CN114703225B

CN114703225B - Method for improving carotenoid content of corn kernels by using gene editing technology

Info

Publication number: CN114703225B
Application number: CN202210370256.6A
Authority: CN
Inventors: 宋广树; 吕庆雪; 周迎鑫; 孙蕾; 周德龙
Original assignee: Jilin Academy of Agricultural Sciences
Current assignee: Jilin Academy of Agricultural Sciences
Priority date: 2022-04-09
Filing date: 2022-04-09
Publication date: 2023-05-16
Anticipated expiration: 2042-04-09
Also published as: CN114703225A

Abstract

The invention discloses a method for improving the carotenoid content of corn kernels by using a gene editing technology, and belongs to the technical field of genetic engineering. The invention discloses a method for improving the carotenoid content of corn kernels by using a gene editing technology, which is characterized in that the CRISPR/Cas9 technology is used for simultaneously carrying out gene editing on corn ZmIsa2, zmIsa3 and ZmZpu1 genes, and further screening to obtain mutant materials containing target gene mutant fragments, wherein the materials with the improved carotenoid content of the corn kernels have important breeding values.

Description

Method for improving carotenoid content of corn kernels by using gene editing technology

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a method for improving the carotenoid content of corn kernels by using a genetic editing technology.

Background

Carotenoids are an important class of natural pigments with unique structure and function, widely distributed in phototrophic and non-phototrophic organisms, and currently more than 700 natural carotenoids have been identified, with a very rich chemical diversity. Carotenoids are chemically or enzymatically converted to other derivatives such as vitamin a, plant hormones or aromatic compounds, etc.; vitamin a deficiency is one of the major micronutrient deficiencies worldwide. Studies have shown that diets rich in carotenoids (consisting mainly of fruits and vegetables) have a health promoting effect while helping to reduce the risk of certain cancers and cardiovascular, ocular, skin or skeletal diseases. Since carotenoids cannot be synthesized by the human body itself but are combined with other molecules such as saccharides, proteins or fatty acids in foods to be taken up by the human body, it is important to study the efficiency of taking up and absorbing carotenoids from the diet and their influencing factors by the human body.

The carotenoid is also used as a feed additive, has special significance for normal growth and development of animals, such as common symptom of 'asymptomatic' fever, delayed ovulation, follicular cyst, corpus luteum reduction, placenta stagnation, reproductive development disorder and the like, and can be improved to a great extent after being added. In addition, after the feed rich in carotenoid is added into the laying hen, the egg yolk color is deepened and the nutritional value of the laying hen is improved. The invention can increase the carotenoid content in the common corn kernel by 2 times, and has important feeding value.

The traditional high-carotene corn material is mainly created by a backcross transformation method, 6 backcross generations are needed, so that the time is long, meanwhile, gene redundancy is frequently accompanied, the introduction of some non-target characters is caused, and the application effect of the improved material is limited.

Carotenoids are the first natural pigments found in humans, and the main chain of the long chain carotenoid molecule is usually composed of 9-11 conjugated c=c bonds, the length of the linear chain of which corresponds to the thickness of the hydrophobic region of the membrane penetrated by molecular rivets, thus serving to enhance the lipid function of cell membranes in certain fungi and animals. Carotenoids are generally classified into two categories based on molecular composition: one refers to a nonpolar carotenoid (e.g., β -carotene, lycopene) having hydrocarbon rings at one or both ends of the polyene backbone, and the other refers to a polar carotenoid having an oxygen-containing group-OH (e.g., lutein), =o (e.g., canthaxanthin), a combination of OH and=o (e.g., astaxanthin), or an alcohol ester (e.g., fucoxanthin) in the structure. In a bilayer membrane of natural phospholipids contained in an organism, polar carotenoids such as lutein having hydroxyl and/or oxy groups at both molecular ends, positioning the polar heads of the phospholipids in a direction perpendicular to the long axis of the surface of the phospholipid membrane will result in reduced freedom of movement of the lipid alkyl chains, reduced permeability of water and oxygen in model membranes and biological membranes, these effects being referred to as solidifying effects in the membrane; the symmetrical fatty chains in the oxygen-free beta-carotene are non-covalently combined with the nonpolar part of the phospholipid, so that the freedom degree of movement of the polar groups of the phospholipid head is increased, the fluidity of the membrane structure is enhanced, and the quantity and the type of the carotenoid are important parameters affecting the membrane function. The mechanical properties of carotenoids are used later in the evolution to protect the relevant structures of the protein, and the exposed carotenoid external structure is able to bind to the protein and thus to confer a certain resistance to environmental conditions.

Therefore, it is a urgent need for a person skilled in the art to provide a method for increasing the carotenoid content of corn kernels by using gene editing technology.

Disclosure of Invention

In view of this, the present invention provides a method for increasing the carotenoid content of corn kernels using gene editing techniques.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a method for improving the carotenoid content of corn kernels by using a gene editing technology comprises the following specific steps:

(1) Designing a CRISPR/Cas 9-based sgRNA action site aiming at a gene ZmIsa 2;

the nucleotide sequence of the sgRNA action site is as follows:

ZmIsa2：5’-GCGGAGATACGGACACACCGCGG-3’；SEQ ID NO.4；

(2) PCR amplifying the target fragment by taking pCBC-MT1T2 plasmid as a template, MT1T2-F and MT1T2-F0 as primers;

the primer sequences are as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCTTTGATGAACTGACGCA-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCTTTGATGAACTGACGCAGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

(3) The sgRNA action site based on CRISPR/Cas9 is designed aiming at the genes ZmIsa3 and ZmZpu1;

the nucleotide sequence of the sgRNA action site is as follows:

zmsia 3:5'-ACCACGACGAAAGTTCAGAGCGG-3'; SEQ ID NO.7; and

ZmZpu1：5’-TGGTCAGACTGAGAACAGCGCGG-3’；SEQ ID NO.8；

(4) PCR amplifying the target fragment by taking pCBC-MT1T2 plasmid as a template, MT1T2-F ', MT1T2-F0', MT1T2-R0', MT1T2-R' as a primer;

the primer sequences are as follows:

MT1T2-F’：5’-AATAATGGTCTCAGGCGCCACGACGAAAGTTCAGAG-3’；SEQ ID NO.9；

MT1T2-F0’：5’-GCCACGACGAAAGTTCAGAGGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.10；

MT1T2-R0’：5’-CGCTGTTCTCAGTCTGACCCGCTTCTTGGTGCC-3’；SEQ ID NO.11；

MT1T2-R’：5’-ATTATTGGTCTCTAAACCGCTGTTCTCAGTCTGACC-3’；SEQ ID NO.12；

(5) Respectively carrying out enzyme digestion connection on the target fragments obtained in the step (2) and the step (4) with a vector pBUE411, and respectively constructing to obtain a ZmIsa2 gene editing vector pBUE411-1gR-ZmIsa2 and a ZmIsa3, and a ZmZpu1 gene editing vector pBUE411-2gR-ZmIsa3-ZmZpu1;

(6) Transferring the gene editing vectors pBUE411-1gR-ZmIsa2 and pBUE411-2gR-ZmIsa3-ZmZpu1 obtained in the step (5) into agrobacterium LBA4404 respectively and independently for corn genetic transformation to obtain a pBUE411-1gR-ZmIsa2 vector positive plant and a pBUE411-2gR-ZmIsa3-ZmZpu1 vector positive plant; the corn material with high carotenoid content is obtained through hybridization and selfing and screening identification.

Further, the PCR amplification reaction system in the step (2) is as follows: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F, 00.5. Mu.l of MT1T2-F, 10. Mu.l of 2 XMix, ddH ₂ O8 μl; the PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃30s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

Further, the PCR amplification reaction system in the step (4) is as follows: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F ', 0.5. Mu.l of MT1T2-F0', 0.5. Mu.l of MT1T2-R ', 10. Mu.l of 2 XMix, ddH ₂ O7. Mu.l; the PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃30s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

Further, the cleavage ligation reaction system in step (5) is as follows: 2 μl of fragment of interest, pBUE4112 μl,10xNEB T4 Buffer 1.5μl，10xBSA 1.5μl，BsaI 1μl，T4 Ligase 1μl，ddH ₂ O 6μl，Total 15μl。

Each sgRNA site of action was ligated into the same gene editing vector via a different expression cassette.

The vector carrying Cas9 is pBUE411.

The maize is inbred line C01.

Compared with the prior art, the method for improving the carotenoid content of the corn seeds by using the gene editing technology can accurately edit the target genes without introducing outer edge genes, and the method can accurately knock out the starch synthesis branch modification related genes ZmIsa2, zmIsa3 and ZmZpu1 by using the gene editing technology, so that the carotenoid content of the corn seeds can be accurately improved, and other agronomic characters are not changed.

The invention discloses biological functions of corn ZmIsa2, zmIsa3 and ZmZpu1 genes for the first time, the CRISPR/Cas9 technology is used for carrying out gene editing on the corn ZmIsa2, zmIsa3 and ZmZpu1 genes, and mutant materials containing target gene fragment deletion are further obtained by screening, and the materials with the carotenoid content increased have important breeding values. The material with the increased corn carotenoid content created by the invention belongs to a material with the obviously increased carotenoid content, other morphologies and yield traits have no obvious change, and the material can be applied to hybrid corn production through reasonable cultivation management measures.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram showing the results of wild-type and mutant sequencing;

FIG. 2 is a graph showing the results of carotenoid content detection in wild-type and mutant corn kernels according to the present invention.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The invention utilizes a gene editing technology to improve the carotenoid content of corn kernels, designs a sgRNA sequence based on CRISPR/Cas9 aiming at target genes ZmIsa2, zmIsa3 and ZmZpu1 in corn, connects a DNA fragment containing the sgRNA sequence to a carrier carrying Cas9, and transforms corn (such as an agrobacterium-mediated method) by using the constructed carrier to realize site-directed mutation of the genes ZmIsa2, zmIsa3 and ZmZpu1 so as to obtain corn plants with the functions of the genes ZmIsa2, zmIsa3 and ZmZpu1 deleted.

EXAMPLE 1 construction of Gene editing vector

(1) The starch debranching enzyme gene ZmISA2 has the nucleotide sequence as follows:

ATGGCCTCCTCCCTCCCCGCGCCGCCGGCCTCGCCCTCTTCCTCCTGGCGCGGACTCACGCCCCGCTGCCCTCCGCCTCGCTGCGGTCCCCTCCTCGCCCGCGCGGTAGCGCGTTCTTACCGTTACCGCTTCCGAACCGACGACGACGGCGTGGTGGACGTGGCCGTCGCCGGGAAAGACGGCGATGCGGGGTATGTGGTCGCTATCGAGGCTCCTACCCATGGACAGAGGGGCGGTCTTGTGCTCCGCCCCGCCGGCTCCGGCGAGGGCGTCCCTCTGGCCCCAGCCGCGCCGGGAGGTGCCCTCGTGGCTGAGTTGTCCTACGACGTGGCCCGCGCGCCGTTCCACGTCTCGTTCACGCTGGCCGACGCGATGGGAGCGGAGATACGGACACACCGCGGGACGAGCTTCCGCGTGCCTGTTGGCGTCGGACGGGGCTGCCCCTCGCCGCTCGGCCTGTCCCAGTCCAAGGATGGGGCCGCTAACTTCGCGGTTTACAGCAAGATCGCCAAGGGCATGGTGCTCTGCCTCTTCGGTGGTGGCGGCGGGGACGGACCCGCGCTGGAGATTGAGCTCGACCCGTACGTCCACCGGACCGGCGATGTCTGGCACGTCTCGATGGAGAGCGTGGAGGGGTACGCCCGCTACGGCTTCCGCAGCGGGCTGTTCGCAATGTTTGGCATTGACCGCCCGCTACTCGACCCGTACGCCAAGGTGATCGGGGACTTCGTCGCTGGCGACTCTGTTGATGAGGATGGGCTAGCTGTGCCATCCATAAGGTGTCTCGCGTCCTTGAAGAATGCACCCAACTACGATTGGGGCAGGGACAAGCACCCATGCTTGCCATTGGAGAAGCTGGTGGTCTACCGGGCAAATGTGGCTTTGTTCACCAAGGATAGGTCGAGTCGGCTGGCAGACAATGCCGCTGGTACTTTCTCCGGCATGTCTGCAAAGGTGGAACACTTCAGGCATCTTGGTGTCAATGCAGTTTTGCTGGAGCCAGTTTTCCCATTCCACCAAGTGAAGGGACCATATTTTCCATACCATTTTTTTTCACCTATGAGCTTGTATAGCAGTGAATGCTCCAGTGTTTCAGCTATCAAGTCTATGAAGGATATGGTCAAAACAATGCACAGAAATGGGATAGAGGTTCTCTTGGAGGTTGTTTTCACGCATACTGCTGAAGGAGGGGCGGAGTGTCAGATGATATCACTTCGAGGCATCGATGGTTCCTCGTACTACATTGCTGATGGAATCGCTGGATGCAAGGCAAGTGTGTTGAATTGCAACCATCCAGTGACTCAGAAGCTGATTTTGGACAGCCTCCGCCATTGGGTGCTCGACTTCCATGTTGATGGGTTCTGCTTCATCAATGCTCCTTTCCTCGTCAGAGGTCCACGTGGTGAGGGCCTCTCACGGCCTCCACTTCTGGAAGCCATAGCATTTGATCCTGTTCTTTCAAAGACTAAGATCATTGCAGATCCTTGGTCTCCGCTTGACATATCTAATGTGCAATTTCCATTCCCTCATTGGAAAAGATGGGCTGAGATGAACACAAGATTCTCTATGGATGTGCGCAAGTTTCTTAAGGGAGAAGCACTTATCAGTGATCTTGCTACACGTTTGTGTGGCAGTGGGGACTTATTTTCCTCAAGGGCCCCAGCATTTTCGTTCAATTATGTATCCAGGAATTCTGGACTCACTCTTGTTGATCTAGTGAGCTTCAGCAGTGATGAGCTTGCTTCTGAGTTCAGCTGGAATTGTGGTGAAGAAGGACCATCGGAGAACAACGCAGTCCTTCAAACCAGGCTAAGACAGATACGCAACTTCTTGTTTATTCTATTCATTTCCCTTGGTATTCCTGTTCTTAACATGGGGGATGAATGTGGAAACTCAGCTGCTGGTTCAACATCATACAAGGATAGAGGGCCTCTGAACTGGAAAGCCTTGAAGACCGCTTTTGTTAAGGAAGTTACCGGGTTTATTTCGTTTCTATCTGCACTAAGGAGTCGACGAGCAGACATTTTCCAGAGATGCGAGTTTCTAAAACTTGAAAATATACATTGGTATGGGAGTGATTTATCTGAGCCATGTTGGGAGGATCCTACTAGCAACTTTCTTTGCTTGCACATAAATGCAGAGCTGGACGAGAAGCTACCAGATTCGACTGGAGGTGATTTGTATATCTGTTTCAATGCAAACGAGGAGTCAGCGAGTGCTACTTTACCAGCTATTGCAGAAGGATCCATGTGGCTGCGCTTGGTTGATACATCACTTGCATTTCCAGGTTTCTTTTCCAGAGGGTCTAGTCATGAAACACACCAGGTGCTAGGATTTTCCTCATATCAAGTGAAGGCACATAGCTGTGTTCTGTTCGAATCCAAGAGGGTTCTTTCATAG；SEQ ID NO.1。

(2) The starch debranching enzyme gene ZmISA3 has the nucleotide sequence as follows:

ATGGATTCCGTCGGTACAAATCGGCCCCCGCTGCGCCCCGTTGCCGCCGCAGCTACTCGACGCAGCGCGCTCCTGCGCCCCCCTAGCCACCTCGGGCTCGGCAATCGTTTTGCGGAGACTAAGCTTGGGATCGCGTCAGGGTGTGGAGGAGGAGGAGGGTATTTTGGAAAGGTACAGGGATTTGATGCCTTGCGGAGTACCACGACGAAAGTTCAGAGCGGGAAGGCGGGGAGGAGTGTGACCAAGGAAATGGGACACACTTCATCTGGCAATGAAGTGCCCTTGAAATATTCTTCAGGCAAAGCCTTCCCCCTAGGAGTGTCACAAGTTGACGATGGGTTAAATTTTGCAATATTCTCACAACATGCTTCTTCTGTCACCCTTTGCTTGAATTTTCCTGAGAGAGGCAACCAAGATGATGTGGACATTGTAGAGTTTGCTTTAGACCGCCAGAAGAACAAAACTGGAGATATATGGCATGTGTCAGTGGAGGGTTTGCCTGCTTCTGGTGTTCTTTATGGGTATCGCATTAATGGTCCTCAAGGGTGGCAACAAGGTCATAGATTTGATGACAGCGTTATTCTTCTGGACCCCTATGCAAAATTAGTTTATGGTCGAAAGCACTTTGCTGTTGAAAAAGAGAAGCCAAGCCAGCTTTTCGGAACATATGATTTCGATAGCTCACCTTTTGACTGGGGTGACAATTATAAGCTTCCTAATTTGCCTGAGACAGATCTTGTTATATATGAAATGAATGTCCGTGCCTTCACTGCCGACGAGTCAAGCAGGCTTGCTCCAGCTATTCGTGGAAGTTACCTTGGTGTCATTGATAAAATTCCTCATTTGCTGGAACTTGGCGTTAATGCAGTGGAACTACTTCCTGTTTTTGAGTTCGATGAGCTGGAGTTGAAGAGGTTCCCTAACCCAAGGGACCACATGGTAAATACATGGGGATATTCTACAATCAACTTTTTTGCGCCCATGAGTCGTTATGCTAGTGCTGGTGGTGGACCTGTGGCTGCTTCCAAAGAGCTCAAACAGATGGTCAAGGCATTTCATAATTCTGGAATTGAGGTTATTTTGGATGTAGTTTACAACCATACAAATGAAGCTGATGATGTTAACCCTTACATGACTTCCTTTCGTGGTATTGATAACAAGGTCTATTACATGTTAGATCTCAACAACAGTGCACAGCTGCTGAACTTCTCGGGTTGCGGGAATACACTAAACTGCAACCATCCTGTTGTCAAGGAGCTTGTACTTGACAGTTTAAGACATTGGGTTAAGGAGTATCACATAGATGGATTTCGGTTTGACCTTGCGAGTGTTCTTTGTCGTGGACCAGATGGCAGTCCTCTTGATGCACCTCCACTTATTAAGGAAATTGCCAAAGACTCTGTATTGTCTAGATGTAAGATCATTGCTGAACCTTGGGACTGTGGTGGCCTTTATCTAGTAGGGAGGTTCCCTAATTGGGACAGGTGGGCTGAATGGAACGGGAAGTACAGAGATGATATTCGAAGATTTATTAAGGGAGATCCTGGTATGAAGGGGGTGTTTGCAACTCGCGTTTCTGGTTCTGCAGATCTCTACCAGGTGAACAATCGGAAGCCTTACCATAGTGTGAACTTTGTAATTGCTCATGATGGATTTACTTTATGTGACCTTGTTTCATATAACTCCAAGCACAATGATGCAAATGGAGAAGGTGGTCGTGATGGGTGCAATGACAACTACAGCTGGAACTGTGGCATTGAAGGAGAAACAAATGATTTGAATGTGCTAAGTCTTCGTTCAAGGCAAATGAAGAACTTCCATGTGGCATTAATGATTTCCCAGGGTACTCCAATGATGCTGATGGGAGATGAATATGGTCACACACGTTATGGAAACAACAATAGCTATGGACATGATACTCACATAAATAATTTTCAGTGGGGCCAGTTGGAAGAAAGGAAGGATGGCCATTTCAGGTTTTTCTCAGAGATGATCAAGTTTCGGCATAACCATCCTATATTGAGACGAGACAGGTTTCTCAACAAAAATGATGTCACTTGGCATGAAAATCGTTGGGAGAACCAGGACAGCAAATTTTTGGCATTTACGATACATGATCACAGTTCTGGTGGAGACATCTATTTGGCATTCAATGCTCATGAGTATTTTGTGGATGCTGTAATTCCCCCACCACCACACCATAAATCTTGGAGTCGTGTGGTGGATACCAACCTGGAATCACCAAAGGATATTGTCCCAGAAGGGGTGCCATTCACAGGTTCAGGGTACAGGATTGCTCCCTACTCTTCCATCTTGCTTAAGGCAAAGCCTTAG；SEQ ID NO.2。

(3) The nucleotide sequence of the starch debranching enzyme gene ZmZpu1 is as follows:

ATGTTGCTCCACGCCGGTCCCTCGTTCCTGCTCGCACCACCTCCGCGCTTTGCCGCCGCTCCGTCGTCAGCTTCGCCGAGGCGATCCAGGACACCGCAATCCTCGCCGCCGACGTCGCATTTCGCGCGCCCCGCTGATCCCGTGGCCCAAAGGGTGCGTCCCGTCGCGCCGAGGCCCCCCATGGCGACGGCGGAGGAGGGCGCCAGCTCTGACGTCGGCGTCGCCGTCGCCGAGTCCGCACAGGGGTTCTTGTTGGATGCGAGGGCTTACTGGGTGACAAAATCCTTGATTGCATGGAATATCAGTGATCAGAAAACTTCTCTCTTCTTATATGCAAGCAGAAATGCTACAATGTGCATGTCGAGTCAGGATATGAAAGGTTATGATTCCAAAGTTGAGCTGCAACCAGAAAATGATGGACTTCCATCCAGTGTGACCCAGAAATTCCCTTTTATCAGCTCTTATAGAGCCTTCAGAATTCCGAGCTCCGTTGATGTTGCCACCTTGGTGAAATGTCAACTTGCTGTTGCTTCATTTGATGCTCATGGGAACAGGCAAGATGTTACTGGGTTGCAACTACCTGGAGTATTGGATGACATGTTCGCCTACACTGGACCGCTTGGTACTATTTTTAGTGAAGAAGCTGATGTAAGTGTGAGCTTCTATGATGGTCCAGCTGGCCCTTTACTGGAAACAGTTCAACTCAACGAGTTAAATGGTGTTTGGAGTGTTACTGGTCCAAGGAACTGGGAGAACCGGTATTATCTATATGAAGTCACAGTATATCATCAAACTACAGGAAACATTGAGAAATGTTTAGCCGCTGATCCTTATGCTAGAGGGCTTTCTGCAAATAGCACACGAACTTGGTTGGTTGATATTAATAATGAAACATTAAAGCCACTTGCCTGGGATGGATTGGCGGCTGAAAAGCCAAGGCTTGATTCCTTCTCTGACATAAGCATATATGAATTGCACATTCGTGATTTCAGTGCCCATGATAGCACAGTGGACTGTCCTTTCCGAGGAGGTTTCTGTGCATTTACATTTCAGGATTCTGTAGGCATAGAACACCTAAAGAAACTATCTGATGCCGGTTTGACTCATGTCCATTTGTTGCCAAGCTTTCAATTTGGTGGTGTTGATGACATAAAGAGCAATTGGAAATGTGTTGATGAGATTGAACTGTCAAAACTCCCTCCAGGGTCAGATTTGCAACAAGCTGCAATTGTGGCTATTCAGGAAGAGGACCCTTATAATTGGGGGTATAACCCTGTGGTTTGGGGCGTTCCAAAAGGAAGCTATGCAAGTAACCCAGATGGTCCAAGTCGTATCATTGAGTACCGGCTGATGGTGCAGGCCTTGAATCGCTTAGGTCTTCGAGTTGTCATGGATGTTGTATACAATCATCTATACTCAAGTGGCCCTTTTGCCATCACTTCCGTGCTTGACAAGATTGTACCTGGATACTACCTCAGAAGGGACTCTAATGGTCAGACTGAGAACAGCGCGGCTGTGAACAATACAGCAAGTGAGCATTTCATGGTTGATAGATTAATCGTGGATGACCTTCTGAATTGGGCAGTAAATTACAAAGTTGACGGGTTCAGATTTGATCTAATGGGACATATCATGAAAAAGACAATGATTAGAGCAAAATCGGCTCTTCAAAGCCTTACAATTGATGAACATGGAGTAGATGGTTCAAAGATATACTTGTATGGTGAAGGATGGAACTTCGGTGAAGTTGCGGAAAATCAACGTGGGATAAATGGATCCCAGCTAAATATGAGTGGCACTGGGATTGGTAGTTTCAACGATAGAATCCGTGATGCTATAAATGGTGGCAGTCCGTTTGGGAATCCACTGCAACAAGGTTTCTCTACTGGATTGTTCTTAGAGCCAAATGGATTTTATCAGGGCAATGAAACAGAGACAAGGCTCACGCTTGCTACATACGCTGACCATATACAGATTGGATTAGCTGGCAATTTGAAGGACTATGTAGTTATATCTCATACTGGAGAAGCTAGAAAAGGATCTGAAATTCGCACCTTCGATGGCTCACCAGTTGGCTATGCTTCATCCCCTATAGAAACAATAAACTACGCCTCTGCTCATGACAATGAAACACTATTTGATATTATTAGTCTAAAGACTCCGATGGACCTCTCAATTGACGAGCGATGCAGGATAAATCATTTGTCCACAAGCATGATTGCATTATCCCAGGGAATACCATTTTTTCATGCTGGTGATGAGATACTACGATCTAAGTCGCTTGATCGAGATTCATATGACTCTGGTGATTGGTTTAACAAGATTGATTTTACCTATGAAACAAACAATTGGGGTGTTGGGCTTCCACCAAGAGAAAAGAACGAAGGGAGCTGGCCTTTGATGAAGCCAAGATTGGAGAACCCGTCGTTCAAACCTGCAAAACATGACATTATTGCTGCCTTAGACAAATTTATTGATATCCTCAAGATCAGATACTCATCACCTCTCTTTCGCCTAACTACAGCAAGTGATATTGTGCAAAGGGTTCACTTTCACAACACAGGGCCCTCCTTGGTTCCAGGAGTTATTGTCATGAGCATCGAAGATGCACGAAATGATAGGCATGATATGGCCCAGATAGATGAAACATTCTCTTGTGTCGTTACAGTCTTCAATGTATGTCCGTACGAAGTGTCTATAGAAATCCCTGATCTTGCATCACTGCGGCTTCAGTTGCATCCAGTGCAGGTGAATTCATCGGATGCGTTAGCCAGGCAGTCTGCGTACGACACCGCCACAGGTCGATTCACCGTGCCGAAAAGGACAGCAGCAGTGTTCGTGGAACCCAGGTGCTGA；SEQ ID NO.3。

construction of Gene editing vector pBUE411-1gR-ZmIsa2

1) Designing a CRISPR/Cas 9-based sgRNA action site aiming at a gene ZmIsa 2;

the nucleotide sequence of the sgRNA action site is as follows:

ZmIsa2：5’-GCGGAGATACGGACACACCGCGG-3’；SEQ ID NO.4；

2) PCR amplifying the target fragment by taking pCBC-MT1T2 plasmid as a template, MT1T2-F and MT1T2-F0 as primers;

the primer sequences are as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCTTTGATGAACTGACGCA-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCTTTGATGAACTGACGCAGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

the PCR amplification reaction system is as follows: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F, 00.5. Mu.l of MT1T2-F, 10. Mu.l of 2 XMix, ddH ₂ O 8μl。

The PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃30s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

The obtained target fragment is subjected to enzyme digestion and connection with a vector pBUE411, and the reaction system is as follows:

2 μl of fragment of interest (945 bp), 4112 μl,10xNEB T4 Buffer 1.5 μl,10×BSA 1.5 μl, bsaI (NEB) 1 μl, T4 Ligase (NEB)/high concentration 1 μl, ddH ₂ O 6μl，Total 15μl。

Reaction conditions: 37 ℃ for 5 hours, 50 ℃ for 5 minutes, and 80 ℃ for 10 minutes.

The ZmIsa2 gene editing vector pBUE411-1gR-ZmIsa2 is constructed.

(II) construction of Gene editing vector pBUE411-2gR-ZmIsa3-ZmZpu1

1) The sgRNA action site based on CRISPR/Cas9 is designed aiming at the genes ZmIsa3 and ZmZpu1;

the nucleotide sequence of the sgRNA action site is as follows:

zmsia 3:5'-ACCACGACGAAAGTTCAGAGCGG-3'; SEQ ID NO.7; and

ZmZpu1：5’-TGGTCAGACTGAGAACAGCGCGG-3’；SEQ ID NO.8；

2) PCR amplifying the target fragment by taking pCBC-MT1T2 plasmid as a template, MT1T2-F ', MT1T2-F0', MT1T2-R0', MT1T2-R' as a primer;

the primer sequences are as follows:

MT1T2-F’：5’-AATAATGGTCTCAGGCGCCACGACGAAAGTTCAGAG-3’；SEQ ID NO.9；

MT1T2-R0’：5’-CGCTGTTCTCAGTCTGACCCGCTTCTTGGTGCC-3’；SEQ ID NO.11；

MT1T2-R’：5’-ATTATTGGTCTCTAAACCGCTGTTCTCAGTCTGACC-3’；SEQ ID NO.12；

3) The target fragment was amplified by one round of PCR using two pairs of primers MT1T2-F ', MT1T2-F0', MT1T2-R0', MT1T2-R', and pCBC-MT1T2 plasmid as template.

The PCR amplification reaction system is as follows: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F ', 0.5. Mu.l of MT1T2-F0', 0.5. Mu.l of MT1T2-R ', 10. Mu.l of 2 XMix, ddH ₂ O 7μl。

2 μl of fragment of interest (964 bp), 4112 μl,10xNEB T4 Buffer 1.5 μl,10×BSA 1.5 μl, bsaI (NEB) 1 μl, T4 Ligase (NEB)/high concentration 1 μl, ddH ₂ O 6μl，Total 15μl。

The ZmIsa3 and ZmZpu1 gene editing vectors pBUE411-2gR-ZmIsa3-ZmZpu1 are constructed.

Example 2 Gene editing vector transfer into Agrobacterium LBA4404

1)CaCl ₂ Preparation of Agrobacterium tumefaciens competent cells by methods

(1) From YEP plates (Rif ^R ，Str ^R ) Picking up fresh LBA4404 single colony, inoculating the single colony into a YEP liquid culture medium containing 50mg/L Str and 25mg/L Rif, and carrying out shaking culture at 28 ℃ and 220rpm for 24-36 h;

(2) Taking 2mL of overnight activated fungus solution in logarithmic phase, inoculating into 50mL of YEP liquid culture medium, and culturing at 20deg.C to obtain fungus solution OD ₆₀₀ To about 0.4 to 0.6;

(3) Transferring the bacterial liquid into a 50mL sterile centrifuge tube precooled by ice, carrying out ice bath for 30min, and centrifuging for 10min at 4,000Xg at 4 ℃, so as to enrich bacterial cells;

(4) Precooling 0.05M CaCl with 10mL of ice ₂ Suspending thallus, ice-bathing for 30min, centrifuging for 10min at 4,000Xg, and enriching thallus;

(5) Precooling 0.05M CaCl with 1mL of ice ₂ Resuspension of thallus, storing the prepared competent cells at 4 deg.C for 24-48 hr with highest conversion efficiency, or packaging 100 μl of each tube into sterile tubes, adding 20% glycerol, quick freezing with liquid nitrogen, and storing at-80 deg.C.

2) Freeze thawing process of transforming competent agrobacterium tumefaciens cell

(1) Agrobacterium competence (200. Mu.L) was removed, placed on ice, 1. Mu.g plasmid DNA was added when just thawed, placed in liquid nitrogen for 1min, and then placed in a 37℃metal bath for 5min; plasmid DNA pBUE411-1gR-ZmIsa2 and pBUE411-2gR-ZmIsa3-ZmZpu1 respectively transformed agrobacteria competence;

(2) Taking out the centrifuge tube, adding 1mL of YEB liquid culture medium (without antibiotics), placing on a shaking table, and culturing at 28 ℃ for 35h at 180 r/min;

(3) Centrifuging at 3000rpm for 1min, collecting excessive supernatant, reserving 100 μl, re-suspending, pouring onto YEB plate culture medium (kan, rif), smearing uniformly, and culturing at 28deg.C in a constant temperature incubator for 36-48 hr;

(4) Monoclonal was picked, detected, and positive colonies were retained. Bacterial liquid PCR identification was performed using primers OsU3-FD 3/TaU-RD.

Wherein, the OsU-FD 3/TaU-RD primer sequence is as follows:

OsU3-FD3：5’-GACAGGCGTCTTCTACTGGTGCTAC-3’；SEQ ID NO.13；

TaU3-RD：5’-CTCACAAATTATCAGCACGCTAGTC-3’；SEQ ID NO.14。

the reaction system:

1. Mu.l of bacterial liquid, osU3-FD 31. Mu.l, taU3-RD 1. Mu.l, 2 Xmix 10. Mu.l, ddH ₂ O 7μl，Total 20μl。

The PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃45s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

Colony PCR product size was 831bp.

After the identification was correct, agrobacterium tumefaciens containing pBUE411-1gR-ZmIsa2 and Agrobacterium tumefaciens containing pBUE411-2gR-ZmIsa3-ZmZpu1 were obtained.

Example 3 maize genetic transformation

(1) The embryo taking material is a maize inbred line C01, maize young embryo is observed from the ninth day after pollination, and when the maize young embryo grows to about 1.5mm, the ears are taken back to a laboratory for embryo taking.

(2) Preparing an Agrobacterium invasion solution, and shaking activated Agrobacterium (Agrobacterium tumefaciens containing pBUE411-1gR-ZmIsa2 or Agrobacterium tumefaciens containing pBUE411-2gR-ZmIsa3-ZmZpu 1) to a specific concentration in YEB liquid medium (OD ₅₅₀ =0.5), bacterial pellet was collected by low-speed centrifugation, and then purified by using inf (composition per liter: n6 saltsVitamin (sigma) 2g, sucrose 68.5 g, glucose 36 g, L-precursor 0.7 g, MES 0.5g,1mg/ml 2, 4-D1.5 ml) +AS (Acetokringine, (100 mM), 1 ml)) broth was resuspended and shaken at 25℃75r/min for 24h to a concentration of OD ₅₅₀ It is only necessary to=0.3 to 0.4.

(3) Washing the young embryo taken out in the step (1) for 2 times by using inf+AS (same AS above) liquid culture medium, and then adding agrobacterium tumefaciens to invade the embryo for 20-30 min.

(4) The infected young embryos were transferred to a co-culture medium (composition: N6 salt and vitamin 4g per liter, sucrose 40 g, glucose 30g, L-precursor 0.7 g, MES 0.5g,1mg/ml 2,4-d 1.5ml, agarose (low EEO) 5g,8.5mg/ml silver nitrate 0.1ml,100mg/ml L-cysteine 0.4g,0.5M/L DTT 0.154 g), the scutellum of the young embryos was facing upwards, the embryonic axis was brought into contact with the surface of the medium, the dishes were sealed with a sealing membrane, and dark cultured in a incubator at 20℃for 3 days.

(5) Young embryos are transferred from the co-culture medium to resting medium (per liter of composition: N6 salt and vitamin 4g, sucrose 40 g, glucose 30g, L-precursor 0.7 g, MES 0.5g,1mg/ml 2,4-d 1.5ml,8.5mg/ml silver nitrate 0.1ml,100mg/ml L-cysteine 0.4g,0.5M/L DTT 0.154g, timetin (theca, sigma) 100 mg), the dishes are sealed with sealing film and incubated dark at 28℃for 7 days.

(6) All the young embryos were transferred to selection medium I (per liter: N6 salt and vitamin 4g, sucrose 40 g, glucose 30g, L-precursor 0.7 g, MES 0.5g,1mg/ml 2,4-d 1.5ml,8.5mg/ml silver nitrate 0.1ml,100mg/ml L-cysteine 0.4g,0.5M/L DTT 0.154g,Timentin 100mg,3mg/ml bialphos 0.5 ml) and dark cultured at 28℃for two weeks.

(7) All the young embryos were transferred to selection medium II (composition per liter: N6 salt and vitamin 4g, sucrose 40 g, glucose 30g, L-precursor 0.7 g, MES 0.5g,1mg/ml 2,4-d 1.5ml,8.5mg/ml silver nitrate 0.1ml,100mg/ml L-cysteine 0.4g,0.5M/L DTT 0.154g,Timentin 100mg,3mg/ml Bialaphos 1 ml), at which point selection was made, and bright-colored young embryos were selected for dark culture at 28℃for two weeks.

(8) After two selections, regeneration was started, sprouting and rooting were performed in regeneration medium I (per liter composition: MS (Murashige and Skoog) salt (sigma) 4.3g, sucrose 60g, gel 2.5g,2mg/ml glycine 1ml,Timentin 100mg), and when significant leaf and root growth was seen, transfer to regeneration medium II (per liter composition: MS salts 2.9g, sucrose 30g, gel 2.5g,2mg/ml glycine 1ml,Timentin 100mg). From this step, light culture was performed.

(9) When 3-4 leaves grow out of the regenerated seedlings, the regenerated seedlings are transferred to a greenhouse and checked, positive plants (pBUE 411-1gR-ZmIsa2 vector positive plants and pBUE411-2gR-ZmIsa3-ZmZpu1 vector positive plants) are reserved, the seedlings are transferred to soil after 2-3 days, and then normal corn growth management is carried out.

Example 4 identification of transgenic maize plants undergoing editing

Transferring the corn leaves into soil for one week, screening the corn leaves with glufosinate, extracting DNA from the corn leaves with the glufosinate by adopting a CTAB method, and carrying out PCR identification on positive plants of pBUE411-1gR-ZmIsa2 vectors by using ZmIsa2 gene specific primers; pBUE411-2gR-ZmIsa3-ZmZpu1 vector positive plants were identified by PCR using ZmIsa3 and ZmZpu1 gene-specific primers, and amplified products were detected by 1% agarose gel electrophoresis.

The ZmIsa2, zmIsa3 and ZmZpu1 gene specific primer sequences were as follows:

ZmIsa2-CRISPR-F1：5’-TACCGTTACCGCTTCCGA-3’；SEQ ID NO.15；

ZmIsa2-CRISPR-R1：5’-CCATCCTTGGACTGGGAC-3’；SEQ ID NO.16；

ZmIsa3-CRISPR-F2：5’-TGTGCTCGCTGTGAGTCT-3’；SEQ ID NO.17；

ZmIsa3-CRISPR-R2：5’-CCAGATGAAGTGTGTCCC-3’；SEQ ID NO.18；

ZmZpu1-CRISPR-F3：5’-GATTGCTTTGTTCATTGGC-3’；SEQ ID NO.19；

ZmZpu1-CRISPR-R3：5’-AACCCGTCAACCTAAGGC-3’；SEQ ID NO.20。

the reaction system is as follows:

DNA 1μl，ZmIsa2-CRISPR-F1/ZmIsa3-CRISPR-F2/ZmZpu1-CRISPR-F3 1μl，ZmIsa2-CRISPR-R1/ZmIsa3-CRISPR-R2/ZmZpu1-CRISPR-R31μl，2×mix 10μl，ddH ₂ O 7μl，Total 20μl。

the reaction procedure is: 94 ℃ for 5min;98℃30s,58℃30s,72℃1min,35 cycles; extending at 72 ℃ for 10min and 4 ℃ in infinity.

The primer pair (ZmIsa 2-CRISPR-F1/R1) is used for amplifying ZmIsa2 gene mutation, and the size of the product is about 0.4Kb; the primer pair (ZmIsa 3-CRISPR-F2/R2) is used for amplifying ZmIsa3 gene mutation, and the size of the product is about 0.5Kb; the primer pair (ZmZpu 1-CRISPR-F3/R3) is used for amplifying ZmZpu1 gene mutation, and the size of a product is about 0.5Kb;

PCR products with correct sizes of amplified products were sent to sequencing, and the sequencing results were compared with the wild type, as shown in FIG. 1 (only mutation sites are shown).

plants edited by two vector targets of pBUE411-1gR-ZmIsa2 and pBUE411-2gR-ZmIsa3-ZmZpu1 are pollinated with each other for hybridization, then selfed, and homozygous mutants with all the edited 3 targets are screened. Thus obtaining the corn with high carotenoid content.

3 gene-edited mutant lines were screened. The homozygous mutant material that undergoes editing is significantly higher than the carotenoid of wild-type maize. The high carotenoid material has important breeding value.

After harvesting, the carotenoid content of wild type and mutant corn kernels was determined, and the results are shown in fig. 2; the average carotenoid content of wild type (Wildtype) corn kernels is 2.34mg/100g, and the average carotenoid content of Mutant type (Mutant) corn kernels is 4.91mg/100g, which are significantly different.

The invention provides a method for improving the carotenoid content of corn kernels, which comprises the steps of preparing a corn material edited by a target gene according to the method, and then carrying out hybridization, backcrossing, selfing or asexual propagation on the corn material edited by the target gene, thereby creating a high carotenoid material.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> Jilin province academy of agricultural sciences

<120> a method for increasing carotenoid content in corn kernel by gene editing technique

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2400

<212> DNA

<213> Artificial Sequence

<400> 1

atggcctcct ccctccccgc gccgccggcc tcgccctctt cctcctggcg cggactcacg 60

ccccgctgcc ctccgcctcg ctgcggtccc ctcctcgccc gcgcggtagc gcgttcttac 120

cgttaccgct tccgaaccga cgacgacggc gtggtggacg tggccgtcgc cgggaaagac 180

ggcgatgcgg ggtatgtggt cgctatcgag gctcctaccc atggacagag gggcggtctt 240

gtgctccgcc ccgccggctc cggcgagggc gtccctctgg ccccagccgc gccgggaggt 300

gccctcgtgg ctgagttgtc ctacgacgtg gcccgcgcgc cgttccacgt ctcgttcacg 360

ctggccgacg cgatgggagc ggagatacgg acacaccgcg ggacgagctt ccgcgtgcct 420

gttggcgtcg gacggggctg cccctcgccg ctcggcctgt cccagtccaa ggatggggcc 480

gctaacttcg cggtttacag caagatcgcc aagggcatgg tgctctgcct cttcggtggt 540

ggcggcgggg acggacccgc gctggagatt gagctcgacc cgtacgtcca ccggaccggc 600

gatgtctggc acgtctcgat ggagagcgtg gaggggtacg cccgctacgg cttccgcagc 660

gggctgttcg caatgtttgg cattgaccgc ccgctactcg acccgtacgc caaggtgatc 720

ggggacttcg tcgctggcga ctctgttgat gaggatgggc tagctgtgcc atccataagg 780

tgtctcgcgt ccttgaagaa tgcacccaac tacgattggg gcagggacaa gcacccatgc 840

ttgccattgg agaagctggt ggtctaccgg gcaaatgtgg ctttgttcac caaggatagg 900

tcgagtcggc tggcagacaa tgccgctggt actttctccg gcatgtctgc aaaggtggaa 960

cacttcaggc atcttggtgt caatgcagtt ttgctggagc cagttttccc attccaccaa 1020

gtgaagggac catattttcc ataccatttt ttttcaccta tgagcttgta tagcagtgaa 1080

tgctccagtg tttcagctat caagtctatg aaggatatgg tcaaaacaat gcacagaaat 1140

gggatagagg ttctcttgga ggttgttttc acgcatactg ctgaaggagg ggcggagtgt 1200

cagatgatat cacttcgagg catcgatggt tcctcgtact acattgctga tggaatcgct 1260

ggatgcaagg caagtgtgtt gaattgcaac catccagtga ctcagaagct gattttggac 1320

agcctccgcc attgggtgct cgacttccat gttgatgggt tctgcttcat caatgctcct 1380

ttcctcgtca gaggtccacg tggtgagggc ctctcacggc ctccacttct ggaagccata 1440

gcatttgatc ctgttctttc aaagactaag atcattgcag atccttggtc tccgcttgac 1500

atatctaatg tgcaatttcc attccctcat tggaaaagat gggctgagat gaacacaaga 1560

ttctctatgg atgtgcgcaa gtttcttaag ggagaagcac ttatcagtga tcttgctaca 1620

cgtttgtgtg gcagtgggga cttattttcc tcaagggccc cagcattttc gttcaattat 1680

gtatccagga attctggact cactcttgtt gatctagtga gcttcagcag tgatgagctt 1740

gcttctgagt tcagctggaa ttgtggtgaa gaaggaccat cggagaacaa cgcagtcctt 1800

caaaccaggc taagacagat acgcaacttc ttgtttattc tattcatttc ccttggtatt 1860

cctgttctta acatggggga tgaatgtgga aactcagctg ctggttcaac atcatacaag 1920

gatagagggc ctctgaactg gaaagccttg aagaccgctt ttgttaagga agttaccggg 1980

tttatttcgt ttctatctgc actaaggagt cgacgagcag acattttcca gagatgcgag 2040

tttctaaaac ttgaaaatat acattggtat gggagtgatt tatctgagcc atgttgggag 2100

gatcctacta gcaactttct ttgcttgcac ataaatgcag agctggacga gaagctacca 2160

gattcgactg gaggtgattt gtatatctgt ttcaatgcaa acgaggagtc agcgagtgct 2220

actttaccag ctattgcaga aggatccatg tggctgcgct tggttgatac atcacttgca 2280

tttccaggtt tcttttccag agggtctagt catgaaacac accaggtgct aggattttcc 2340

tcatatcaag tgaaggcaca tagctgtgtt ctgttcgaat ccaagagggt tctttcatag 2400

<210> 2

<211> 2334

<212> DNA

<213> Artificial Sequence

<400> 2

atggattccg tcggtacaaa tcggcccccg ctgcgccccg ttgccgccgc agctactcga 60

cgcagcgcgc tcctgcgccc ccctagccac ctcgggctcg gcaatcgttt tgcggagact 120

aagcttggga tcgcgtcagg gtgtggagga ggaggagggt attttggaaa ggtacaggga 180

tttgatgcct tgcggagtac cacgacgaaa gttcagagcg ggaaggcggg gaggagtgtg 240

accaaggaaa tgggacacac ttcatctggc aatgaagtgc ccttgaaata ttcttcaggc 300

aaagccttcc ccctaggagt gtcacaagtt gacgatgggt taaattttgc aatattctca 360

caacatgctt cttctgtcac cctttgcttg aattttcctg agagaggcaa ccaagatgat 420

gtggacattg tagagtttgc tttagaccgc cagaagaaca aaactggaga tatatggcat 480

gtgtcagtgg agggtttgcc tgcttctggt gttctttatg ggtatcgcat taatggtcct 540

caagggtggc aacaaggtca tagatttgat gacagcgtta ttcttctgga cccctatgca 600

aaattagttt atggtcgaaa gcactttgct gttgaaaaag agaagccaag ccagcttttc 660

ggaacatatg atttcgatag ctcacctttt gactggggtg acaattataa gcttcctaat 720

ttgcctgaga cagatcttgt tatatatgaa atgaatgtcc gtgccttcac tgccgacgag 780

tcaagcaggc ttgctccagc tattcgtgga agttaccttg gtgtcattga taaaattcct 840

catttgctgg aacttggcgt taatgcagtg gaactacttc ctgtttttga gttcgatgag 900

ctggagttga agaggttccc taacccaagg gaccacatgg taaatacatg gggatattct 960

acaatcaact tttttgcgcc catgagtcgt tatgctagtg ctggtggtgg acctgtggct 1020

gcttccaaag agctcaaaca gatggtcaag gcatttcata attctggaat tgaggttatt 1080

ttggatgtag tttacaacca tacaaatgaa gctgatgatg ttaaccctta catgacttcc 1140

tttcgtggta ttgataacaa ggtctattac atgttagatc tcaacaacag tgcacagctg 1200

ctgaacttct cgggttgcgg gaatacacta aactgcaacc atcctgttgt caaggagctt 1260

gtacttgaca gtttaagaca ttgggttaag gagtatcaca tagatggatt tcggtttgac 1320

cttgcgagtg ttctttgtcg tggaccagat ggcagtcctc ttgatgcacc tccacttatt 1380

aaggaaattg ccaaagactc tgtattgtct agatgtaaga tcattgctga accttgggac 1440

tgtggtggcc tttatctagt agggaggttc cctaattggg acaggtgggc tgaatggaac 1500

gggaagtaca gagatgatat tcgaagattt attaagggag atcctggtat gaagggggtg 1560

tttgcaactc gcgtttctgg ttctgcagat ctctaccagg tgaacaatcg gaagccttac 1620

catagtgtga actttgtaat tgctcatgat ggatttactt tatgtgacct tgtttcatat 1680

aactccaagc acaatgatgc aaatggagaa ggtggtcgtg atgggtgcaa tgacaactac 1740

agctggaact gtggcattga aggagaaaca aatgatttga atgtgctaag tcttcgttca 1800

aggcaaatga agaacttcca tgtggcatta atgatttccc agggtactcc aatgatgctg 1860

atgggagatg aatatggtca cacacgttat ggaaacaaca atagctatgg acatgatact 1920

cacataaata attttcagtg gggccagttg gaagaaagga aggatggcca tttcaggttt 1980

ttctcagaga tgatcaagtt tcggcataac catcctatat tgagacgaga caggtttctc 2040

aacaaaaatg atgtcacttg gcatgaaaat cgttgggaga accaggacag caaatttttg 2100

gcatttacga tacatgatca cagttctggt ggagacatct atttggcatt caatgctcat 2160

gagtattttg tggatgctgt aattccccca ccaccacacc ataaatcttg gagtcgtgtg 2220

gtggatacca acctggaatc accaaaggat attgtcccag aaggggtgcc attcacaggt 2280

tcagggtaca ggattgctcc ctactcttcc atcttgctta aggcaaagcc ttag 2334

<210> 3

<211> 2856

<212> DNA

<213> Artificial Sequence

<400> 3

atgttgctcc acgccggtcc ctcgttcctg ctcgcaccac ctccgcgctt tgccgccgct 60

ccgtcgtcag cttcgccgag gcgatccagg acaccgcaat cctcgccgcc gacgtcgcat 120

ttcgcgcgcc ccgctgatcc cgtggcccaa agggtgcgtc ccgtcgcgcc gaggcccccc 180

atggcgacgg cggaggaggg cgccagctct gacgtcggcg tcgccgtcgc cgagtccgca 240

caggggttct tgttggatgc gagggcttac tgggtgacaa aatccttgat tgcatggaat 300

atcagtgatc agaaaacttc tctcttctta tatgcaagca gaaatgctac aatgtgcatg 360

tcgagtcagg atatgaaagg ttatgattcc aaagttgagc tgcaaccaga aaatgatgga 420

cttccatcca gtgtgaccca gaaattccct tttatcagct cttatagagc cttcagaatt 480

ccgagctccg ttgatgttgc caccttggtg aaatgtcaac ttgctgttgc ttcatttgat 540

gctcatggga acaggcaaga tgttactggg ttgcaactac ctggagtatt ggatgacatg 600

ttcgcctaca ctggaccgct tggtactatt tttagtgaag aagctgatgt aagtgtgagc 660

ttctatgatg gtccagctgg ccctttactg gaaacagttc aactcaacga gttaaatggt 720

gtttggagtg ttactggtcc aaggaactgg gagaaccggt attatctata tgaagtcaca 780

gtatatcatc aaactacagg aaacattgag aaatgtttag ccgctgatcc ttatgctaga 840

gggctttctg caaatagcac acgaacttgg ttggttgata ttaataatga aacattaaag 900

ccacttgcct gggatggatt ggcggctgaa aagccaaggc ttgattcctt ctctgacata 960

agcatatatg aattgcacat tcgtgatttc agtgcccatg atagcacagt ggactgtcct 1020

ttccgaggag gtttctgtgc atttacattt caggattctg taggcataga acacctaaag 1080

aaactatctg atgccggttt gactcatgtc catttgttgc caagctttca atttggtggt 1140

gttgatgaca taaagagcaa ttggaaatgt gttgatgaga ttgaactgtc aaaactccct 1200

ccagggtcag atttgcaaca agctgcaatt gtggctattc aggaagagga cccttataat 1260

tgggggtata accctgtggt ttggggcgtt ccaaaaggaa gctatgcaag taacccagat 1320

ggtccaagtc gtatcattga gtaccggctg atggtgcagg ccttgaatcg cttaggtctt 1380

cgagttgtca tggatgttgt atacaatcat ctatactcaa gtggcccttt tgccatcact 1440

tccgtgcttg acaagattgt acctggatac tacctcagaa gggactctaa tggtcagact 1500

gagaacagcg cggctgtgaa caatacagca agtgagcatt tcatggttga tagattaatc 1560

gtggatgacc ttctgaattg ggcagtaaat tacaaagttg acgggttcag atttgatcta 1620

atgggacata tcatgaaaaa gacaatgatt agagcaaaat cggctcttca aagccttaca 1680

attgatgaac atggagtaga tggttcaaag atatacttgt atggtgaagg atggaacttc 1740

ggtgaagttg cggaaaatca acgtgggata aatggatccc agctaaatat gagtggcact 1800

gggattggta gtttcaacga tagaatccgt gatgctataa atggtggcag tccgtttggg 1860

aatccactgc aacaaggttt ctctactgga ttgttcttag agccaaatgg attttatcag 1920

ggcaatgaaa cagagacaag gctcacgctt gctacatacg ctgaccatat acagattgga 1980

ttagctggca atttgaagga ctatgtagtt atatctcata ctggagaagc tagaaaagga 2040

tctgaaattc gcaccttcga tggctcacca gttggctatg cttcatcccc tatagaaaca 2100

ataaactacg cctctgctca tgacaatgaa acactatttg atattattag tctaaagact 2160

ccgatggacc tctcaattga cgagcgatgc aggataaatc atttgtccac aagcatgatt 2220

gcattatccc agggaatacc attttttcat gctggtgatg agatactacg atctaagtcg 2280

cttgatcgag attcatatga ctctggtgat tggtttaaca agattgattt tacctatgaa 2340

acaaacaatt ggggtgttgg gcttccacca agagaaaaga acgaagggag ctggcctttg 2400

atgaagccaa gattggagaa cccgtcgttc aaacctgcaa aacatgacat tattgctgcc 2460

ttagacaaat ttattgatat cctcaagatc agatactcat cacctctctt tcgcctaact 2520

acagcaagtg atattgtgca aagggttcac tttcacaaca cagggccctc cttggttcca 2580

ggagttattg tcatgagcat cgaagatgca cgaaatgata ggcatgatat ggcccagata 2640

gatgaaacat tctcttgtgt cgttacagtc ttcaatgtat gtccgtacga agtgtctata 2700

gaaatccctg atcttgcatc actgcggctt cagttgcatc cagtgcaggt gaattcatcg 2760

gatgcgttag ccaggcagtc tgcgtacgac accgccacag gtcgattcac cgtgccgaaa 2820

aggacagcag cagtgttcgt ggaacccagg tgctga 2856

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 4

gcggagatac ggacacaccg cgg 23

<210> 5

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 5

aataatggtc tcaggcgcct ttgatgaact gacgca 36

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 6

gcctttgatg aactgacgca gttttagagc tagaaatagc 40

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 7

accacgacga aagttcagag cgg 23

<210> 8

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 8

tggtcagact gagaacagcg cgg 23

<210> 9

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 9

aataatggtc tcaggcgcca cgacgaaagt tcagag 36

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 10

gccacgacga aagttcagag gttttagagc tagaaatagc 40

<210> 11

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 11

cgctgttctc agtctgaccc gcttcttggt gcc 33

<210> 12

<211> 36

<212> DNA

<213> Artificial Sequence

<400> 12

attattggtc tctaaaccgc tgttctcagt ctgacc 36

<210> 13

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 13

gacaggcgtc ttctactggt gctac 25

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 14

ctcacaaatt atcagcacgc tagtc 25

<210> 15

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 15

taccgttacc gcttccga 18

<210> 16

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 16

ccatccttgg actgggac 18

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 17

tgtgctcgct gtgagtct 18

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 18

ccagatgaag tgtgtccc 18

<210> 19

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 19

gattgctttg ttcattggc 19

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 20

aacccgtcaa cctaaggc 18

Claims

1. A method for improving the carotenoid content of corn kernels by using a gene editing technology is characterized by comprising the following specific steps:

(1) Designing a CRISPR/Cas 9-based sgRNA action site aiming at a gene ZmIsa 2;

the nucleotide sequence of the sgRNA action site is as follows:

ZmIsa2：5’-GCGGAGATACGGACACACCGCGG-3’；SEQ ID NO.4；

the primer sequences are as follows:

MT1T2-F：5’-AATAATGGTCTCAGGCGCCTTTGATGAACTGACGCA-3’；SEQ ID NO.5；

MT1T2-F0：5’-GCCTTTGATGAACTGACGCAGTTTTAGAGCTAGAAATAGC-3’；SEQ ID NO.6；

the nucleotide sequence of the sgRNA action site is as follows:

zmsia 3:5'-ACCACGACGAAAGTTCAGAGCGG-3'; SEQ ID NO.7; and

ZmZpu1：5’-TGGTCAGACTGAGAACAGCGCGG-3’；SEQ ID NO.8；

the primer sequences are as follows:

MT1T2-F’：5’-AATAATGGTCTCAGGCGCCACGACGAAAGTTCAGAG-3’；SEQ ID NO.9；

MT1T2-R0’：5’-CGCTGTTCTCAGTCTGACCCGCTTCTTGGTGCC-3’；SEQ ID NO.11；

MT1T2-R’：5’-ATTATTGGTCTCTAAACCGCTGTTCTCAGTCTGACC-3’；SEQ ID NO.12；

2. The method for increasing the carotenoid content of corn kernels by using a gene editing technology according to claim 1, wherein the PCR amplification reaction system in the step (2) is: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F, 00.5. Mu.l of MT1T2-F, 10. Mu.l of 2 XMix, ddH ₂ O8 μl; the PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃30s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

3. The method for increasing the carotenoid content of corn kernels by using a gene editing technology according to claim 1, wherein the PCR amplification reaction system in the step (4) is: 1. Mu.l of pCBC-MT1T2 plasmid, 0.5. Mu.l of MT1T2-F ', 0.5. Mu.l of MT1T2-F0', 0.5. Mu.l of MT1T2-R ', 10. Mu.l of 2 XMix, ddH ₂ O7. Mu.l; the PCR amplification reaction procedure was: 98 ℃ for 3min;98℃30s,57℃30s,72℃1min,35 cycles; 72 ℃ for 5min and 4 ℃ for infinity.

4. The method for increasing the carotenoid content of corn kernels by using a gene editing technology according to claim 1, wherein the enzyme digestion ligation reaction system in the step (5) is as follows: 2. Mu.l of fragment of interest, pBUE 4112. Mu.l, 10xNEB T4 Buffer 1.5. Mu.l, 10xBSA 1.5. Mu.l, bsaI 1. Mu.l, T4 Ligase 1. Mu.l, ddH ₂ O 6μl，Total 15μl。