CN114703209A

CN114703209A - Method for increasing oil content of soybean seeds

Info

Publication number: CN114703209A
Application number: CN202210311249.9A
Authority: CN
Inventors: 寿惠霞; 廖文英; 郭润泽
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2022-03-28
Filing date: 2022-03-28
Publication date: 2022-07-05
Anticipated expiration: 2042-03-28
Also published as: CN114703209B

Abstract

The invention discloses a method for improving oil content of soybean seeds, which is characterized in that a target site 135bp-154bp behind an initiation codon of a soybean esterase gene GmHO4 is subjected to frame shift mutation gene editing to ensure that the target site is not expressed, so that the oil content of the soybean seeds is improved; the target site PAM sequence is as follows: GGAGACTCTTTCACAGACAC is added. The invention edits the gene GmHO4 of the soybean esterase gene by a CRISPR/Cas9 gene editing technology so that the gene is not expressed, and increases the accumulation amount of fatty acid in soybean seeds by reducing the degradation rate of the fatty acid. The soybean of the strain line which is homozygous for the mutation site and has no foreign fragment insertion obtained by the invention has higher oil content, does not have adverse effect on the growth and development of the soybean, has extremely low safety risk, and provides more feasibility for putting the transgenic soybean with excellent characters into commercial planting in China in the follow-up process.

Description

Method for increasing oil content of soybean seeds

(I) technical field

The invention relates to the field of crop breeding and genetic engineering, in particular to a method for improving the oil content of soybean seeds by editing the gene of a soybean esterase gene GmHO4 so as to prevent the soybean esterase gene from being expressed.

(II) background of the invention

The common transgenic crops on the market comprise transgenic soybeans, transgenic corns, transgenic tomatoes and the like, which are all transgenic agricultural products passing safety verification.

The gene editing technology is also a genetic engineering technology, but does not introduce exogenous gene fragments or large fragment sequences, so that the safety risk is relatively low.

Whether the gene editing plant is a transgenic plant or not is the key point for whether the gene editing crop can smoothly enter the field for planting. The relevant plant scientists have pointed out that with the advent of gene editing tools, the current definition of transgenic organisms and the corresponding regulatory framework need to be reconsidered, since the genomic modifications achieved by gene editing methods are very different from those of transgenic technology. And most CRISPR-induced gene mutations are small indels rather than large fragment insertions or rearrangements. Such small indel variations are also typically present in plants grown in nature or induced on a large scale using radiation or chemical mutagens. Second, transgenes are stably inherited in traditional transgenic plants, while trait-improved plants constructed using CRISPR and other gene editing tools can be transgene-free. Thus, there is a scientific belief that plants without transgene editing should be treated in the same manner as plants grown by traditional chemical or radiation mutagenesis, and should not be subject to particular regulatory policies. The gene editing plant is probably a breakthrough for obtaining commercial planting of transgenic crops in China.

The safety evaluation management of agricultural gene editing plants is further standardized, and the method has milestone significance for the research and development of biological breeding technology and the promotion of production industry in China.

In the previous studies, high-oil soybeans were developed by modifying genes affecting fatty acid synthesis by means of genetic engineering, but studies have shown that increasing the oil content of seeds by means of genetic engineering is accompanied by smaller seeds and lower yields.

The soybean is one of four major oil crops in the world, the soybean dependency required in China is as high as eight-percent at present, and the problem of the soybean in China is insufficient industrial supply. The gene GmHO4 encodes an esterase, the main role of which is to degrade fatty acids.

Disclosure of the invention

The invention aims to provide a method for improving the oil content of soybean seeds, wherein an esterase gene GmHO4 highly expressed in soybean pods and seeds is selected for gene editing, and the accumulation amount of fatty acid in the soybean seeds is increased by reducing the decomposition of the fatty acid in the process of the development and maturation of the soybean seeds, so that the soybean material with high oil content is obtained, and the pressure of the soybean oil industry in China can be relieved to a certain extent.

The technical scheme adopted by the invention is as follows:

the invention provides a method for improving oil content of soybean seeds, which is characterized in that a target site at 135bp-154bp behind an initiation codon of a soybean esterase gene GmHO4 is subjected to frame shift mutation (insertion or deletion) gene editing to ensure that the target site is not expressed, so that the oil content of the soybean seeds is improved; the target site PAM sequence is as follows: GGAGACTCTTTCACAGACAC are provided.

Further, the soybean esterase gene GmHO4 is divided into GmHO4a and GmHO4b, and the corresponding nucleotide sequences are SEQ ID NO.1 and SEQ ID NO.2 respectively.

Further, the gene editing of the target site is performed by using a CRISPR/Cas9 gene editing technology, and the specific method comprises the following steps: (1) artificially synthesizing a target site gene fragment of a soybean esterase gene GmHO4, connecting the target site gene fragment to a vector Cas9MDC123, constructing a recombinant vector (Cas 9MDC 123-target site gene fragment) containing the target site gene fragment, and transforming agrobacterium to obtain agrobacterium containing the recombinant vector; (2) infecting a soybean explant by using agrobacterium liquid containing a recombinant vector in the step (1), and screening strains which do not contain Cas9 protein and are successfully edited and homozygous with GmHO4 gene (homozygous means that GmHO4a and GmHO4b in the GmHO4 gene are edited), so as to obtain strains with the oil content of soybean seeds improved; the GmHO4 gene is successfully edited, which refers to the condition that base deletion or insertion occurs at a target site of the GmHO4 gene, so that frame shift occurs, and the protein expression is terminated early.

Experiments show that the GmHO4 is highly expressed mainly in pods and seeds during the seed development period, and has extremely low expression level or even no expression level in other tissues such as roots, stems, leaves and the like, so that the growth and development of soybean plants after gene editing of GmHO4 are not adversely affected, and the accumulation of oil is affected only in the oil accumulation process of seeds.

The method can be expanded to prevent the expression of the GmHO4 gene by other means, such as radiation, chemical mutagenesis and the like, and obtain the mutant of the GmHO4 to improve the oil content of the soybean seeds; meanwhile, the haplotype with no expression or low expression of the GmHO4 gene is screened in soybean genetic resources, and the oil content of soybean seeds can be improved, so the invention also covers the content.

Compared with the prior art, the invention has the following beneficial effects:

the invention edits the gene GmHO4 of the soybean esterase gene by a CRISPR/Cas9 gene editing technology so that the gene is not expressed, and increases the accumulation amount of fatty acid in soybean seeds by reducing the degradation rate of the fatty acid. According to the invention, after the characteristics such as seed structure development and yield are evaluated, the gene editing of GmHO4 does not cause defects or adverse effects on the seed development; its increase in soybean seed oil content is not a cost to reduce yield. In addition, although the gene editing is still a transgenic technology, the gene editing is different from the traditional transgenic technology, the Cas9 protein introduced into the T0 generation seedlings and other exogenous fragments on an expression vector can be screened in a character separation mode in later generations, and strains which do not have any exogenous fragment inserted and only generate mutation at the target site of GmHO4 are selected. The soybean of the strain line which is homozygous for the mutation site and has no foreign fragment insertion obtained by the invention not only has higher oil content, but also has no adverse effect on the growth and development of the soybean. Because no exogenous fragment is introduced, the safety risk is extremely low, and more feasibility is provided for putting the transgenic soybean with excellent characters into commercial planting in China in the follow-up process.

(IV) description of the drawings

FIG. 1, target site and mutation information of gmho4 a/b; (a) the position and sequence of the target site; (b) two modes of mutation of GmHO4a in GmHO4 a/b; (c) two modes of mutation of GmHO4b in GmHO4 a/b; (d) the identification chart of Cas9 protein in gmho4a/b, CK + represents a positive PCR result with Cas9MDC123 plasmid as a template, WT represents a negative PCR result with wild-type leaf genome as a template, Black represents a negative PCR result with water as a template, gmho4a/b #1 represents a gene editing soybean purified double-mutant plant, and gmho4a/b #2 represents a gene editing soybean purified double-mutant plant.

FIG. 2, expression pattern of GmHO4 in wild type soybean Williams82 (WT); (a) the expression of GmHO4a and (b) GmHO4b in various tissues of soybean; (c) expression of GmHO4a and (d) GmHO4b in various structures of soybean seeds.

FIG. 3 is a plot of oil content of field harvested gmho4a/b seeds versus wild type seed content.

FIG. 4, change in the content and percentage of each fatty acid in gmho4a/b seeds; (a) the content of each fatty acid in gmho4a/b seeds; (b) percentage of each fatty acid in the gmho4a/b seeds.

FIG. 5, gmho4a/b growth trait histogram; (a) graph comparing the growth traits of WT and gmho4a/b 30 days after greenhouse sowing; (b) statistical plot of plant height 30 days and 37 days after greenhouse sowing, Bar 5 cm.

FIG. 6, gmho4a/b agronomic trait histogram; (a) WT harvest in field vs gmho4a/b seed size plot, Bar 1 cm; (b) a single particle weight statistical chart; (c) WT was harvested in the field as a comparison to gmho4a/b plants, Bar 10 cm; (d) statistical plot of WT and gmho4a/b plant heights after field harvest.

FIG. 7, structural development of wild type soybean Williams82 (WT) and gmho4a/b seeds at different time periods, Bar 250 μm.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the formula of the culture medium used in the embodiment of the invention is as follows:

composition of LB liquid medium: 5g/L of yeast extract, 10g/L of tryptone and 10g/L of sodium chloride, and adjusting the pH value to 7.0, wherein the solvent is deionized water.

LB solid medium: 12g/L agar powder is added into an LB liquid culture medium.

YEP liquid medium composition: 5g/L yeast extract, 10g/L tryptone, 5g/L sodium chloride, adjusting the pH value to 7.0, and using deionized water as a solvent.

YEP solid medium: 12g/L agar powder was added to YEP liquid medium.

B5 macroelements: KNO₃ 2500mg/L、MgSO₄·7H₂O 50mg/L、CaCL₂·2H₂O150 mg/L、 (NH₄)₂SO₄ 134mg/L、NaH₂PO₄·H₂O150 mg/L and the solvent is water.

B5 trace elements: KI 0.75mg/L, H₃BO₃ 3.0mg/L、MnSO₄·4H₂O 10mg/L、ZnSO₄·7H₂O 2.0mg/L、Na₂MoO₄·2H₂O 0.25mg/L、CoCl₂·6H₂O 0.025mg/L、CuSO₄·5H₂O0.025 mg/L and water as solvent.

MS macroelements: NH (NH)₄NO₃ 1650mg/L、KNO₃ 1900mg/L、MgSO₄·7H₂O 370mg/L、 CaCl₂·2H₂O₄40mg/L、KH₂PO₄·H₂O170 mg/L and the solvent is water.

MS trace elements: KI 0.83mg/L, H₃BO₃ 6.2mg/L、MnSO₄·4H₂O 22.3mg/L、ZnSO₄·7H₂O 8.6mg/L、Na₂MoO₄·2H₂O 0.25mg/L、CoCl₂·6H₂O 0.025mg/L、CuSO₄·5H₂O0.025 mg/L and water as solvent.

B5 vitamin mixture: 100mg/L inositol, 1.0mg/L nicotinic acid, 1.0mg/L pyridoxine hydrochloride, 10mg/L thiamine hydrochloride, and water as solvent.

B5 iron salt: na-disodium edetate (Na)₂-EDTA)37.3mg/L、FeSO₄·7H₂O 278mg/L, the solvent is water.

Co-culture solution: 1/10B5 macroelement, 1/10B5 microelement, 1/10B5 vitamin mixed liquor, 30g/L sucrose, 3.9 g/L2- (N-morpholino) ethanesulfonic acid (MES), pH 5.4, and solvent is deionized water. Sterilizing under high pressure, cooling, adding filter sterilized Gibberellin (GA)₃)0.25mg/L and 40mg/L acetosyringone.

Bud induction medium: macroelement 1 XB 5, trace element 1 XB 5, vitamin mixed liquor 1 XB 5, iron salt 1 XB 5, sucrose 30g/L, MES 0.59g/L, agar 7g/L and pH 5.7. The components are sterilized at high pressure and cooled, and then 1.11mg/L of BAP (2, 2-bis (4-hydroxy-3-aminophenyl) propane), 100mg/L of cefotaxime and 5mg/L of glufosinate-ammonium which are sterilized by suction filtration are added.

Stem elongation medium: 1 XMS macroelement, 1 XMS microelement, 1 XB 5 vitamin mixed solution, 30g/L sucrose, 0.59g/L MES, 7g/L agar, pH 5.7. Sterilizing under high pressure, cooling, adding suction-filtered sterilized asparagine 50mg/L, glutamine 50mg/L, auxin (IAA)100 μ g/L, and Gibberellin (GA)₃)500 mu g/L, zeatin 1mg/L, cefotaxime 100mg/L and glufosinate-5 mg/L.

Rooting culture medium: 1 XMS macroelement, 1 XMS microelement, 1 XB 5 vitamin mixed liquor, 1 XB 5 iron salt, 30g/L sucrose, 0.59g/L MES, 7g/L agar, and pH 5.4. After autoclaving and cooling, 50mg/L asparagine and 50mg/L glutamine are added.

The room temperature is 25-30 ℃, and the DEPC water refers to ultrapure water (primary water) which is treated by DEPC (diethyl pyrocarbonate) and is sterilized at high temperature and high pressure, and is colorless liquid.

Example 1 construction of Cas9MDC 123-GmHO4 expression vector

1. Selection of target sites

Because the soybean is an ancient tetraploid, 2 homologous soybean esterase genes GmHO4 (the classification number in NCBI is 3847) exist in the genome of the soybean, and are respectively named as a gene GmHO4a (the nucleotide sequence is shown as SEQ ID NO. 1) and a gene GmHO4b (the nucleotide sequence is shown as SEQ ID NO. 2). When designing a gene editing target site, sites capable of simultaneously targeting GmHO4a and GmHO4b were selected.

GN19NGG was chosen on GmHO4 as the target site for gene editing according to the product specification of plasmid Cas9MDC123 (offered by professor Kan at Iowa State university), and referenced to gene editing target site design tools developed by Liu flare laboratory (https:// www.genome.arizona.edu/crispr/more. html). In order to create double mutant materials when designing target sites, we chose sites that can target both GmHO4a and GmHO4 b. The PAM sequence for the target site of GmHO4 we designed was: GGAGACTCTTTCACAGACACTGG (nucleotide sequence is shown in SEQ ID NO. 3), which are both located 138bp downstream of the start codons of GmHO4a and GmHO4b, as shown in a in figure 1.

GmHO4a nucleotide sequence:

atggcttcttctgtgtcatccatggtttctaccaccctcctcctaattaccatctgcacactgtcctcacttctgtcagttgcatctg cagcaacagaggagggacgaacaaggccattcaaaagggtctatgcctttggagactctttcacagacactggcaacacccaaaa tgcagaaggtccaagtggctttggccatgtttcaaactctccctatggaaccactttctttaaccactccaccaataggtactcagatg gtaggcttgtgattgattttgtggctgaagcactttcactgccttacttgcccccctaccgtcatagcaaaggcaatgacacttttggtgt taactttgctgttgctggttccacagccataaaccatttgttctttgtcaagcacaacctctcccttgacatcactcctcagtccatccaaa cccagatgatatggttcaacaggtacctggagagccaggactgccaagagtcaaagtgcaatgattttgatgacactctattttggttt ggggagattggagtcaatgactatgcctacactcttggatctaccgtctcagatgaaaccataaggaagcttgcaatcagcagtgtct caggagctttacaggtatgatttaggacaaaatttacaaataattctttaggtgagttaggttcttattgtgttgttctcccatcaaaattgg agtctcacttttttagttgttttttgtattattcacctcgataatttgtgttggcctttaattcaaacttttattaagtgaattgtcgaggtagaac tctaatttcaattgaaaaacaacactaaaaacatctatagatcttcatctaatttttgtggtttggtttactgtcctaattggtcttttataccaa gtagttaaaactcaaaaacttgaaattttgtgcacagatcatcttatcccaattttataattttcattcctttgttttgcagacattgcttgaga agggtgccaagtacctagtagtgcagggtttgcctctaactgggtgcttgacattgtccatgtacctggctccaccagatgataggga tgacattggatgtgtgaaaagtgtcaacaaccaaagctactaccacaaccttgtgctgcaagacaaattacaagaattcaggaaaca gtaccctcaagctgtcatactttatgctgattactatgatgcctaccgcactgtcatgaagaatccaagcaaattcggattcaaagaga ccttcaacgtttgctgtggatcgggagaaccaccttacaacttcactgtgtttgccacatgtggcacacctaatgccactgtgtgctca agcccttctcagtacatcaattgggatggtgttcacctcactgaggccatgtataaagttatttctagtatgtttttgcaaggaaatttcac ccaacctccgtttaattttttgttgggaaaaaaggagagggtggggtgaatggttcacccaagaataatactaatatttgggatttgctt gtccttatgactttaatgcatctgctaatgtaactataagtgagggaatcaggttttacctgttttgctagaacttgtgtcctctgcacatca tgtatgatgagttcaaaggaatatgttgtatttgtatttgtattagtatctgccaaggctgtcttaaactcggtatcagttagtgcttatctag attagttgattttgggttaataaagtggttttctatttata。

GmHO4b nucleotide sequence:

atggcttcttgtgtgtcatccatgtcttctaccatcctcatcctaattgccatctgcacactgtcctcacttctgtcagctgcatctg cagcaacagaggagggacgaacaaggcccttcaaaagggtctatgcctttggagactctttcacagacactggcaacaccaaaaa tgccgaaggtccaagtggctttggtcatgtttcaaactctccctacggcaccactttcttcaaccactccacaaacaggtactcagatg gtaggcttgtgattgattttgtagctgaagcactttcactgccttacttgcccccctaccgtcacagcaaaggcaatgacacttttggtgt taactttgctgttgctggctccacagccataaaccatttgttctttgtgaagcacaacctctcccttgatatcactgctcagtccatccaa acccagatgatatggttcaacaggtacctagagagccaggaatgtcaagaatcaaagtgtaatgattttgatgacactctgttttggttt ggggagattggagtcaatgactatgcctacactcttggatctactgtctcagatgagaccataaggaagcttgcaatcagcagtgtct caggagctttacaggtatgatttaggacaaaatttacaaataattttttaggtgcttattgtgttgctctcccatcaaaattgaagtctcact tctttagttgtatttggtgttattctcttatcagaattgctgtttcacctcgataatttgtgttgacctttaattcaaacttttattaactgagttat cgaggtagaaactctaatttcaattgaaaaacaacactaaaagcatctatagatcttcatctaagttttgtggtatcgtttattgtcctaatt gttctttaatttattctaagtagttaaaactcaaaaacttgaaattttgtgcacagatcatctaatcctaattttataatattcattctttgcgttg cagacgttgcttgagaagggtgccaagtacctagttgtgcagggtatgcctctaactgggtgcttgacattgtccatgtacctggctc ctccagatgatagggatgacattagatgtgttaaaagtgttaacaaccaaagctactaccacaatcttgtgctacaagacaaattacaa gaattcaggaaacagtaccctcaagctgtcatactttatgctgattactatgatgcctaccgcactgtcatgaagaatccaagcaaata cggattcaaagagaccttcaacgtttgctgtggatcaggagaaccaccttataacttcactgtgtttgccacatgtggcacacctaatg ccactgtgtgttcaagcccttctcagtacatcaattgggatggtgttcatctcacggaggccatgtacaaagtaatttctagtatgtttttg caaggaaatttcacccaacctccgtttaattttttgttggaaaaaaaggagagggtggggtgaatggttagtatttgggatttgcttgtc cctatgactttaatgcatcagctaatgtaactataagtgagggaatcaggtcttacctgttttgctacaacttgtgtcctctgcacatcata tatgatgagaagttctaaggaatatgttgtatttgtattagtatctgccaaggctgtcttaaactcggtattagctagtgcttactttgtttag attagttgattttgggttaataaagtgttttttcttttctttttacaaataaatttaaagaaaatgtaattttataattttattcaataaaaaattatc aggatgaatttattaacttttac。

2. target site sequence synthesis

According to the target site selected in the step 1, a primer Cas9MDC 123-GmHO4-F/R (artificially synthesized) is designed, a gene GmHO4a (the nucleotide sequence is shown as SEQ ID NO. 1) and a gene GmHO4b (the nucleotide sequence is shown as SEQ ID NO. 2) are used as templates, and the primers react for 6h in 10x PCR buffer solution at 50 ℃ to anneal to form a double-stranded DNA fragment with a Bpi1 enzyme cutting site cohesive end, namely a PAM fragment.

Cas9 MDC123-GmHO4-F：5’-GATTGGAGACTCTTTCACAGACAC-3’。

Cas9 MDC123-GmHO4-R：5’-AAACGTGTCTGTGAAAGAGTCTCC-3’。

3. Cas9MDC 123-PAM expression vector

Selecting T4 DNA Ligase (Takara), connecting the PAM fragment formed after annealing to a Cas9MDC123 skeleton cut by Bpi1 under the action of T4 Ligase, transferring the connection product into escherichia coli competence DH5 alpha (100 mu L, exclusively living things), standing on ice for 30min, bathing for 45s at 42 ℃, adding 500 mu L LB liquid culture medium, 200rpm 1h at 37 ℃, sucking 100 mu L of bacterial liquid, uniformly coating the bacterial liquid on LB solid culture medium containing 50mg/L spectinomycin, and culturing for 12h in dark at 37 ℃; and (3) after growing the monoclones, selecting 2-3 monoclones, activating, sequencing in a company, and verifying to be correct to obtain a Cas9MDC 123-PAM expression vector.

Example 2 transformation of Agrobacterium with Cas9MDC 123-PAM

500ng of Cas9MDC 123-PAM vector plasmid constructed in example 1 was added to a centrifuge tube containing Agrobacterium LBA4404 competent cells (100. mu.L, Vibrio species), placed on ice for 5 minutes, liquid nitrogen-quenched for 10 seconds, coagulated, placed in a 37 ℃ water bath, water-bathed for 5 minutes, placed on ice for 2 minutes, then 0.5mL YEP liquid medium without antibiotic was added, shake-cultured at 250rpm and 28 ℃ for 3 hours, centrifuged at 3500rpm and 3 minutes, and the pellet was evenly spread on YEP solid medium containing 50mg/L kanamycin and 50mg/L streptomycin, and cultured at 28 ℃ for 2 days to obtain Agrobacterium carrying Cas9MDC 123-PAM expression vector.

Example 3 Agrobacterium-mediated transformation of Soybean cotyledonary node with Cas9MDC 123-PAM

1. Soybean explant

Disinfecting seeds of wild type soybeans Williams82 (Williams82) with chlorine, placing the soybeans in a culture dish (60-80 grains/dish), and placing the culture dish in a drying pot; adding 100mL of bleaching water (standing white) to the bottom of the drying pot, adding 5mL of 12M concentrated hydrochloric acid, and sealing and sterilizing the culture dish in the drying pot overnight; and (3) culturing the sterilized soybean seeds on a germination culture medium at 24 ℃ for 14-16 hours to ensure that the soybean seeds fully absorb water. The imbibed soybeans have their seed coats removed and wounds are made at the cotyledonary node as soybean explants.

2. Agrobacterium infection liquid

Inoculating agrobacterium tumefaciens carrying a Cas9MDC 123-PAM expression vector in the embodiment 2 into 5mL YEP liquid culture medium for activation, and culturing at 28 ℃ until saturation to obtain activated agrobacterium tumefaciens bacterial liquid; inoculating the activated agrobacterium liquid with an inoculation amount of 0.5% of volume concentration into 250mL of YEP liquid culture medium, and culturing at 28 ℃ until the logarithmic growth phase (OD600 is 0.8) of the agrobacterium to obtain the agrobacterium liquid, wherein the agrobacterium liquid has the best infection activity and the appropriate concentration. And (3) carrying out centrifugal enrichment (4000rpm for 10min) on the agrobacterium liquid, removing a supernatant, and resuspending a precipitate by using an equal-volume co-culture solution to obtain an agrobacterium infection liquid.

3. Infection with Agrobacterium

Immersing the soybean explants prepared in the step 1 by using the agrobacterium infection solution prepared in the step 2, and infecting the soybean explants at room temperature (30 min). Sterile filter paper was placed in the petri dish and soaked with co-culture medium. Placing the infected soybean explants on filter paper (with cotyledonary nodes upward), culturing in the dark at 24 ℃ for 3 days, trimming overlong hypocotyls to a proper length (0.5cm), transferring to a bud induction medium, and culturing for 2 weeks; non-cluster buds were removed and subcultured once in bud induction medium. And (3) cutting off cotyledons and screened dead buds of the explants forming the cluster buds, transferring the explants to a stem elongation culture medium, subculturing once every two weeks until the stem length reaches 5cm, transferring the seedlings from the base part of the stem to a rooting culture medium, culturing for 1-2 weeks until the root length reaches 3-5 cm, and then transplanting the seedlings to nutrient soil. The whole tissue culture process is carried out under the condition of 24 ℃ for 16 hours of illumination/8 hours. The transplanted seedlings are firstly trained in an incubator (16-hour illumination at 28 ℃ and 8-hour humidity of 40%); and transplanting the seedlings to a greenhouse or a proper natural environment for cultivation after the 3 rd three compound leaves of the seedlings grow in the incubator, namely the transgenic soybean T0 generation seedlings.

Example 4 screening of Positive seedlings and trait isolation to obtain mutant line GmHO4a/b without Cas9 protein

1. PCR identified whether T0 seedlings obtained in example 3 were positive seedlings containing Cas9 protein:

50mg of leaves of T0-generation seedlings obtained in example 3 were taken, 200. mu.L of TPS solution was added, ground by a grinder, and subjected to cell lysis in a water bath at 65 ℃ for 20 minutes; centrifuging at 12000rpm for 10min, sucking supernatant, and adding isopropanol with equal volume for DNA sedimentation; then adding 500 mu L of 75% alcohol to wash off protein and other impurities, centrifuging at 12000rpm for 10min, removing supernatant, and finally adding 30 mu L of water to dissolve to obtain T0 seedling genome.

Taking 1 mu L of genome obtained by the method as a template, taking a primer as Cas9-id-F/R, taking the plasmid Cas9MDC 123-PAM constructed in the example 1 as a positive control, taking wild soybean Williams82 genome DNA as a negative control, and taking water as a blank control. If the size of the PCR product is 750bp, the corresponding T0 generation transgenic seedling with the target band is a positive seedling.

2. Gene sequencing verification of T0 generation positive seedlings

Taking the genome of the T0 generation positive seedling screened in the step 1 as a template, and carrying out primer: GmHO4a-id-F/R and GmHO4b-id-F/R, PCR reaction is carried out, the PCR reaction product is sequenced and compared with wild GmHO4a and GmHO4b, the result shows that the GmHO4a and GmHO4b genes of the positive seedling of the T0 generation are changed, and the gene editing plant obtained by the seedling of the T0 generation is GmHO4a/b^+/-And carries a Cas9 protein.

3. Gene detection of T1 generation seedlings

The seeds of the positive seedlings of the T0 generation of the gene-edited soybean screened in the step 1 are planted to obtain seedlings of the T1 generation of the gene-edited soybean, two strains are selected and marked as #1 and #2 respectively, the genome of the two strains of the T1 generation seedlings is obtained according to the method of the example 4, and the sequencing result is shown in b and c in the picture 1, wherein b is the mutation of GmHO4a in the #1 and the #2, and c is the mutation of GmHO4b in the #1 and the # 2.

Taking the genome of the T1 generation seedling as a template, and carrying out primer: GmHO4a-id-F/R and GmHO4b-id-F/R, PCR reaction is carried out according to the method of step 2, the PCR products are detected by gel electrophoresis, the plasmid Cas9MDC 123-PAM constructed in example 1 is used as a positive control, wild soybean Williams82 genome DNA is used as a negative control, water is used as a blank control, and the result is shown as d in figure 1.

By the above method we obtained two homozygous double mutant strains GmHO4a/b #1, GmHO4a/b #2, marked as gene-edited soybean GmHO4a/b #1, gene-edited soybean GmHO4a/b #2, which do not contain Cas9 protein and in which GmHO4a and GmHO4b are mutated simultaneously, for subsequent experiments.

The annealing temperature of the PCR reaction system is 56 ℃, and the procedure is 94 ℃ for 5 min; 30s at 95 ℃, 30s at 52 ℃, 30s at 72 ℃ and 34 cycles; 5min at 72 ℃.

TPS solution: 100mM Tris-HCl, 10mM EDTA, 1M KCl, water as solvent, pH 8.0.

Cas9-id-F：5’-ACCACGCTCACGATGCTTAC-3’

Cas9-id-R：5’-ACTTGGATGGCAGAGCCAGC-3’

GmHO4a-id-F：5’-CGAGAAGTAATTTTTTTAAAAT-3’

GmHO4a-id-R：5’-AGAACCTAACTCACCTAAAG-3’

GmHO4b-id-F：5’-CGTTATAGTTAATGACTTAATG-3’

GmHO4b-id-R：5’-AACAGCAATTCTGATAAGAG-3’。

Example 5 phenotypic analysis of Gene-edited Soybean homozygous double mutant lines gmho4a/b

1. Expression pattern analysis of wild type Williams82 soybean GmHO4

RNA extraction: freezing a sample by using liquid nitrogen, grinding, adding 1ml of Trizol (purchased from Invitrogen company) into the sample, quickly mixing the mixture uniformly, standing the mixture at room temperature for 15min, reversing the mixture uniformly every 2-3 min, centrifuging the mixture at 12,000rpm for 5min, and removing precipitates; transferring the supernatant into a new centrifuge tube, adding isopropanol with the same volume as the supernatant, and centrifuging at 12000rpm for 10 min; then washed with 75% ethanol/0.1% DEPC water to remove impurities, and finally dissolved with 30. mu.L of 0.1% DEPC water to obtain the total RNA of the sample. Then, the cDNA of the sample is obtained by reverse transcription using a reverse transcription kit (Takara), and the specific experimental method is described in the kit instructions.

Relative expression amount of GmHO4 in soybean tissue: different tissues of wild type williams82 soybean were selected: 3 times of each sample of roots, stems, leaves, flowers, root nodules, pods and seeds, 50mg of each sample, extracting total RNA and carrying out reverse transcription on cDNA; and performing fluorescent quantitative PCR by using cDNA as a template and specific primers HO4a-qPCR-F/R and HO4b-qPCR-F/R of GmHO4 respectively. The soybean internal reference gene ACTIN was used as a control. Finally, the relative expression amount of GmHO4 in each sample is obtained by calculation, and the result is shown in a and b in figure 2.

Relative expression of GmHO4 in seed tissue: to assess whether gene editing of GmHO4 affected seed development, expression of GmHO4 in different seed structures was further explored: selecting embryo, endosperm and cotyledon of wild type Williams82 soybean. 3 times of each sample, 50mg of each sample, extracting total RNA and carrying out reverse transcription on cDNA; and carrying out fluorescent quantitative PCR by using cDNA as a template and specific primers HO4a-qPCR-F/R and HO4b-qPCR-F/R of GmHO 4. The soybean internal reference gene ACTIN was used as a control. Finally, the relative expression amount of GmHO4 in each sample is obtained by calculation, and the result is shown in c and d in FIG. 2.

FIG. 2 shows that GmHO4 is highly expressed in seeds and pods, slightly expressed in flowers, and extremely low expressed in tissues such as roots, stems, leaves, nodules, etc.; it is not expressed in the endosperm of seeds, and is mainly concentrated in embryos and cotyledons.

HO4a-qPCR-F：5’-GATCGGGAGAACCACCTTAC-3’

HO4a-qPCR-R：5’-ATACATGGCCTCAGTGAGG-3’

HO4b-qPCR-F：5’-GATCAGGAGAACCACCTTAT-3’

HO4b-qPCR-R：5’-GTACATGGCCTCCGTGAGA-3’

2. Gene editing statistics of soybean gmho4a/b #1 and gmho4a/b #2 growth traits and observation of seed structure

Wild type soybean variety Williams82 was used as a control material, and the gene-edited soybean gmho4a/b #1 and the gene-edited soybean gmho4a/b #2 selected in example 4 were planted in a greenhouse (16 hours/light, 8 hours/dark, 28 ℃) and a Hainin test field (5 months at 2021 to 8 months at 2021), respectively.

It was observed that gmho4a/b #1 and gmho4a/b #2 were slightly retarded in growth in early seedling stages compared to wild type, but no significant difference was observed in the late vegetative growth stage (FIG. 5).

After statistics of the size, single seed weight, yield and plant height of the seeds harvested in the field, the seed sizes of the gmho4a/b #1 and the gmho4a/b #2 are not significantly different from the wild type (a and b in the figure 6); and the individual yields of gmho4a/b #1, gmho4a/b #2 were not reduced (c and d in FIG. 6).

3. Observation of seed structures of Gene-edited Soybean gmho4a/b #1 and gmho4a/b #2

The soybean seed development period can be divided into a spherical period, a heart-shaped period and a cotyledon period. GmHO4 was highly expressed in the embryo and cotyledon of the seeds and not expressed in the endosperm (FIG. 2). To investigate whether gene editing GmHO4 had an effect on seed structure, seeds of wild type soybean variety williams82 and randomly selected gene editing soybean GmHO4a/b grown in field of step 2 were selected for dissection at 3 different periods and observed under the stereoscope. It was observed that the seed structures of gmho4a/b were consistent with the wild type, and the embryos developed normally (FIG. 7).

In conclusion, the gene editing GmHO4 does not have adverse effects on the growth and development of soybean.

4. Gene edited soybean gmho4a/b oil content analysis

Total oil content: williams82, gene edited soybean, gmho4a/b seeds harvested in step 2 were randomly selected and the total oil content was determined by gas chromatography (Agilent, CA, USA, DB-23) and the results showed that the total oil content of the gmho4a/b seeds was significantly increased compared to the wild type (FIG. 3).

Fatty acid: williams82 and soybean gmho4a/b seeds (about 20 grains) harvested in the field in the step 2 are randomly selected, numbered and bagged, dried in an oven at 70 ℃ (48 hours), and ground into powder after being dried. Accurately weighing 50mg into a glass test tube, adding 2ml of extracting solution (chloroform isopropanol: 2:1, v/v), extracting for 2 hours at normal temperature in a dark place, and performing vortex oscillation once every half an hour; centrifuging at 2500rpm for 5 min; adding 500 mu L of supernatant into a new test tube, adding 2ml of 1% sulfuric acid methanol solution (V/V) with volume concentration (100ml ═ 1ml of concentrated sulfuric acid +99ml of methanol), tightly covering the cap, and carrying out water bath at 80 ℃ for 1 hour; cooling to normal temperature, adding 2ml of NaCl aqueous solution with mass concentration of 0.9% and 1ml of n-hexane, violently vortex and shake, and centrifuging at 2500rpm for 2 min; sucking all the supernatant into a new test tube, adding 2ml of n-hexane for extracting raffinate 2 times (1 ml each time), combining the supernatant into the test tube, carrying out vortex centrifugation, and taking 1000 mu L of sample with 700-.

FIG. 4 shows that the content of each fatty acid (palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid) in gmho4a/b is significantly increased; analysis of the ratios of the fatty acid components revealed that the fatty acid content of gmho4a/b was unchanged from that of the wild type.

It is clear from this that GmHO4 has no specificity for the decomposition of fats and oils, and therefore, the gene editing GmHO4 only increases the amount of accumulated fats and oils without changing the composition (fig. 4).

Gas chromatography detection procedure: (1)120 ℃ for 5 min; (2) heating to 190 deg.C, protecting for 12min at a heating rate of 4 deg.C/min; (3) the temperature was raised to 210 ℃ and held for 10 minutes at a rate of 2.5 ℃/min with nitrogen as the carrier gas. Finally, detection was performed using a 280 ℃ gas chromatography-flame ionization detector (7890A, Agilent, USA).

Sequence listing

<110> Zhejiang university

<120> a method for increasing oil content of soybean seeds

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1766

<212> DNA

<213> Unknown (Unknown)

<400> 1

atggcttctt ctgtgtcatc catggtttct accaccctcc tcctaattac catctgcaca 60

ctgtcctcac ttctgtcagt tgcatctgca gcaacagagg agggacgaac aaggccattc 120

aaaagggtct atgcctttgg agactctttc acagacactg gcaacaccca aaatgcagaa 180

ggtccaagtg gctttggcca tgtttcaaac tctccctatg gaaccacttt ctttaaccac 240

tccaccaata ggtactcaga tggtaggctt gtgattgatt ttgtggctga agcactttca 300

ctgccttact tgccccccta ccgtcatagc aaaggcaatg acacttttgg tgttaacttt 360

gctgttgctg gttccacagc cataaaccat ttgttctttg tcaagcacaa cctctccctt 420

gacatcactc ctcagtccat ccaaacccag atgatatggt tcaacaggta cctggagagc 480

caggactgcc aagagtcaaa gtgcaatgat tttgatgaca ctctattttg gtttggggag 540

attggagtca atgactatgc ctacactctt ggatctaccg tctcagatga aaccataagg 600

aagcttgcaa tcagcagtgt ctcaggagct ttacaggtat gatttaggac aaaatttaca 660

aataattctt taggtgagtt aggttcttat tgtgttgttc tcccatcaaa attggagtct 720

cactttttta gttgtttttt gtattattca cctcgataat ttgtgttggc ctttaattca 780

aacttttatt aagtgaattg tcgaggtaga actctaattt caattgaaaa acaacactaa 840

aaacatctat agatcttcat ctaatttttg tggtttggtt tactgtccta attggtcttt 900

tataccaagt agttaaaact caaaaacttg aaattttgtg cacagatcat cttatcccaa 960

ttttataatt ttcattcctt tgttttgcag acattgcttg agaagggtgc caagtaccta 1020

gtagtgcagg gtttgcctct aactgggtgc ttgacattgt ccatgtacct ggctccacca 1080

gatgataggg atgacattgg atgtgtgaaa agtgtcaaca accaaagcta ctaccacaac 1140

cttgtgctgc aagacaaatt acaagaattc aggaaacagt accctcaagc tgtcatactt 1200

tatgctgatt actatgatgc ctaccgcact gtcatgaaga atccaagcaa attcggattc 1260

aaagagacct tcaacgtttg ctgtggatcg ggagaaccac cttacaactt cactgtgttt 1320

gccacatgtg gcacacctaa tgccactgtg tgctcaagcc cttctcagta catcaattgg 1380

gatggtgttc acctcactga ggccatgtat aaagttattt ctagtatgtt tttgcaagga 1440

aatttcaccc aacctccgtt taattttttg ttgggaaaaa aggagagggt ggggtgaatg 1500

gttcacccaa gaataatact aatatttggg atttgcttgt ccttatgact ttaatgcatc 1560

tgctaatgta actataagtg agggaatcag gttttacctg ttttgctaga acttgtgtcc 1620

tctgcacatc atgtatgatg agttcaaagg aatatgttgt atttgtattt gtattagtat 1680

ctgccaaggc tgtcttaaac tcggtatcag ttagtgctta tctagattag ttgattttgg 1740

gttaataaag tggttttcta tttata 1766

<210> 2

<211> 1848

<212> DNA

<213> Unknown (Unknown)

<400> 2

atggcttctt gtgtgtcatc catgtcttct accatcctca tcctaattgc catctgcaca 60

ctgtcctcac ttctgtcagc tgcatctgca gcaacagagg agggacgaac aaggcccttc 120

aaaagggtct atgcctttgg agactctttc acagacactg gcaacaccaa aaatgccgaa 180

ggtccaagtg gctttggtca tgtttcaaac tctccctacg gcaccacttt cttcaaccac 240

tccacaaaca ggtactcaga tggtaggctt gtgattgatt ttgtagctga agcactttca 300

ctgccttact tgccccccta ccgtcacagc aaaggcaatg acacttttgg tgttaacttt 360

gctgttgctg gctccacagc cataaaccat ttgttctttg tgaagcacaa cctctccctt 420

gatatcactg ctcagtccat ccaaacccag atgatatggt tcaacaggta cctagagagc 480

caggaatgtc aagaatcaaa gtgtaatgat tttgatgaca ctctgttttg gtttggggag 540

attggagtca atgactatgc ctacactctt ggatctactg tctcagatga gaccataagg 600

aagcttgcaa tcagcagtgt ctcaggagct ttacaggtat gatttaggac aaaatttaca 660

aataattttt taggtgctta ttgtgttgct ctcccatcaa aattgaagtc tcacttcttt 720

agttgtattt ggtgttattc tcttatcaga attgctgttt cacctcgata atttgtgttg 780

acctttaatt caaactttta ttaactgagt tatcgaggta gaaactctaa tttcaattga 840

aaaacaacac taaaagcatc tatagatctt catctaagtt ttgtggtatc gtttattgtc 900

ctaattgttc tttaatttat tctaagtagt taaaactcaa aaacttgaaa ttttgtgcac 960

agatcatcta atcctaattt tataatattc attctttgcg ttgcagacgt tgcttgagaa 1020

gggtgccaag tacctagttg tgcagggtat gcctctaact gggtgcttga cattgtccat 1080

gtacctggct cctccagatg atagggatga cattagatgt gttaaaagtg ttaacaacca 1140

aagctactac cacaatcttg tgctacaaga caaattacaa gaattcagga aacagtaccc 1200

tcaagctgtc atactttatg ctgattacta tgatgcctac cgcactgtca tgaagaatcc 1260

aagcaaatac ggattcaaag agaccttcaa cgtttgctgt ggatcaggag aaccacctta 1320

taacttcact gtgtttgcca catgtggcac acctaatgcc actgtgtgtt caagcccttc 1380

tcagtacatc aattgggatg gtgttcatct cacggaggcc atgtacaaag taatttctag 1440

tatgtttttg caaggaaatt tcacccaacc tccgtttaat tttttgttgg aaaaaaagga 1500

gagggtgggg tgaatggtta gtatttggga tttgcttgtc cctatgactt taatgcatca 1560

gctaatgtaa ctataagtga gggaatcagg tcttacctgt tttgctacaa cttgtgtcct 1620

ctgcacatca tatatgatga gaagttctaa ggaatatgtt gtatttgtat tagtatctgc 1680

caaggctgtc ttaaactcgg tattagctag tgcttacttt gtttagatta gttgattttg 1740

ggttaataaa gtgttttttc ttttcttttt acaaataaat ttaaagaaaa tgtaatttta 1800

taattttatt caataaaaaa ttatcaggat gaatttatta acttttac 1848

<210> 3

<211> 23

<212> DNA

<213> Unknown (Unknown)

<400> 3

ggagactctt tcacagacac tgg 23

Claims

1. The method is characterized in that gene editing is carried out on a target site 135bp-154bp behind the initiation codon of a soybean esterase gene GmHO4 so that the target site is not expressed, and therefore the oil content of the soybean seeds is improved.

2. The method of claim 1, wherein the target site PAM sequence is: GGAGACTCTTTCACAGACAC are provided.

3. The method of claim 1, wherein the gene editing comprises an insertion or deletion.

4. The method of claim 1, wherein the soybean esterase gene GmHO4 comprises GmHO4a and GmHO4b, and the corresponding nucleotide sequences are SEQ ID No.1 and SEQ ID No.2, respectively.

5. The method of claim 1, wherein the target site gene editing method is: (1) artificially synthesizing a target site gene fragment of a soybean esterase gene GmHO4, connecting the target site gene fragment to a vector Cas9MDC123, constructing a recombinant vector containing the target site gene fragment, and transforming agrobacterium to obtain agrobacterium containing the recombinant vector; (2) and (2) infecting a soybean explant by using the agrobacterium liquid containing the recombinant vector in the step (1), and screening a strain which does not contain Cas9 protein and is successfully edited and homozygous with GmHO4 gene to obtain the strain with the soybean seed oil content increased.