 3

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cagccacact ggaactgaga tacggtc 27

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ccgtgctaat tgtagggcta atac 24

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gctgccttcc ttagatgtgg t 21

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tttggcggcg tttattagtt ctaaacctcc c 31

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cccatgtgga tgcttcttat agtc 24

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ccatccaatc agtgtcgaag agaa 24

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ctgcactaaa ctggatcgct tggttcc 27

<210> 10

<211> 269

<212> DNA

<213> ribosome RNA (ribosomal RNA gene)

<400> 10

tacctagtag tatgggatag ccactagaaa tggtgggtaa tactgtataa tccctgcggg 60

ggaaagattt atcgctatta gatgagccta tgttagatta gctagttggt agggtaaagg 120

cctaccaagg cagtgatcta tagctggtct gagaggatga tcagccacac tggaactgag 180

atacggtcca gactcctacg ggaggcagca gtggggaata ttggacaatg ggcgcaagcc 240

tgatccagct atgccgcgtg agtgaggaa 269

<210> 11

<211> 513

<212> DNA

<213> ribosome RNA (ribosomal RNA gene)

<400> 11

ttggtattcg ttttccatgg ataaccgtgc taattgtagg gctaatacaa gttcgaggcc 60

tttttggcgg cgtttattag ttctaaacct cccttggttt tcggtgattc ataataaact 120

cgcgaatcgc ttttagcgat ggaccattca agtttctgac ccatcagctt gacggtaggg 180

tattggccta ccgaggcagc aacgggtaac ggggaattag ggttcgattc cggagaggga 240

gcctgagaaa cggctaccac atctaaggaa ggcagcaggc gcgcaaacta cccaatcctg 300

acacagggag gtagtgacaa gaaataacaa tacagggcaa ttgtcttgta attggaatga 360

tggtgacgta aaatctcacc agagtaacaa ttggagggca agtctggtgc cagcagccgc 420

ggtaattcca gctccaatag cgtatattaa acttgttgca gttaaaaagc tcgtagttga 480

atttctgcgt tgcccgactc ggctacttgc ctt 513

<210> 12

<211> 218

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis suecica)

<400> 12

tcaaggaact aaaaagaccc atgtggatgc ttcttatagt cactgcacta aactggatcg 60

cttggttccc tttccttctc ttcgacactg attggatggg ccgtgaggtg tacggagtgg 120

accattcgac gaactattcg gtggtggaaa cattccagca tttgtgttag gagcgattgc 180

ggcagcggta agtggtgtat tggcgttgac ggtgttgc 218

Claims

1. The primer probe composition for detecting the canine leaf-like limit insects and the babesia is characterized in that: the kit comprises an upstream primer for detecting the canine platyedge insects, a downstream primer for detecting the canine platyedge insects, a fluorescent probe for detecting the canine platyedge insects, an upstream primer for detecting the canine babesia, a downstream primer for detecting the canine babesia, a fluorescent probe for detecting the canine babesia, an external reference upstream primer, an external reference downstream primer and an external reference fluorescent probe; the upstream primer for detecting the canine leaf marginalis comprises the following components: the sequence is shown as SEQ ID NO. 1; the downstream primer for detecting the canine leaf marginalis comprises the following components: the sequence is shown as SEQ ID NO. 2; the fluorescent probe for detecting the canine leaf marginalis comprises the following components: the sequence is shown as SEQ ID NO. 3, and the upstream primer for detecting the babesia canis is as follows: the sequence is shown as SEQ ID NO. 4; the downstream primer for detecting babesia canis: the sequence is shown as SEQ ID NO. 5; the fluorescent probe for detecting babesia canis comprises: the sequence is shown as SEQ ID NO. 6; the upstream primer of the external reference: the sequence is shown in SEQ ID NO. 7, and the external reference downstream primer: the sequence is shown as SEQ ID NO. 8; the fluorescent probe of the external reference: the sequence is shown as SEQ ID NO. 9.

2. The primer probe composition for detecting canine distemper and babesia according to claim 1, wherein: the fluorescent probe for detecting the canine leaf marginalis comprises the following components: a FAM fluorescent group is marked at the 5 'end, and a BHQ1 quenching group is marked at the 3' end; the fluorescent probe for detecting babesia canis comprises: a CY5 fluorescent group is marked at the 5 'end, and a BHQ2 quenching group is marked at the 3' end; the fluorescent probe of the external reference: the 5 'end marks the VIC fluorescent group, and the 3' end marks the BHQ1 quenching group.

3. A nucleic acid detection kit for detecting dog sheet limit worm and babesia, its characterized in that: comprises PCR reaction liquid, enzyme mixed liquid, negative reference substance and positive reference substance; the PCR reaction solution comprises a PCR reaction Buffer, a primer with a sequence shown as SEQ ID NO. 1-SEQ ID NO. 9 and a probe.

4. A nucleic acid detection kit for detecting the presence of the sheet-like limit-worm and babesia canis according to claim 3, wherein: the negative control: TE buffer.

5. A nucleic acid detection kit for detecting the presence of the sheet-like limit-worm and babesia canis according to claim 3, wherein: the positive control: the concentrations of the artificially synthesized plasmid containing the canine sheet-like margarita, the artificially synthesized plasmid containing the babesia and the artificially synthesized plasmid containing the external reference are all 1 multiplied by 10 ⁶ copy/mL.

6. The preparation method of the nucleic acid detection kit for detecting the canine platyceros and babesia is characterized by comprising the following steps of: the method comprises the steps of designing a primer probe, constructing a reaction system and establishing a reaction program; the design primer probe: the method is characterized in that an upstream primer and a downstream primer and a probe for detecting the canine leaf-like limit insects are designed aiming at the leaf-like limit insects 16 and S ribosomal RNA gene, and the sequences are shown as SEQ ID NO. 1-SEQ ID NO. 3; aiming at the Ba Bei Sichong small subunit ribosomal RNA gene, an upstream primer and a downstream primer and a probe for detecting the babesia are designed, and the sequences are shown as SEQ ID NO. 4-SEQ ID NO. 6; the sequence of the upstream and downstream primers and probes for external reference is designed for the Arabidopsis SUC2 gene, and is shown as SEQ ID NO. 7-SEQ ID NO. 9.

7. The method for preparing a nucleic acid detection kit for detecting a canine distemper and a canine distemper according to claim 6, wherein the method comprises the steps of: the reaction system is constructed by the following steps: the final concentration of the PCR Buffer was 1×; the final concentration of the primers SEQ ID NO. 1 and SEQ ID NO. 2 for detecting the canine leaf-like rootworm is 0.2 mu M; the final concentration of the primers SEQ ID NO. 4 and SEQ ID NO. 5 for detecting the babesia is 0.2 mu M; the final concentration of the probe SEQ ID NO. 3 for detecting the canine sheet-like side worms, the probe SEQ ID NO. 6 for detecting the babesia and the primer probe SEQ ID NO. 7-SEQ ID NO. 9 for external reference are all 0.2 mu M; the final concentration of the enzyme mixture in the reaction system was 1×.

8. The method for preparing a nucleic acid detection kit for detecting a canine distemper and a canine distemper according to claim 6, wherein the method comprises the steps of: the establishment reaction procedure: the first step: the temperature is 50 ℃ and the time is 2 min; and a second step of: the temperature is 95 ℃ and the time is 10min; and a third step of: 94 ℃ for 15s, and the fourth step: the temperature is 60 ℃ and the time is 40s, wherein the third step and the fourth step are cycled for 40 times, and fluorescent signals are collected in the fourth step.