CN114703258B - One-pot RPA-CRISPR nucleic acid detection method and system based on light activation - Google Patents

One-pot RPA-CRISPR nucleic acid detection method and system based on light activation Download PDF

Info

Publication number
CN114703258B
CN114703258B CN202210627966.2A CN202210627966A CN114703258B CN 114703258 B CN114703258 B CN 114703258B CN 202210627966 A CN202210627966 A CN 202210627966A CN 114703258 B CN114703258 B CN 114703258B
Authority
CN
China
Prior art keywords
rpa
crispr
nucleic acid
dna
cas12a
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210627966.2A
Other languages
Chinese (zh)
Other versions
CN114703258A (en
Inventor
刘翼振
陈勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen University
Original Assignee
Shenzhen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen University filed Critical Shenzhen University
Priority to CN202210627966.2A priority Critical patent/CN114703258B/en
Publication of CN114703258A publication Critical patent/CN114703258A/en
Application granted granted Critical
Publication of CN114703258B publication Critical patent/CN114703258B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation. The RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA. According to the invention, the CRISPR/Cas12a system is shielded at the initial stage of reaction by utilizing the complementation of PC-DNA with a light control group and crRNA to interfere the combination of the crRNA and Cas12a protein, so that the interference of RPA amplification is avoided, and the RPA can generate a large amount of amplicons in a short time; when the amplicon is sufficient, the light-operated group of the PC-DNA can be broken by ultraviolet irradiation, the activity of the CRISPR/Cas12a system is activated, and the rapid detection of the amplicon is realized. In addition, the CRISPR/Cas12a reagent is not required to be added after amplification, so that aerosol pollution can be effectively avoided.

Description

One-pot RPA-CRISPR nucleic acid detection method and system based on light activation
Technical Field
The invention relates to the field of biological detection, in particular to a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation.
Background
Recombinase Polymerase Amplification (RPA) is known as the nucleic acid Amplification technique most likely to replace PCR. Compared with the PCR technology, the RPA amplification reaction temperature is constant, the amplification speed is high, the rapid amplification of nucleic acid can be realized only by keeping the temperature within 37-40 ℃ for 10-15 min, and the method has great application potential in the fields of actual rapid field detection and future molecular diagnosis. However, the problem of non-specific amplification of RPA is very serious and must be combined with highly specific nucleic acid detection techniques. CRISPR/Cas12a is a hot spot in the field of research in recent years, and it has very high specificity. However, their sensitivity is limited and thus the assistance of amplification techniques is required.
It is currently believed that the combination of these two technologies perfectly solves the respective problems. Therefore, in recent years, technologies for detecting nucleic acids based on RPA-CRISPR have been abundantly developed, such as: SHELLLOCK, DETECTRR, HOLMES, etc. However, the method of performing RPA amplification first and then CRISPR detection requires transfer of amplicons, which is likely to cause aerosol contamination. If the two reactions are simply mixed, the amplification efficiency of the RPA is reduced due to the fact that the amplification product generated by the RPA and the required primers are continuously consumed by the CRISPR system, and finally the sensitivity of detection is reduced and the detection time is prolonged.
Therefore, the prior art has yet to be improved.
Disclosure of Invention
In view of the defects of the prior art, the invention aims to provide a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation, and aims to solve the problems that the nucleic acid detection method based on the RPA-CRISPR in the prior art cannot have both sensitivity and accuracy and is easy to cause aerosol pollution.
The technical scheme of the invention is as follows:
in a first aspect, the present invention provides a method for detecting a nucleic acid based on light-activated one-pot RPA-CRISPR, wherein the method for detecting is for non-diagnostic purposes, comprising the steps of:
1.1 Providing an RPA-CRISPR nucleic acid detection system, wherein the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA;
or the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA;
wherein the PC-DNA comprises a photodegradable photosensitive molecule and the nucleotide sequence is complementary to the crRNA in the CRISPR/Cas12a reaction system;
1.2 A pre-amplification stage:
mixing the RPA-CRISPR nucleic acid detection systems, and adding a nucleic acid sample to be detected for reaction to generate an amplicon;
1.3 After the pre-amplification reaction is carried out for a preset time, carrying out illumination treatment on the RPA-CRISPR nucleic acid detection system, and activating a CRISPR/Cas12a reaction system;
1.4 And after the reaction is continued for a preset time II, detecting the fluorescence signal intensity of the RPA-CRISPR nucleic acid detection system, analyzing the result and calculating the content of the nucleic acid sample to be detected.
The light-activated one-pot RPA-CRISPR nucleic acid detection method is characterized in that the PC-DNA is ssDNA oligonucleotide, consists of a plurality of oligonucleotides and is connected through light-degradable photosensitive molecules.
The one-pot RPA-CRISPR nucleic acid detection method based on light activation is characterized in that the PC-DNA consists of 4 oligonucleotides of 9-10nt and is connected through 3 photodegradable photosensitive molecules.
The one-pot RPA-CRISPR nucleic acid detection method based on light activation is characterized in that the molar ratio of the PC-DNA to the crRNA is 1-4.
The one-pot type RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.3, the predetermined time I is 15-20 min.
The one-pot RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.3, the light treatment conditions are as follows: 365 Irradiating with nm ultraviolet light for 1-3min.
The one-pot type RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.4, the preset time is two, and the preset time is 5-60 min.
In a second aspect, the invention also provides a light-activated one-pot RPA-CRISPR-based nucleic acid detection system, wherein,
the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA;
or the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA;
wherein the CRISPR/Cas12a reaction system comprises specific crRNA aiming at a nucleic acid sample to be detected, CRISPR/Cas12a protein and a ssDNA-FQ report system; the RPA reaction system comprises a specific amplification primer, DNA polymerase and buffer solution aiming at a DNA sample to be detected; the RT-RPA reaction system comprises a specific RT-RPA amplification primer, reverse transcriptase, DNA polymerase and buffer solution aiming at an RNA sample to be detected; the PC-DNA comprises a photodegradable photosensitive molecule and the nucleotide sequence is complementary to the crRNA in the CRISPR/Cas12a reaction system.
In a third aspect, the invention also provides a light-activated one-pot type RPA-CRISPR nucleic acid detection kit, wherein the kit comprises the light-activated one-pot type RPA-CRISPR nucleic acid detection system.
In a fourth aspect, the present invention also provides an application of the light-activated one-pot RPA-CRISPR nucleic acid detection method, wherein the light-activated one-pot RPA-CRISPR nucleic acid detection method or the light-activated one-pot RPA-CRISPR nucleic acid detection system is applied to the detection of single-stranded DNA, double-stranded DNA or RNA, and the application is for non-diagnostic purposes.
Has the advantages that: the invention provides a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation. The RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA, or the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA; wherein the PC-DNA comprises a light-degradable photosensitive molecule, and the nucleotide sequence is complementary with the crRNA in the CRISPR/Cas12a reaction system. In one-pot RPA-CRISPR nucleic acid detection, PC-DNA with a light control group is complementary with crRNA, and the combination of the crRNA and Cas12a protein is interfered, so that the enzyme cutting activity of Cas12a nuclease is prevented at the initial stage of reaction, and RPA amplification or RT-RPA amplification can be rapidly carried out. And after amplification is carried out for 15-20min, when a CRISPR/Cas12a system needs to be activated, ultraviolet light at 365nm is used for irradiating for 1-3min, the light control group of the PC-DNA is broken, the broken ssDNA fragments are not combined with crRNA any more, the activity of the CRISPR/Cas12a system is further activated, and the detection of target nucleic acid is rapidly completed. The one-pot RPA-CRISPR nucleic acid detection method based on light activation accurately controls the starting of a CRISPR detection technology by using the method of light activation CRISPR, thereby avoiding the mutual interference of RPA or RT-RPA amplification and CRISPR detection. The CRISPR/Cas12a system shielded in the early stage does not interfere with amplification of RPA or RT-RPA, so that a large number of amplicons can be generated in a short time; when the amplicon is sufficient, ultraviolet light is utilized to activate the CRISPR/Cas12a system, and the rapid detection of the amplicon is realized. In addition, the CRISPR/Cas12a reagent does not need to be added after amplification, so that aerosol pollution can be effectively avoided.
Drawings
FIG. 1 is a schematic diagram of the principle of the one-pot RPA-CRISPR nucleic acid detection method based on light activation in the embodiment of the invention.
FIG. 2 is a schematic diagram of the process of generating a stable RNA-DNA hybrid of PC-DNA and crRNA according to an embodiment of the present invention.
FIG. 3 is a diagram illustrating the effect of different hybridization ratios of PC-DNA and crRNA on the detection system in the example of the present invention.
FIG. 4 is a diagram illustrating the effect of different illumination times on the detection system in the embodiment of the present invention.
FIG. 5 is a diagram illustrating the effect of a high concentration template on a detection system at different pre-amplification times in an embodiment of the present invention.
FIG. 6 is a graph showing the effect of low concentration of template on the detection system at different pre-amplification times in the example of the present invention.
FIG. 7 is a diagram showing the sensitivity test results of the light-activated one-pot type RPA-CRISPR nucleic acid detection method according to the embodiment of the invention.
Detailed Description
The invention provides a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation, and the invention is further explained in detail below in order to make the purpose, technical scheme and effect of the invention clearer and clearer. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The embodiment of the invention provides a one-pot type RPA-CRISPR nucleic acid detection method based on light activation, which comprises the following steps:
s10, providing an RPA-CRISPR nucleic acid detection system, wherein the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA;
or the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA;
wherein the PC-DNA comprises a photodegradable photosensitive molecule and the nucleotide sequence is complementary to the crRNA in the CRISPR/Cas12a reaction system;
s20, a pre-amplification stage:
mixing the RPA-CRISPR nucleic acid detection system, and adding a nucleic acid sample to be detected for reaction to generate an amplicon;
s30, after the pre-amplification reaction is carried out for a preset time, carrying out illumination treatment on the RPA-CRISPR nucleic acid detection system, and activating a CRISPR/Cas12a reaction system;
and S40, after the reaction is continued for the second preset time, detecting the fluorescence signal intensity of the RPA-CRISPR nucleic acid detection system, analyzing the result and calculating the content of the nucleic acid sample to be detected.
Wherein the detection method is for non-diagnostic purposes.
FIG. 1 is a schematic diagram showing the principle of the one-pot RPA-CRISPR nucleic acid detection method based on light activation according to the embodiment of the present invention. Wherein the CRISPR/Cas12a system is a light activated system. First, an ssDNA oligonucleotide (PC-DNA) was designed, which consists of 4 oligonucleotides linked by 3 photodegradable photosensitive molecules and is complementary to crRNA. The crRNA is a target guide RNA of the Cas12a nuclease, and comprises a universal sequence and a targeting sequence, wherein the universal sequence can automatically form a hairpin structure and can be specifically recognized with the Cas protein; the targeting sequence may specifically recognize the DNA sequence of interest. In the pre-amplification stage, because the PC-DNA and the crRNA are completely complementary, a stable RNA-DNA hybrid can be generated, thereby preventing the binding of the crRNA and the Cas12a nuclease, the inactivated CRISPR/Cas12a system does not compete with the RPA amplification for the template DNA and the primer, and fig. 2 is a schematic diagram of the process of generating the stable RNA-DNA hybrid by the PC-DNA and the crRNA. After a period of time, the RPA reaction generates enough amplicon, the RPA-CRISPR nucleic acid detection system is irradiated by light, the light-controlled PC-DNA is degraded into short fragments, the affinity of the short fragments with crRNA is reduced, the crRNA is released and combined with Cas12a protein to form nucleoprotein (RNP), and the ssDNA-FQ reporter gene can be rapidly cut after the RNP is activated by the amplification product, and a bright fluorescent signal is generated within a period of time.
In some embodiments, the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system, and PC-DNA. The detection system detects target DNA, and the RPA reaction system comprises a specific amplification primer, DNA polymerase and a buffer solution aiming at a DNA sample to be detected; prior to activation of the CRISPR/Cas12a system, an RPA reaction occurs.
In other embodiments, the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system, and PC-DNA. The detection system detects target RNA, and the RT-RPA reaction system comprises a specific RT-RPA amplification primer, reverse transcriptase, DNA polymerase and buffer solution aiming at the RNA sample to be detected; prior to activation of the CRISPR/Cas12a system, an RT-RPA reaction occurs.
In some embodiments, the PC-DNA is a ssDNA oligonucleotide, consisting of several oligonucleotides and linked by a photodegradable photosensitive molecule. But not limited thereto, other photo-degradable groups may be reasonably used.
In some embodiments, the PC-DNA consists of 4 oligonucleotides and is linked by 3 photodegradable photosensitive molecules. Without being limited thereto, the number of oligonucleotides is not limited to 4, and for example, 5 oligonucleotides may be linked by 4 photo-degradable photosensitive molecules, or 7 oligonucleotides may be linked by 6 photo-degradable photosensitive molecules, and the design may be flexible according to the circumstances.
Specifically, the ssDNA oligonucleotide is 40 nt in length, consists of 4 oligonucleotides of 9-10nt and is connected through 3 photodegradable photosensitive molecules. The molecular structure and the photocleavage site schematic diagram of the photosensitive molecular photobase of the PC-DNA are shown in FIG. 2. Under 365nm ultraviolet light irradiation, the photo-cleavage sites marked by stars in the figure can be cleaved, resulting in PC-DNA fragmentation. The 4 oligonucleotides are typically 9-10 bases in length, but are not limited thereto. Shorter or longer, the system is also effective, for example it may be 5-20 bases in length.
In some embodiments, the molar ratio of PC-DNA to crRNA is 1. Preferably, the molar ratio of PC-DNA to crRNA is 2.
In order to reduce the background interference of a detection system, enough PC-DNA needs to be added to completely shield crRNA; meanwhile, considering that the 9-10nt PC-DNA fragment generated by photodegradation may compete with the ssDNA-FQ reporter gene for the cleavage activity of Cas12a nuclease, resulting in a slow increase rate of fluorescence signal, it is necessary to minimize the PC-DNA dose while ensuring complete shielding of background signal. In the embodiment of the invention, the molar ratio of the PC-DNA to the crRNA is set to 1. As shown in FIG. 3, the present example verified that the background signal was slightly increased when the hybridization ratio of PC-DNA to crRNA was 1.2. This is due to the insufficient PC-DNA dose, cas12a nuclease is activated by free crRNA, which may affect the accuracy of the microscale assay. When the dose of PC-DNA was increased to two-fold of the crRNA (i.e. the molar ratio of PC-DNA to crRNA was 2. In addition, when the CRISPR/Cas12a system is activated again under 365nm ultraviolet light, the same endpoint fluorescence signal intensity is obtained by experimental groups with different doses of PC-DNA, which indicates that the cleavage efficiency of the activated CRISPR/Cas12a system is not affected by the hybridization ratio of 1.2.
The one-pot type RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.3, the predetermined time I is 15-20 min.
The predetermined time is the time for the RPA reaction to generate the amplicon. The detection sensitivity of the CRISPR/Cas12a system is only at the pM level, so the emphasis of CRISPR/Cas12a assisted RPA detection is to generate sufficient amplicon before CRISPR/Cas12a cleavage is activated. If the RPA reaction time is too short, sufficient amplicon cannot be generated; if the time is too long, the RPA reaction tends to be saturated, and more amplicons cannot be obtained even if the amplification time is prolonged, so that the detection time is wasted. Therefore, the embodiment of the invention sets the pre-amplification time to be 15-20min, which not only can generate enough amplicons and improve the sensitivity, but also can not waste the detection time.
The one-pot RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.3, the light treatment conditions are as follows: 365 Irradiating with nm ultraviolet light for 1-3min.
365 The longer the irradiation time of nm ultraviolet light, the more crRNA is released from the PC-DNA/RNA hybrid strand, the more Cas12a nuclease is activated, and the faster the signal enhancement rate. However, too long an irradiation time may cause DNA damage. Therefore, the UV irradiation time is reasonably set, so that the PC-DNA/RNA can fully release crRNA, and the required time is shortest. The embodiment of the invention researches the shortest time required by PC-DNA/RNA to fully release crRNA and the enhancement rate of fluorescence signals after different activation times, and the result is shown in figure 4. In FIG. 4A, the leftmost two channels indicate the positions of crRNA and PC-DNA, respectively. When the PC-DNA/RNA was not cleaved by UV irradiation, a clear 40 bp hybridization band and a faint PC-DNA excess band were observed. As the light time is prolonged, the PC-DNA/RNA band gradually decreases and disappears, and 40 nt PC-DNA is broken into 9-10nt fragments, and the crRNA release amount gradually increases. After UV irradiation for 1min, the PC-DNA band almost disappeared, while the crRNA band was very clear. In a further study, the photoactivated CRISPR/Cas12a reaction was performed at different UV irradiation times. The corresponding fluorescence kinetic curves (fig. 4B) and end-point fluorescence images (fig. 4C) show that the accumulation rate and end-point intensity of the fluorescence signal are consistent with the normal CRISPR/Cas12a reaction system when the light activation time is 3min and 5min, indicating that sufficient crRNA has been released to activate the CRISPR/Cas12a system. Therefore, the embodiment of the present invention sets the conditions of the light treatment as follows: 365 The ultraviolet light with nm irradiates for 1-3min, so that the PC-DNA/RNA can fully release crRNA, the required time is as short as possible, and the DNA damage caused by irradiation is reduced.
The one-pot type RPA-CRISPR nucleic acid detection method based on light activation is characterized in that in the step 1.4, the preset time is two, and the preset time is 5-60 min.
The embodiment of the invention also provides a light-activated one-pot type RPA-CRISPR nucleic acid detection system, which comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA.
The embodiment of the invention also provides a light-activated one-pot type RPA-CRISPR nucleic acid detection system, which comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA.
In some embodiments, the CRISPR/Cas12a reaction system comprises specific crRNA, CRISPR/Cas12a protein, and ssDNA-FQ reporter system for a nucleic acid sample to be tested.
In some embodiments, the Cas12a nuclease is an LbCas12a protein. But not limited thereto, other Cas12a nucleases such as assas 12a, aaCas12a, fnCas12a, etc. may also be selected.
In some embodiments, the ssDNA-FQ reporter system is a single-stranded DNA modified at both ends with a fluorescent group and a corresponding quenching group. But not limited thereto, ssDNA-FQ systems commonly used in the art can be reasonably applied to the system.
In some embodiments, the RPA reaction system comprises specific amplification primers for a DNA sample to be tested, a DNA polymerase, and a buffer.
Specifically, the RPA reaction system may adopt a commercial RPA kit, which usually comprises a single-stranded DNA binding protein, a recombinase, a strand displacement DNA polymerase, and the kit may be matched with a buffer solution, a magnesium acetate activator, and the like.
In some embodiments, the RT-RPA reaction system comprises a specific RT-RPA amplification primer for an RNA sample to be tested, a reverse transcriptase, a DNA polymerase, and a buffer.
Specifically, the RT-RPA reaction system can adopt a commercial RT-RPA kit.
In some embodiments, the PC-DNA comprises a photodegradable photosensitive molecule and the nucleotide sequence is complementary to the crRNA in the CRISPR/Cas12a reaction system. Preferably, the PC-DNA is ssDNA oligonucleotide, which consists of 4 oligonucleotides of 9-10nt and is linked by 3 photo-degradable photosensitive molecules. But not limited thereto, other photo-degradable groups may be reasonably used.
The embodiment of the invention also provides a light-activated one-pot type RPA-CRISPR based nucleic acid detection kit, which comprises the light-activated one-pot type RPA-CRISPR based nucleic acid detection system.
In some embodiments, the kit further comprises a test strip, a microfluidic chip, and the like.
The embodiment of the invention also provides an application of the light-activated one-pot RPA-CRISPR nucleic acid detection method, which applies the light-activated one-pot RPA-CRISPR nucleic acid detection method or the light-activated one-pot RPA-CRISPR nucleic acid detection system to the detection of single-stranded DNA, double-stranded DNA or RNA, wherein the application is for non-diagnostic purposes.
In some embodiments, the detection limit of the single-stranded or double-stranded DNA is as low as 2.5 copies, with a detection time of 20-50min.
In some embodiments, the nucleic acid sample to be tested can be, but is not limited to, cells, bacteria, tissues, and blood. The target nucleic acid sample to be detected can be subjected to nucleic acid extraction treatment, for example, a nucleic acid extraction kit is used, and the obtained total nucleic acid sample is extracted according to the nucleic acid extraction technology provided by the instruction of the nucleic acid extraction kit.
In some embodiments, the nucleic acid sample to be tested is derived from a mammal including a human or a plant, but is not limited thereto.
In some embodiments, the nucleic acid sample to be tested can also be a microorganism such as a bacterium, a virus, or the like. For example: african Swine Fever Virus (ASFV), rabies virus (pseudorabies virus), human papilloma virus-18 (HPV-18), human papilloma virus 16 (HPV-16), AIDS virus (HIV), staphylococcus aureus (Streptococcus aureus), escherichia coli (E.coli) or Listeria monocytogenes (Listeria monocytogenes), and the like.
The following is a further explanation of the light-activated one-pot type RPA-CRISPR-based nucleic acid detection method and system of the present invention by specific examples:
unless otherwise specified, all the chemical reagents used in the examples are commercially available reagents.
Example 1 design of PC-DNA for DNA of interest
1. Selection of the DNA of interest
SelectingASFV(African swine fever virus) is used as template DNA, and the sequence of the African swine fever virus is found by using NCBI, which is shown as SEQ ID No. 1: GATAAGATTGATACCATGAGCAGTTACGGAAATGTTTAATAATAGGTAATGTGATCGGATACGTAACGGTGCTAATATATATCAGATATAGATGAACATGCGTCTGGAAGAGCTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTGGGCTGCATAATGGCG。
To is directed atASFV Template DNA, primers designed for RPA amplification:
wherein the sequence of the primer AFSV-F is shown as SEQ ID No. 2:
AFSV-F: GATAAGATTGATACCATGAGCAGTTACGGA
wherein the sequence of the primer AFSV-R is shown as SEQ ID No. 3:
AFSV-R: CGCCATTATGCAGCCCACTCACCACGCAGA
2. design of crRNA
Designing a targetASFV The sequence of the crRNA is shown as SEQ ID No. 4:
crRNA: AAUUUCUACUCUUGUAGAUAUAAUAGGUAAUGUGAUCGGAUA
wherein, the sequence AUAAUAGGUAAUGUGAUCGGAUA of the crRNA is recognizedASFV The partial sequence of the template DNA ATAATAGGTAATGTGATCGGATA.
3. Design of PC-DNA
A40 nt ssDNA oligonucleotide (PC-DNA) complementary to crRNA was designed, consisting of 4 oligonucleotides of 9-10nt linked by 3 photo-degradable photosensitive molecules.
The sequence of the PC-DNA is: TATCCGATC/iPClink/ACATTACT/iPClink/ATTATATTACC/iPClink/AAGAGTAGAA
Wherein, iPClink is a photosensitive molecule capable of being photodegraded.
EXAMPLE 2 preparation of PC-DNA/RNA
1. Optimization of PC-DNA/RNA
In order to reduce the background interference of a detection system, enough PC-DNA is required to be added to completely shield crRNA; meanwhile, considering that the photolysis-generated 9-10nt PC-DNA fragment may compete with the ssDNA-FQ reporter gene for the cleavage activity of Cas12a nuclease, resulting in a slow increase rate of the fluorescence signal, it is necessary to minimize the dosage of PC-DNA while ensuring complete shielding of the background signal.
This example first optimizes the hybridization ratio of PC-DNA to crRNA. crRNA was fixed at 60 nM and pc-DNA was fixed at 72 nM (1.2. As shown in FIG. 3, the background signal was slightly increased when the hybridization ratio of PC-DNA to crRNA was 1.2. This is due to the insufficient PC-DNA dose and the Cas12a nuclease activated by free crRNA, which affects the accuracy of the microscale assay. When the dose of PC-DNA was increased to two-fold of the crRNA (PC-DNA to crRNA hybridization ratio of 2. In addition, when the CRISPR/Cas12a system is activated again under 365nm ultraviolet light, the same endpoint fluorescence signal intensity is obtained in experimental groups with different doses of PC-DNA, which shows that the cutting efficiency of the activated CRISPR/Cas12a system is not influenced by twice the amount of the PC-DNA.
Therefore, this example sets the hybridization ratio of PC-DNA to crRNA to 2.
2. Preparation of PC-DNA/RNA
In one pot buffer (containing 50 mM Tris-HCl,10 mM MgCl) 2 100 mM KCl,2 mM DTT, 100ug/ml BSA,5% PEG) was added with 2. Mu.M PC-DNA and 1. Mu.M crRNA (2. The mixture was then heated to 95 degrees celsius in a heating block for 10 minutes, then the heating block was turned off and the mixture was allowed to cool slowly to room temperature for a total cooling time of over 2 hours.
EXAMPLE 3 photo-cleavage of PC-DNA/RNA
1. Gel electrophoresis verification
In one pot buffer (containing 50 mM Tris-HCl,10 mM MgCl) 2 100 mM KCl,2 mM DTT, 100ug/ml BSA,5% PEG), and subjecting the annealed PC-RNA (2. Mu.M) to light irradiation (0 s, 30s, 1min, 3min, 5 min) under 365nm ultraviolet lamp for different periods. Then, 4. Mu.L of the PC-RNA after the above different light irradiation times, 2. Mu.L of 6 XPS gel loading buffer, 2. Mu.L of 100 XPSYBR Green I nucleic acid gel dye and 2. Mu.L of 2U/. Mu.L RNase inhibitor were added to each of the labeled Eppendorf tubes in a total volume of 10. Mu.l. Electrophoresis was then performed on a denaturing 12% polyacrylamide gel (110V, 60min).
The results are shown in FIG. 4A. The leftmost two channels represent the locations of crRNA and PC-DNA, respectively. When the PC-DNA/RNA was not cleaved by UV irradiation, a clear 40 bp hybridization band and a faint PC-DNA excess band were observed. As the light time is prolonged, the PC-DNA/RNA band gradually decreases and disappears, and 40 nt PC-DNA is broken into 9-10nt fragments, and the crRNA release amount gradually increases. After UV irradiation for 1min, the PC-DNA band almost disappeared, while the crRNA band was very clear.
2. Fluorescence kinetic curve
Reaction system: 1 Xone pot buffer (containing 50 mM Tris-HCl,10 mM MgCl) 2 100 mM KCl,2 mM DTT, 100ug/ml BSA,5% PEG) containing 60 nM PC-RNA, 60 nM LbCas12a, 300 nM signal-reporter strand, 2U/. Mu.L nuclease inhibitor and 0.5. Mu.M DNA sample of interest in a total volume of 25. Mu.l.
The activation of the light control system is achieved by illumination. The reaction system is placed in a centrifuge tube, the reaction system is horizontally placed at a position 10cm away from a 365nm ultraviolet lamp for illumination, and the CRISPR/Cas system experimental group in a closed state is wrapped by tinfoil and is strictly protected from light. And the kinetic measurement is to obtain a fluorescence kinetic curve on a qPCR instrument after the illumination is finished, measure the fluorescence kinetic curve every 2min, and perform the reaction for 1 h.
Fig. 4B-4C show photo-activated CRISPR/Cas12a reactions performed at different UV irradiation times. The corresponding fluorescence kinetic curves (fig. 4B) and end-point fluorescence images (fig. 4C) show that the rate of accumulation and end-point intensity of the fluorescence signal are consistent with the normal CRISPR/Cas12a reaction system when the light activation time is 3min and 5min, indicating that sufficient crRNA has been released to activate the CRISPR/Cas12a system.
Example 4 Pre-amplification Condition optimization
1. Pre-amplification reaction system
Closed tube assay, combining RPA pre-amplification with Cas12a/crRNA cleavage assay in the same reaction. All reagents were solubilized and diluted with one pot buffer and loaded on ice for handling. Wherein, the closed tube system is 25 mu L, one part of freeze-dried powder in the RPA kit can be used for 50 mu L reaction, namely one part of dry powder can be used for two times of reaction, 23.8 mu L of one pot buffer solution is added to dissolve the dry powder when in use, and then the volume required by the reaction is absorbed.
A25. Mu.L reaction system included the reagents listed in Table 1 below:
Figure 554516DEST_PATH_IMAGE002
RPA pre-amplification was performed first, with the reaction time set as gradient: 0.5, 10, 15, 20 and 30 min, then irradiating for 3min by using an ultraviolet lamp with the wavelength of 365nm, continuing the reaction for 30 min in a 37 ℃ after the irradiation is finished, and measuring the fluorescence signal of an end point by using a HORIBA FluoroMax-4 fluorescence spectrometer.
2. High concentration target DNA test results
Using high concentrations (2.5X 10) 5 copies) were tested, whereas the non-target control group used sterile water without target DNA and the same procedure was performed. The visualization was performed by taking a photograph with a gel imager (Tanon).
The results are shown in FIG. 5, for detection of high concentration template (2.5X 10) 5 copies) and CRISPR/Cas12a detection is carried out after different preamplification times (0, 5, 10, 15, 20 and 30 min), and the enhancement speed of the fluorescence signal has no obvious difference. This is because when the template concentration is high, the amplification process can be completed in only a few minutes, so that extension of the pre-amplification time does not improve the detection system.
3. Low concentration target DNA test results
The test was performed using low concentration (25 copies) of target DNA, while the non-target control group used sterile water without target DNA, and the same procedure was performed. The visualization was performed by taking a photograph with a gel imager (Tanon).
As shown in FIG. 6, when the pre-amplification time is extended to 15 min, the enhancement rate of the fluorescence signal is significantly increased; after a pre-amplification time of more than 20min, the fluorescence signal increase rate cannot be further enhanced by a longer amplification time. This is because the RPA reaction is almost saturated after 15-20min amplification, and no more amplicons can be obtained by prolonging the amplification time.
The detection sensitivity of the CRISPR/Cas12a system is only at the pM level, so the emphasis of CRISPR/Cas12a assisted RPA detection is to generate sufficient amplicon before CRISPR/Cas12a cleavage is activated. When the concentration of the template is high, the amplification process can be completed in only a few minutes, so that the detection system is not improved by prolonging the pre-amplification time. Whereas at lower template concentrations (25 copies), the shorter amplification times produce too small a number of amplicons and thus premature activation of the CRISPR/Cas12a reaction results in a slower rate of increase of the fluorescent signal. In this case, in order to obtain a better detection effect, it is necessary to lengthen the pre-amplification time. Therefore, setting the pre-amplification time to 15-20min not only improves the sensitivity but also does not waste detection time.
Example 5 sensitivity testing of a light-activated one-pot RPA-CRISPR-based nucleic acid detection method
Under the optimum conditions described in examples 1 to 4, selection was madeASFV(African swine fever virus) as template DNA, the sensitivity of the one-pot light-activated CRISPR/cas12 a-assisted RPA method was tested. Target DNA samples with different concentrations are added into a 25 mu L system and incubated for 15 min at 37 ℃ to complete the pre-amplification process. Then irradiating for 3min under 365nm ultraviolet light, incubating for 20min, and detecting fluorescence intensity.
The results are shown in FIG. 7. The results of fig. 7A confirm that the sensitivity of the one-pot light-activated CRISPR/cas12 a-assisted RPA method in each reaction was 2.5 copies. The endpoint fluorescence image in fig. 7B also shows a difference in visual signal between the blank and the test groups.
In conclusion, the invention provides a one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation. The RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA, or the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RT-RPA reaction system and PC-DNA; wherein the PC-DNA comprises a photodegradable photosensitive molecule and the nucleotide sequence is complementary to the crRNA in the CRISPR/Cas12a reaction system. In the one-pot type RPA-CRISPR nucleic acid detection, PC-DNA with a light control group is complementary with crRNA, and the combination of the crRNA and Cas12a protein is interfered, so that the enzyme digestion activity of Cas12a nuclease is prevented at the initial reaction stage, and the RPA amplification or RT-RPA reaction can be rapidly carried out. When the CRISPR/Cas12a system needs to be activated after 15-20 minutes of amplification, a 365nm ultraviolet light is used for irradiating for 1-3 minutes, the light control group of the PC-DNA is broken, the broken ssDNA fragments are not combined with the crRNA, the activity of the CRISPR/Cas12a system is further activated, and the detection of the target nucleic acid is rapidly completed. The one-pot RPA-CRISPR nucleic acid detection method based on light activation provided by the invention utilizes the method of light activation CRISPR to accurately control the starting of the CRISPR detection technology, thereby avoiding the mutual interference of RPA or RT-RPA amplification and CRISPR detection. The CRISPR/Cas12a system shielded in the early stage does not interfere with amplification of RPA or RT-RPA, so that a large number of amplicons can be generated in a short time; when the amplicon is sufficient, the CRISPR/Cas12a system is activated by ultraviolet light, so that the rapid detection of the amplicon is realized. In addition, the CRISPR/Cas12a reagent does not need to be added after amplification, so that aerosol pollution can be effectively avoided.
It is to be understood that the invention is not limited to the examples described above, but that modifications and variations may be effected thereto by those of ordinary skill in the art in light of the foregoing description, and that all such modifications and variations are intended to be within the scope of the invention as defined by the appended claims.
Sequence listing
<110> Shenzhen university
<120> one-pot type RPA-CRISPR nucleic acid detection method and system based on light activation
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 166
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 1
gataagattg ataccatgag cagttacgga aatgttttta ataataggta atgtgatcgg 60
atacgtaacg gggctaatat cagatataga tgaacatgcg tctggaagag ctgtatctct 120
atcctgaaag cttatctctg cgtggtgagt gggctgcata atggcg 166
<210> 2
<211> 30
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 2
gataagattg ataccatgag cagttacgga 30
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence (rengongxulie)
<400> 3
cgccattatg cagcccactc accacgcaga 30
<210> 4
<211> 42
<212> RNA
<213> Artificial sequence (rengongxulie)
<400> 4
aauuucuacu cuuguagaua uaauagguaa ugugaucgga ua 42

Claims (7)

1. A light-activated one-pot RPA-CRISPR nucleic acid detection method for African swine fever virus is characterized in that the detection method is for non-diagnosis purposes and comprises the following steps:
1.1 Providing an RPA-CRISPR nucleic acid detection system, wherein the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA;
wherein, the CRISPR/Cas12a reaction system comprises specific crRNA aiming at a nucleic acid sample to be detected, CRISPR/Cas12a protein and a ssDNA-FQ report system; the RPA reaction system comprises a specific amplification primer, DNA polymerase and buffer solution aiming at a DNA sample to be detected; the PC-DNA comprises a photosensitive molecule capable of being degraded by light, and the nucleotide sequence is complementary with the crRNA; in the one-pot type RPA-CRISPR nucleic acid detection, PC-DNA with a light control group is complementary to crRNA, the combination of the crRNA and Cas12a protein is interfered, the enzyme cutting activity of Cas12a nuclease is prevented in the early reaction stage, so that the RPA amplification is rapidly carried out, and the sequence of the PC-DNA is as follows: TATCCGATC/iPClink/ACATTACT/iPClink/ATTATATTACC/iPClink/AAGAGTAGAA;
1.2 A pre-amplification stage:
mixing the RPA-CRISPR nucleic acid detection system, and adding a nucleic acid sample to be detected for reaction to generate an amplicon;
1.3 After the pre-amplification reaction is carried out for a preset time, carrying out illumination treatment on the RPA-CRISPR nucleic acid detection system, wherein the conditions of the illumination treatment are as follows: 365 Irradiating for 1-3min by nm ultraviolet light to activate a CRISPR/Cas12a reaction system;
1.4 And after the reaction is continued for a preset time II, detecting the fluorescence signal intensity of the RPA-CRISPR nucleic acid detection system, analyzing the result and calculating the content of the nucleic acid sample to be detected.
2. The African swine fever virus light-activated one-pot RPA-CRISPR nucleic acid detection method of claim 1, wherein the molar ratio of PC-DNA to crRNA is 1.
3. The method for detecting African swine fever virus (RPA-CRISPR) nucleic acid based on light activation according to claim 1, wherein the predetermined time is 15-20min in step 1.3.
4. The method for detecting African swine fever virus (RPA-CRISPR) nucleic acid based on light activation according to claim 1, wherein the predetermined time is 5-60 min in step 1.4.
5. A one-pot RPA-CRISPR nucleic acid detection system based on light activation for African swine fever virus is characterized in that the RPA-CRISPR nucleic acid detection system comprises a CRISPR/Cas12a reaction system, an RPA reaction system and PC-DNA;
wherein the CRISPR/Cas12a reaction system comprises specific crRNA aiming at a nucleic acid sample to be detected, CRISPR/Cas12a protein and a ssDNA-FQ report system; the RPA reaction system comprises a specific amplification primer, DNA polymerase and buffer solution aiming at a DNA sample to be detected; the PC-DNA comprises a photosensitive molecule capable of being degraded by light, and the nucleotide sequence is complementary with the crRNA; in the one-pot type RPA-CRISPR nucleic acid detection, PC-DNA with a light control group is complementary to crRNA, the combination of the crRNA and Cas12a protein is interfered, the enzyme cutting activity of Cas12a nuclease is prevented in the early reaction stage, so that the RPA amplification is rapidly carried out, and the sequence of the PC-DNA is as follows: TATCCGATC/iPClink/ACATTACT/iPClink/ATTATATCTCA/iPClink/AAGAGTAAA.
6. A light-activated one-pot RPA-CRISPR-based nucleic acid detection kit for African swine fever virus, which comprises the light-activated one-pot RPA-CRISPR-based nucleic acid detection system of claim 5.
7. The use of the light-activated one-pot RPA-CRISPR nucleic acid detection method is characterized in that the light-activated one-pot RPA-CRISPR nucleic acid detection method for the African swine fever virus according to any one of claims 1 to 4 or the light-activated one-pot RPA-CRISPR nucleic acid detection system for the African swine fever virus according to claim 5 is used for the detection of single-stranded DNA or double-stranded DNA, and the application is for non-diagnostic purposes.
CN202210627966.2A 2022-06-06 2022-06-06 One-pot RPA-CRISPR nucleic acid detection method and system based on light activation Active CN114703258B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210627966.2A CN114703258B (en) 2022-06-06 2022-06-06 One-pot RPA-CRISPR nucleic acid detection method and system based on light activation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210627966.2A CN114703258B (en) 2022-06-06 2022-06-06 One-pot RPA-CRISPR nucleic acid detection method and system based on light activation

Publications (2)

Publication Number Publication Date
CN114703258A CN114703258A (en) 2022-07-05
CN114703258B true CN114703258B (en) 2022-10-11

Family

ID=82177847

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210627966.2A Active CN114703258B (en) 2022-06-06 2022-06-06 One-pot RPA-CRISPR nucleic acid detection method and system based on light activation

Country Status (1)

Country Link
CN (1) CN114703258B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116590387B (en) * 2023-07-06 2023-12-08 深圳大学 CRISPR (clustered regularly interspaced short palindromic repeats) system-based ssDNA detection method and application

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020124050A1 (en) * 2018-12-13 2020-06-18 The Broad Institute, Inc. Tiled assays using crispr-cas based detection
CN111808931A (en) * 2020-07-15 2020-10-23 南方科技大学 One-step RPA-CRISPR nucleic acid detection method, kit and application
CN112239795A (en) * 2020-09-16 2021-01-19 复旦大学 RT-RPA and CRISPR-based visual new coronavirus RNA nucleic acid detection kit
WO2021081469A2 (en) * 2019-10-25 2021-04-29 The Johns Hopkins University Light-inducible crispr/cas9 system for genome editing
CN114045356A (en) * 2022-01-12 2022-02-15 仲恺农业工程学院 Kit and method for visually detecting citrus greening disease based on RPA-CRISPR-Cas12a system
CN114410752A (en) * 2022-01-24 2022-04-29 华南师范大学 CRISPR-Cas nucleic acid detection kit based on light control and detection method

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021081468A1 (en) * 2019-10-25 2021-04-29 The Johns Hokins University A crispr-cas9 platform with an intrinsic off-switch and enhanced specificity
CN111041049A (en) * 2019-12-04 2020-04-21 江苏大学 Preparation method and application of CRISPR-Cas13a system based on near-infrared light control
CN111235232B (en) * 2020-01-19 2022-05-27 华中农业大学 Visual rapid nucleic acid detection method based on CRISPR-Cas12a system and application

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020124050A1 (en) * 2018-12-13 2020-06-18 The Broad Institute, Inc. Tiled assays using crispr-cas based detection
WO2021081469A2 (en) * 2019-10-25 2021-04-29 The Johns Hopkins University Light-inducible crispr/cas9 system for genome editing
CN111808931A (en) * 2020-07-15 2020-10-23 南方科技大学 One-step RPA-CRISPR nucleic acid detection method, kit and application
CN112239795A (en) * 2020-09-16 2021-01-19 复旦大学 RT-RPA and CRISPR-based visual new coronavirus RNA nucleic acid detection kit
CN114045356A (en) * 2022-01-12 2022-02-15 仲恺农业工程学院 Kit and method for visually detecting citrus greening disease based on RPA-CRISPR-Cas12a system
CN114410752A (en) * 2022-01-24 2022-04-29 华南师范大学 CRISPR-Cas nucleic acid detection kit based on light control and detection method

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Development of light-activated CRISPR using photocleavable protectors of guide RNAs;Piyush K Jain等;《Angew Chem Int Ed Engl》;20160824;第55卷(第40期);第12440-124444页 *

Also Published As

Publication number Publication date
CN114703258A (en) 2022-07-05

Similar Documents

Publication Publication Date Title
CN107429296B (en) Methods, compositions and kits for capturing, detecting and quantifying small RNAs
CN108774639B (en) Directional polymerization fluorescent probe PCR
BR112014000138B1 (en) METHOD FOR IDENTIFYING THE PRESENCE OR ABSENCE OF A TARGET NUCLEIC ACID
KR102648647B1 (en) Improved detection of short homopolymeric repeat sequences
ES2558007T3 (en) Nucleic acid amplification inhibition procedure using light and very sensitive nucleic acid selective amplification procedure
US9845495B2 (en) Method and kit for detecting target nucleic acid
CN114703258B (en) One-pot RPA-CRISPR nucleic acid detection method and system based on light activation
US10260090B2 (en) Accelerated isothermal amplification of DNA
JP2022189882A (en) Method for detecting minor BCR-ABL1 gene
CN114410752A (en) CRISPR-Cas nucleic acid detection kit based on light control and detection method
CN106755284A (en) It is a kind of based on the cascade DNA amplification machine of label-free molecular beacon and application
JPWO2003100095A1 (en) Target nucleic acid detection method
CN109680044B (en) Gene mutation detection method based on selective elimination of wild chain background interference
JP2003518951A (en) Methods for simultaneous amplification and real-time detection of polymorphic nucleic acid sequences
JP7004570B2 (en) Substrate molecule
CN112553307A (en) One-pot nucleic acid detection method based on CasRNAse and application
CN114875178B (en) SARS-CoV-2 detection system and method based on hybridization chain reaction
JP2013523097A (en) Methods for controlling oligonucleotide functionality
CN114317689A (en) Method for synthesizing nucleic acid under constant temperature condition for non-diagnosis purpose, kit and application
JP6501594B2 (en) Method and kit for detecting Nitrobacter bacteria
KR20140024411A (en) Torque teno virus diagnostics
CN108291255B (en) Methods and kits for ligating fragmented nucleic acids together
CA3163565A1 (en) Method and kit for detection of polynucleotide
CN109477139A (en) Use long ssDNA polynucleotides as the method for the primer in PCR measurement
WO2023133411A2 (en) Methods and compositions related to nucleic acid-based fluorescent nanocluster probes

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant