CN114703159A - Glucosyltransferase mutant and application thereof - Google Patents

Glucosyltransferase mutant and application thereof Download PDF

Info

Publication number
CN114703159A
CN114703159A CN202210252128.1A CN202210252128A CN114703159A CN 114703159 A CN114703159 A CN 114703159A CN 202210252128 A CN202210252128 A CN 202210252128A CN 114703159 A CN114703159 A CN 114703159A
Authority
CN
China
Prior art keywords
mutant
rebaudioside
glucosyltransferase
udp
artificial sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210252128.1A
Other languages
Chinese (zh)
Other versions
CN114703159B (en
Inventor
林影
陈美琪
梁书利
韩双艳
郑穗平
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Eryuan Hesheng Guangzhou Biochemical Products Co ltd
Original Assignee
South China University of Technology SCUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China University of Technology SCUT filed Critical South China University of Technology SCUT
Priority to CN202210252128.1A priority Critical patent/CN114703159B/en
Publication of CN114703159A publication Critical patent/CN114703159A/en
Application granted granted Critical
Publication of CN114703159B publication Critical patent/CN114703159B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/56—Preparation of O-glycosides, e.g. glucosides having an oxygen atom of the saccharide radical directly bound to a condensed ring system having three or more carbocyclic rings, e.g. daunomycin, adriamycin

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention discloses a glucosyltransferase mutant and application thereof, belonging to the technical field of protein engineering. The invention uses bioinformatics means to determine a plurality of protein surface amino acids in non-conservative regions by methods of protein modeling, structural analysis and the like, and performs single or combined mutation to obtain the mutant, wherein the mutant is at least one site of mutation A11L, F39Y, S58G, S55P, N109K, A250E, I279L, V304L and T329I in wild type UDP-glucosyltransferase of an amino acid sequence shown in SEQ ID NO. 1. Compared with wild UDP-glucosyltransferase, the obtained mutant has the advantages that the heat stability and the enzyme activity are both obviously improved, the mutant can be applied to the industrial production of sweetener stevioside (rebaudioside D and/or rebaudioside E), the production efficiency can be improved, the production cost is reduced, and the market prospect is wide.

Description

Glucosyltransferase mutant and application thereof
Technical Field
The invention belongs to the technical field of protein engineering, and discloses a UDP-glucosyltransferase mutant with improved activity and thermal stability and application thereof.
Background
In recent years, the demand for green biological methods instead of chemical methods has been based on an ever-expanding market for fine compounds. Some substances which are difficult to extract from natural plants usually face the problems of low yield, high energy consumption and the like in the traditional extraction process, and some natural macromolecular compounds cannot be synthesized by chemical synthesis methods. With the continuous progress of the biology fields of synthetic biology, metabolic engineering and the like, the sustainable production and synthesis of natural high-value compounds by a biological enzyme method becomes an industrial trend.
Glycosyltransferase (EC2.4.1.x) is a transferase ubiquitous in organisms and plays an important role in the synthesis of secondary metabolites in plants and microorganisms, catalyzing the transfer of glycosyl groups from glycosyl donors to acceptor molecules. UDP-glucosyltransferase has been widely studied in the biological production of flavonoids, alkaloids, terpenes and oligosaccharides, using UDP-glucose as a glycosyl donor. Glucosyltransferases are highly regioselective and stereoselective, and their substrate hybridization also confers their ability to synthesize a variety of substances.
The stevioside extracted from the stevia rebaudiana leaves is used as a natural sugar substitute with the sweetness about 200 times that of cane sugar, has near zero calorie and high stability, and is expected to become a sweetener substitute in daily diet. Stevioside has a certain after-bitterness due to steviol in the molecular structure, but the sweetness and the flavor of the stevioside are influenced by the quantity of glucosyl groups on branched chains and binding sites of the stevioside. At present, main components of stevioside products on the market are stevioside and rebaudioside A, rebaudioside D is used as a stevioside component with better sweetness and flavor, and because the stevioside component has very low content in a natural stevia extract and is not easy to extract, the stevioside component is not beneficial to large-scale production and application. In the natural synthetic pathway, glucosyltransferase can synthesize rebaudioside d (reb d) using UDP-glucose and rebaudioside a (reb a) as substrates.
In practical applications, the properties of the enzyme (such as stability and enzyme activity) affect the cost of industrial production, and are not favorable for popularization and application. Therefore, the modification of enzyme stability and catalytic activity is the key point of research in the field of biocatalytic synthesis production.
Disclosure of Invention
In order to overcome the defects and shortcomings of the prior art, the invention aims to provide a UDP-glucosyltransferase mutant. The mutant has obviously improved heat resistance and enzyme activity, and is favorable for wide application in the field of stevioside synthesis.
Another object of the present invention is to provide the use of the above glucosyltransferase mutant.
The invention utilizes RosettAFold2 to carry out AI modeling, carries out site-directed mutagenesis on UDP-glucosyltransferase from ginseng based on the model, and carries out combined mutagenesis based on the result. Provides a UDP-glucosyltransferase mutant with better heat stability and enzyme activity, can be applied to synthesis of rebaudioside D and/or rebaudioside E, and has important industrial value and significance.
The purpose of the invention is realized by the following technical scheme:
the primary object of the present invention is to provide a mutant UDP-glucosyltransferase enzyme that has mutated at least one amino acid position in a wild-type UDP-glucosyltransferase enzyme having an amino acid sequence represented by SEQ ID No.1, comprising: one or a combination of more of A11L, F39Y, S58G, S55P, N109K, A250E, I279L, V304L and T329I.
In some embodiments of the invention, the mutation is a11L, or F39Y, or S58G, or S55P, or N109K, or a250E, or I279L, or V304L, or T329I.
In some preferred embodiments of the invention, the mutation is S55/V304, or S58/V304/T329, or V304/T329/F39/S55/N109/A11/I279/A250, or V304/T329/F39/S55/N109/A11/A250.
It is a second object of the present invention to provide a gene encoding the UDP-glucosyltransferase mutant as described above, which can encode UDP-glucosyltransferase having higher activity and thermostability than the wild type.
Preferably, the gene encoding the wild-type UDP-glucosyltransferase having the amino acid sequence shown in SEQ ID NO.1 has the nucleotide sequence shown in SEQ ID NO. 2.
It is a third object of the present invention to provide a recombinant expression vector containing the UDP-glucosyltransferase mutant gene.
The fourth object of the present invention is to provide a genetically engineered bacterium containing the UDP-glucosyltransferase mutant gene or the recombinant expression vector.
In one embodiment, the genetically engineered bacterium is a host escherichia coli, and further escherichia coli BL21(DE3) is a host.
The invention also provides application of the UDP-glucosyltransferase mutant or the genetically engineered bacterium in synthesizing rebaudioside D and/or rebaudioside E.
Preferably, rebaudioside D and/or rebaudioside E are synthesized with stevioside and/or rebaudioside a as substrates.
Specifically, rebaudioside E is synthesized by taking stevioside as a substrate; rebaudioside D was synthesized using rebaudioside A as a substrate.
Compared with the prior art, the invention has the following advantages and effects:
the invention uses bioinformatics means, determines a plurality of protein surface amino acids in non-conservative regions by methods of protein modeling, structural analysis and the like, and performs single or combined mutation, so that the obtained mutant has obviously improved thermal stability and enzyme activity compared with wild UDP-glucosyltransferase, and can improve production efficiency and reduce production cost when applied to industrial production of sweetener stevioside.
Specifically, single-point mutant enzymes A11, S58, V304, S55, F39, T329, A250, N109 and I279 and combined mutant enzymes S55/V304, S58/V304/T329, V304/T329/F39/S55/N109, V304/T329/F39/S55/N109/A11, V304/T329/F39/S55/N109/A11/I279/A250 and V304/T329/F39/S55/N109/A11/A250 are obtained. The single-point mutant enzyme activity is 110.3-143.2% of that of the wild type, and the combined mutant enzyme activity is 154.3-319.4% (even 251.0-319.4%) of that of the wild type. After the combined mutant is treated at 40 ℃ for 30min, the residual enzyme activity is 24.6-82.7% (even 66.8-82.7%), and compared with 11.6% of the wild type, the combined mutant has great improvement, can be better applied to the industrial production of rebaudioside D and/or rebaudioside E, and has wide market prospect.
Drawings
FIG. 1 is a chemical diagram of catalytic synthesis of rebaudioside D using rebaudioside A as a substrate.
FIG. 2 is the three-dimensional structure of the protein established based on RosettAFold 2.
FIG. 3 is a graph of the Laplace analysis of the protein model reliability.
FIG. 4 is a comparison of the relative enzyme activities of the mutant Mut19 and the wild type after incubation for 30min at different temperatures; wherein (a) is Wild Type (WT); (b) mutant Mut 19.
FIG. 5 shows the comparison of the enzyme activities of mutant Mut19 and Wild Type (WT) incubated at 35 ℃ and 40 ℃ for different periods of time; wherein (a) is 35 ℃; (b) the temperature was 40 ℃.
FIG. 6 is a graph of rebaudioside D production for mutant Mut19 and Wild Type (WT) reacted for 20h at 35 ℃ and 40 ℃.
Detailed Description
The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and other embodiments obtained by those skilled in the art without inventive efforts are within the protection scope of the present invention based on the embodiments of the present invention.
A, L, S, G, V, P, F, Y, T, I, E, N, K in the present invention are abbreviations for alanine Ala, leucine Leu, serine Ser, glycine Gly, valine Val, proline Pro, phenylalanine Phe, tyrosine Tyr, threonine Thr, isoleucine Ile, glutamic acid Glu, asparagine Asn, and lysine Lys, respectively.
Example 1 protein Structure prediction analysis of UDP-glucosyltransferase
The wild-type amino acid sequence (shown as SEQ ID NO. 1) was subjected to protein structure modeling using the RosettAFold2 online prediction software (FIG. 2), and the model was subjected to reliability analysis using the online analysis tool Procheck, and the Lambda constellation is shown in FIG. 3. The red region is the high confidence region where 90.1% of the amino acids in the model fall; the dark yellow region is the high tolerance region, 7.8% of the amino acids fall in this region; 1% of the amino acids fell in the pale yellow low-permissive region. Only four amino acids (1%) are white forbidden regions. A high proportion of amino acids in the red and dark yellow regions indicates that the model is of higher quality and can be used for subsequent analytical studies.
Example 2 site-directed mutant library construction of predicted sites
Site-directed mutagenesis prediction analysis for improving thermostability was performed on the three-dimensional structure obtained in example 1 using FireProt online prediction website, and the mutation sites (Table 1) were determined to be A11L, S58G, V304L, S55P, F39Y, T329I, A250E, N109K, and I279L based on the change in binding energy. The UDP-glucosyltransferase gene (shown as SEQ ID NO. 2) encoding the gene derived from ginseng was ligated to pET30a (+) vector by EcoRI and NotI to obtain recombinant expression vector pET30 a-PU. Primers were designed for site-directed mutagenesis on pET30a-PU (Table 2).
TABLE 1 prediction of mutational site binding energy changes
Figure BDA0003547123130000041
Figure BDA0003547123130000051
TABLE 2 primer sequences
Primer name Primer sequence (5 '-3')
A11L-F AATCAGTATACTGTTGCTACCATTTTTAGC
A11L-R CAGTATACTGATTCTACCAT
S58G-F GGATTCCTCTGCTGGTATAAAACTAGTTGAG
S58G-R ACCAGCAGAGGAATCCTTAT
V304L-F ACCAGAGGGGTTTCTGCAAAGGGTAGGAGAC
V304L-R CAGAAACCCCTCTGGTAAAA
S55P-F AGGATAAGGATCCGTCTGCTTCTATAAAAC
S55P-R CGGATCCTTATCCTTGATGG
F39Y-F TGCAATGTTTATCTCTGTTCTACCCCAATC
F39Y-R ATAAACATTGCAATTTCT
T329I-F CATTCAAGCATTGGTGGGTTTGTGAGCCAT
T329I-R AATGCTTGAATGTCCTAAAA
A250E-F GACAAAAGGGAAGAATCTACAGTGGTGTTT
A250E-R TTCCCTTTTGTCAAGCCAGT
N109K-F CTTAAAACCTTAAAACCCGATTTGCTTATTT
N109K-R TTTTAAGGTTTTAAGGATTTC
I279L-F TGGGCTAGAGCTGAGCACGGTTAATTTCAT
I279L-R CAGCTCTAGCCCAATTGCT
S58G/S55P-F TCCGTCTGCTGGTATAAAACTAGTTGAGCTT
S58G/S55P-R ACCAGCAGACGGATCCTTA
EXAMPLE 3 E.coli expression of site-directed mutase
The point mutation recombinant expression vector constructed in example 2 was transformed into an expression host, e.coli BL21(DE3), and plated on LB kanamycin plates. The positive transformants identified successfully were inoculated into 10mL LB medium (containing 50mg/L kanamycin antibiotic) and cultured overnight at 37 ℃. The next day, the seed solution was transferred to 100mL of LB medium (containing 50mg/L kanamycin antibiotic) at a rate of 2% v/v, and cultured at 37 ℃ to OD6000.6-0.8, adding inducer isopropyl-beta-D-thiogalactoside (IPTG, 5mM), and culturing at 16 deg.C for 26 h. The cultured cells were collected by centrifugation at 7000rpm at 4 ℃ and washed twice. The thalli is broken by ultrasonic, and the thalli is centrifuged for 30min at 10000rpm and 4 ℃ to obtain a crude enzyme solution. Purifying the crude enzyme solution by using a nickel ion affinity chromatography column to obtain pure enzyme, determining the protein concentration by using a Bradford method, determining a standard curve by using the concentration of standard bovine serum albumin, determining the protein concentration of the pure enzyme, and refrigerating at 4 ℃ for later use.
Example 4 detection and comparison of Single-Point mutant enzyme and wild type enzyme Activity
The enzyme activity determination reaction system (200 mu L) contains a substrate of 5mM rebaudioside A, 2mM UDP-glucose and 50mM phosphate buffer (pH 7.5), and the enzyme solution to be determined is 20 mu L. The reaction solution except the enzyme solution to be measured was dispensed into 2mL EP tubes and preheated at 35 ℃ for 5 min. Adding enzyme solution, reacting at 35 deg.C and 400rpm for 10 min. The reaction was stopped by adding 0.5M phosphoric acid and after 5min, 1M sodium hydroxide solution was added to adjust the pH. After centrifugation at 12000rpm for 1min, the supernatant was filtered through a 0.22 μm aqueous filter head into a liquid sample bottle for HPLC analysis. The chemical schematic diagram of the catalytic synthesis of rebaudioside D with rebaudioside a as a substrate is shown in fig. 1.
The detection conditions of the high performance liquid chromatography are as follows:
a chromatographic column: athena C18-WP (250 mm. times.4.6 mm, 5 μm); the mobile phase is as follows: 68% sodium dihydrogen phosphate solution (1.38g/L, pH2.6), 32% acetonitrile; flow rate: 1 mL/min; detecting the temperature: at 40 ℃.
The relative activities of the 9 mutant sites to the wild type are shown in Table 3. As can be seen from the data in Table 3, compared with wild-type glucosyltransferase, the mutant A11L, S58G, V304L, S55P, F39Y, T329I, A250E, N109K and I279L obtained by the invention have higher enzyme activity than that of the wild-type glucosyltransferase, and the single-point mutant has 1.10-1.43 times higher enzyme activity than that of the wild-type glucosyltransferase.
TABLE 3 comparison of wild-type glucosyltransferase Activity with Single mutants
Mutation site Relative ratio of enzyme activity (%)
Wild type 100
A11L 139.2
F39Y 110.3
S55P 126.7
S58G 143.2
N109K 132.8
A250E 123.2
I279L 120.9
V304L 122.0
T329I 125.5
Example 5 comparison of Single Point mutant enzymes with wild type thermostability
The enzyme solution obtained in example 3 and the wild-type purified enzyme solution were separately placed in a water bath at 40 ℃ for 30 min. The residual enzyme activity after heat treatment was determined according to the method of example 4. The heat resistance of 9 mutants is obtained through experiments, and as shown in Table 4, on the basis of improving the enzyme activity of the single-point mutant, the residual enzyme activities of A11L, F39Y, S55P, N109K, A250E, I279L, V304L and T329I after heat treatment are 17.1-21.4% and are higher than 11.3% of the wild type except that S58G is similar to the wild type in heat stability.
TABLE 4 comparison of Heat resistance of wild-type glucosyltransferase to mutant
Mutation site Incubation at 40 ℃ for 30min residual enzyme activity (%)
Wild type 11.3
A11L 17.1
F39Y 17.5
S55P 20.2
S58G 10.1
N109K 18.0
A250E 21.4
I279L 21.2
V304L 26.3
T329I 19.9
Example 6 site combining mutations
In order to further improve the catalytic activity and the thermal stability of the wild-type protein PU, A11L, S58G, V304L, S55P, F39Y, T329I, A250E, N109K and I279L are subjected to combined mutation. Pure enzyme was obtained according to the procedure of example 3 and enzyme activity was measured. And the thermostability of the combination mutations was tested according to the procedure of example 4. The combined mutants with obviously improved enzyme activity are obtained through experiments and are named as Mut1, Mut2, Mut5, Mut12, Mut17, Mut18, Mut19 and Mut21 respectively. As shown in tables 5 and 6, the enzyme activity of the combined mutant is improved by 1.54-3.19 times, even 2.51-3.19 times compared with that of the wild type; the residual enzyme activity of the combined mutant after heat treatment is 24.6-82.7%, even 66.8-82.7%, which is greatly improved compared with 11.6% of the wild type.
Wherein Mut1 contains mutation sites of: S55P, V304L;
mut2 contains mutation sites: S58G, V304L, T329I;
mut5 contains mutation sites: V304L, T329I, F39Y, S55P;
mut12 contains mutation sites: V304L, S55P, F39Y, T329I, N109K;
mut17 contains mutation sites: V304L, S55P, F39Y, T329I, N109K, a 11L;
mut18 contains mutation sites: V304L, S55P, F39Y, T329I, N109K, a11L, I279L;
mut19 contains mutation sites: V304L, T329I, F39Y, S55P, N109K, a11L, I279L, a 250E;
mut21 contains mutation sites: V304L, T329I, F39Y, S55P, N109K, a11L, a 250E;
TABLE 5 wild-type glucosyltransferase Activity vs. combination mutants
Mutation site Relative ratio of enzyme activity (%)
Wild type 100
Mut1 154.3
Mut2 165.2
Mut5 186.1
Mut12 236.0
Mut17 272.2
Mut18 302.8
Mut19 319.4
Mut21 251.0
TABLE 6 comparison of Heat resistance of wild-type glucosyltransferase to combinatorial mutants
Mutation site Incubation at 40 ℃ for 30min residual enzyme activity (%)
Wild type 11.6
Mut1 24.6
Mut2 27.9
Mut5 21.5
Mut12 35.5
Mut17 66.8
Mut18 73.0
Mut19 82.7
Mut21 75.6
Example 7 enzymatic Properties examination of mutant Mut19 and wild type
A reaction solution containing rebaudioside A at a final concentration of 0.1 to 1.8mM (gradient of 0.1, 0.2, 0.3, 0.4, 0.5, 0.8, 1, 1.2, 1.6, 1.8mM), UDP-glucose at a final concentration of 2mM, and a 50mM phosphate buffer solution (pH 7.5) was prepared. The reaction solution except the enzyme solution was dispensed into 2mL EP tubes and preheated at 35 ℃ for 5 min. 0.02mg/mL of pure enzyme was added, and the reaction was carried out at 35 ℃ and 400rpm for 10 min. The reaction was stopped by adding 0.5M phosphoric acid and after 5min, 1M sodium hydroxide solution was added to adjust the pH. After centrifugation at 12000rpm for 1min, the supernatant was filtered through a 0.22 μm aqueous filter head into a liquid sample bottle for HPLC analysis. K of combinatorial mutant Mut19 compared to wild type (Table 7)cat/KmThe value is improved by 1.14 times, which shows that the enzyme catalysis efficiency after mutation is improved, and is more beneficial to the industrial application.
TABLE 7 enzymatic Properties of wild type and Mut19
Enzyme kcat(min-1) Km(mM) kcat/Km(min-1·mM-1)
Wild type 22.1±1.9 0.12±0.0047 184.2
Mut19 82.8±4.7 0.21±0.0046 394.3
Example 8 comparison of the thermostability of the mutant Mut19 with the wild type at different temperatures
And placing Mut19 with the same protein concentration and wild enzyme liquid at 25-50 ℃ for incubation for 30 min. The enzyme activity was measured according to example 4 with the addition of preheated to 35 ℃. The results are shown in FIG. 4. Compared with wild type, after Mut19 is incubated for 30min at 35 ℃, the enzyme activity still remains more than 97%. Under the conditions of 45 ℃ and 50 ℃, the enzyme activity is almost completely lost after wild type incubation for 30min, but 83.3 percent of enzyme activity still remains in Mut19 under the same condition at 45 ℃, and 15.4 percent of enzyme activity remains at 50 ℃.
Example 9 comparison of enzyme Activity of mutant Mut19 with wild type at the same temperature and for different periods of time
Mut19 with the same protein concentration and the wild-type enzyme solution were incubated at 35 ℃ and 40 ℃ for different periods of time, respectively. Enzyme activity was measured according to example 4. The results are shown in FIG. 5. After incubation for 2h at 35 ℃, the enzyme activity of the wild type is reduced to 39% of that of the non-incubation enzyme activity, but the Mut19 enzyme activity is still kept above 93%. At 40 ℃, all enzyme activity is lost after wild type incubation for 1h, but Mut19 still retains more than 59% of enzyme activity after incubation for 2 h.
Example 10 use of mutant Mut19 in rebaudioside D Synthesis
A reaction solution containing 4mM rebaudioside A, 4mM UDP-glucose, and 50mM phosphate buffer (pH 7.5) at the final concentration was prepared. The reaction solution except the enzyme solution was dispensed into a 2mL EP tube and preheated at 35 ℃ or 40 ℃ for 5 min. Adding 0.01mg/mL pure enzyme, reacting at 35 deg.C or 40 deg.C and 400rpm for 20h, and taking 200 μ L reaction solution for detection. 0.5M phosphoric acid was added to stop the reaction, and after 5min, 1M sodium hydroxide solution was added to adjust the pH. After centrifugation at 12000rpm for 1min, the supernatant was filtered through a 0.22 μm aqueous filter head into a liquid sample bottle for HPLC analysis. The results are shown in FIG. 6. The wild type is reacted for 20 hours at the temperature of 40 ℃, and the yield of rebaudioside D is hardly increased after 5 hours of reaction, and the final yield is 2.04 mM. At 35 ℃ the product growth rate of the wild type after 10h of reaction tended to be flat with a final yield of 2.75 mM. Compared with the wild type, the yield of rebaudioside D of Mut19 is always higher than that of the wild type at 35 ℃ and 40 ℃, and the reaction of Mut19 at 40 ℃ is better than that at 35 ℃. After 20h reaction at 40 ℃ the yield of Mut19 was 3.81mM and the conversion was 95.3%.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> university of southern China's science
<120> glucosyltransferase mutant and application thereof
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 442
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> amino acid sequence of wild-type UDP-glucosyltransferase
<400> 1
Met Asp Asn Gln Asn Gly Arg Ile Ser Ile Ala Leu Leu Pro Phe Leu
1 5 10 15
Ala His Gly His Ile Ser Pro Phe Phe Glu Leu Ala Lys Gln Leu Ala
20 25 30
Lys Arg Asn Cys Asn Val Phe Leu Cys Ser Thr Pro Ile Asn Leu Ser
35 40 45
Ser Ile Lys Asp Lys Asp Ser Ser Ala Ser Ile Lys Leu Val Glu Leu
50 55 60
His Leu Pro Ser Ser Pro Asp Leu Pro Pro His Tyr His Thr Thr Asn
65 70 75 80
Gly Leu Pro Ser His Leu Met Leu Pro Leu Arg Asn Ala Phe Glu Thr
85 90 95
Ala Gly Pro Thr Phe Ser Glu Ile Leu Lys Thr Leu Asn Pro Asp Leu
100 105 110
Leu Ile Tyr Asp Phe Asn Pro Ser Trp Ala Pro Glu Ile Ala Ser Ser
115 120 125
His Asn Ile Pro Ala Val Tyr Phe Leu Thr Thr Ala Ala Ala Ser Ser
130 135 140
Ser Ile Gly Leu His Ala Phe Lys Asn Pro Gly Glu Lys Tyr Pro Phe
145 150 155 160
Pro Asp Phe Tyr Asp Asn Ser Asn Ile Thr Pro Glu Pro Pro Ser Ala
165 170 175
Asp Asn Met Lys Leu Leu His Asp Phe Ile Ala Cys Phe Glu Arg Ser
180 185 190
Cys Asp Ile Ile Leu Ile Lys Ser Phe Arg Glu Leu Glu Gly Lys Tyr
195 200 205
Ile Asp Leu Leu Ser Thr Leu Ser Asp Lys Thr Leu Val Pro Val Gly
210 215 220
Pro Leu Val Gln Asp Pro Met Gly His Asn Glu Asp Pro Lys Thr Glu
225 230 235 240
Gln Ile Ile Asn Trp Leu Asp Lys Arg Ala Glu Ser Thr Val Val Phe
245 250 255
Val Cys Phe Gly Ser Glu Tyr Phe Leu Ser Asn Glu Glu Leu Glu Glu
260 265 270
Val Ala Ile Gly Leu Glu Ile Ser Thr Val Asn Phe Ile Trp Ala Val
275 280 285
Arg Leu Ile Glu Gly Glu Lys Lys Gly Ile Leu Pro Glu Gly Phe Val
290 295 300
Gln Arg Val Gly Asp Arg Gly Leu Val Val Glu Gly Trp Ala Pro Gln
305 310 315 320
Ala Arg Ile Leu Gly His Ser Ser Thr Gly Gly Phe Val Ser His Cys
325 330 335
Gly Trp Ser Ser Ile Ala Glu Ser Met Lys Phe Gly Val Pro Val Ile
340 345 350
Ala Met Ala Arg His Leu Asp Gln Pro Leu Asn Gly Lys Leu Ala Ala
355 360 365
Glu Val Gly Val Gly Met Glu Val Val Arg Asp Glu Asn Gly Lys Tyr
370 375 380
Lys Arg Glu Gly Ile Ala Glu Val Ile Arg Lys Val Val Val Glu Lys
385 390 395 400
Ser Gly Glu Val Ile Arg Arg Lys Ala Arg Glu Leu Ser Glu Lys Met
405 410 415
Lys Glu Lys Gly Glu Gln Glu Ile Asp Arg Ala Leu Glu Glu Leu Val
420 425 430
Gln Ile Cys Lys Lys Lys Lys Asp Glu Gln
435 440
<210> 2
<211> 1329
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> Gene sequence encoding wild-type UDP-glucosyltransferase
<400> 2
atggataacc aaaatggtag aatcagtata gcgttgctac catttttagc ccatggtcac 60
atatctccct tctttgagct agccaaacaa ctcgcgaaaa gaaattgcaa tgttttcctc 120
tgttctaccc caatcaatct tagctccatc aaggataagg attcctctgc ttctataaaa 180
ctagttgagc ttcatcttcc atcttcccct gatcttcctc ctcactatca caccacaaat 240
ggcctccctt cccatctcat gctcccactc agaaacgcct ttgaaactgc aggccccacc 300
ttctctgaaa tccttaaaac cttaaacccc gatttgctta tttatgattt caatccctca 360
tgggcaccgg agatcgcttc gtctcacaat attccggcag tttatttcct aaccacggca 420
gcagccagct cttccattgg cctacatgct ttcaaaaacc caggtgaaaa atacccattt 480
ccagattttt atgataacag taatattacc cctgaaccac cttctgcaga taacatgaag 540
ctacttcatg attttatcgc ttgtttcgaa cgatcttgcg acattatttt gattaagagt 600
tttagagaac tagaagggaa atatattgat ttgctttcca ctttatctga taaaactttg 660
gttcctgttg gtccactcgt tcaagatcct atgggccata atgaagatcc aaaaacagag 720
cagattataa actggcttga caaaagggct gaatctacag tggtgtttgt ctgctttgga 780
agtgagtatt ttctctccaa tgaggaattg gaagaagtag caattgggct agagattagc 840
acggttaatt tcatatgggc tgtgagatta attgaaggag agaaaaaagg gattttacca 900
gaggggtttg ttcaaagggt aggagacaga ggattggttg tggaggggtg ggctccacag 960
gcaagaattt taggacattc aagcaccggt gggtttgtga gccattgtgg gtggagttct 1020
attgcggaga gtatgaagtt tggggttcca gtaattgcca tggccaggca tcttgatcag 1080
cctttgaatg gtaagctggc ggcggaggtt ggtgtgggca tggaggttgt gagagatgag 1140
aatgggaagt ataagagaga agggattgca gaggtaataa gaaaagtggt tgtggagaaa 1200
agtggggagg ttatcaggag gaaagcaagg gagttgagtg agaaaatgaa agagaaagga 1260
gagcaagaga ttgatagggc attggaggag ctagtacaaa tttgtaagaa gaagaaagat 1320
gaacaatag 1329
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> A11L-F
<400> 3
aatcagtata ctgttgctac catttttagc 30
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> A11L-R
<400> 4
cagtatactg attctaccat 20
<210> 5
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S58G-F
<400> 5
ggattcctct gctggtataa aactagttga g 31
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S58G-R
<400> 6
accagcagag gaatccttat 20
<210> 7
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> V304L-F
<400> 7
accagagggg tttctgcaaa gggtaggaga c 31
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> V304L-R
<400> 8
cagaaacccc tctggtaaaa 20
<210> 9
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S55P-F
<400> 9
aggataagga tccgtctgct tctataaaac 30
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S55P-R
<400> 10
cggatcctta tccttgatgg 20
<210> 11
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> F39Y-F
<400> 11
tgcaatgttt atctctgttc taccccaatc 30
<210> 12
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> F39Y-R
<400> 12
ataaacattg caatttct 18
<210> 13
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> T329I-F
<400> 13
cattcaagca ttggtgggtt tgtgagccat 30
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> T329I-R
<400> 14
aatgcttgaa tgtcctaaaa 20
<210> 15
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> A250E-F
<400> 15
gacaaaaggg aagaatctac agtggtgttt 30
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> A250E-R
<400> 16
ttcccttttg tcaagccagt 20
<210> 17
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> N109K-F
<400> 17
cttaaaacct taaaacccga tttgcttatt t 31
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> N109K-R
<400> 18
ttttaaggtt ttaaggattt c 21
<210> 19
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> I279L-F
<400> 19
tgggctagag ctgagcacgg ttaatttcat 30
<210> 20
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> I279L-R
<400> 20
cagctctagc ccaattgct 19
<210> 21
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S58G/S55P-F
<400> 21
tccgtctgct ggtataaaac tagttgagct t 31
<210> 22
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<223> S58G/S55P-R
<400> 22
accagcagac ggatcctta 19

Claims (10)

1. A UDP-glucosyltransferase mutant, comprising: the mutant mutates at least one amino acid site in wild UDP-glucosyltransferase of the amino acid sequence shown in SEQ ID NO.1, and comprises one or more of the following mutations: a11L, F39Y, S58G, S55P, N109K, a250E, I279L, V304L, T329I.
2. The UDP-glucosyltransferase mutant according to claim 1, wherein:
the mutation is A11, F39, S58, S55, N109, A250, I279, V304, T329, S55/V304, S58/V304/T329, V304/T329/F39/S55/N109/A11/I279/A250 or V304/T329/F39/S55/N109/A11/A250.
3. A gene encoding a UDP-glucosyltransferase mutant according to claim 1 or 2.
4. The gene according to claim 3, characterized in that:
the nucleotide sequence of the gene coding for the wild-type UDP-glucosyltransferase is shown in SEQ ID NO. 2.
5. A recombinant expression vector comprising the gene of claim 3 or 4.
6. A genetically engineered bacterium containing the gene according to any one of claims 3 to 4 or the recombinant expression vector according to claim 5.
7. The genetically engineered bacterium of claim 6, wherein:
the host bacterium of the genetic engineering bacterium is escherichia coli.
8. Use of the UDP-glucosyltransferase mutant according to any one of claims 1 to 2, the gene according to any one of claims 3 to 4, the recombinant expression vector according to claim 5 or the genetically engineered bacterium according to any one of claims 6 to 7 for synthesizing rebaudioside D and/or rebaudioside E.
9. Use according to claim 8, characterized in that:
rebaudioside D and/or rebaudioside E are synthesized by taking stevioside and/or rebaudioside A as substrates.
10. Use according to claim 9, characterized in that:
taking stevioside as a substrate to synthesize rebaudioside E; rebaudioside D was synthesized using rebaudioside A as a substrate.
CN202210252128.1A 2022-03-15 2022-03-15 Glycosyltransferase mutant and application thereof Active CN114703159B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210252128.1A CN114703159B (en) 2022-03-15 2022-03-15 Glycosyltransferase mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210252128.1A CN114703159B (en) 2022-03-15 2022-03-15 Glycosyltransferase mutant and application thereof

Publications (2)

Publication Number Publication Date
CN114703159A true CN114703159A (en) 2022-07-05
CN114703159B CN114703159B (en) 2023-05-26

Family

ID=82169239

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210252128.1A Active CN114703159B (en) 2022-03-15 2022-03-15 Glycosyltransferase mutant and application thereof

Country Status (1)

Country Link
CN (1) CN114703159B (en)

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5723327A (en) * 1994-06-25 1998-03-03 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Thermostable trehalose-releasing enzyme, and its preparation and uses
CN102559528A (en) * 2012-02-09 2012-07-11 南京工业大学 Genetic engineering bacterium for producing stevia glycosyltransferase UGT76G1 and application thereof
WO2015018176A1 (en) * 2013-08-06 2015-02-12 中国科学院大连化学物理研究所 Specific fluorescent probe of glucuronosyltransferase ugt1a1 and use thereof
CN106795523A (en) * 2014-08-19 2017-05-31 可口可乐公司 Prepare the method and purposes of Rebaudiodside A I
CN110225971A (en) * 2017-05-19 2019-09-10 中国科学院上海生命科学研究院 The UDP- glycosyl transferase and its application that one group of catalysis sugar chain extends
CN113186141A (en) * 2021-04-08 2021-07-30 华南理工大学 Method for efficiently synthesizing rebaudioside M by one-pot method
CN113302298A (en) * 2018-11-09 2021-08-24 银杏生物制品公司 Biosynthesis of mogrosides
CN113549664A (en) * 2014-09-19 2021-10-26 谱赛科有限责任公司 High purity steviol glycosides
CN113862319A (en) * 2021-09-16 2021-12-31 华南理工大学 Application of ginseng glycosyltransferase in synthesis of stevioside

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5723327A (en) * 1994-06-25 1998-03-03 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Thermostable trehalose-releasing enzyme, and its preparation and uses
CN102559528A (en) * 2012-02-09 2012-07-11 南京工业大学 Genetic engineering bacterium for producing stevia glycosyltransferase UGT76G1 and application thereof
WO2015018176A1 (en) * 2013-08-06 2015-02-12 中国科学院大连化学物理研究所 Specific fluorescent probe of glucuronosyltransferase ugt1a1 and use thereof
CN106795523A (en) * 2014-08-19 2017-05-31 可口可乐公司 Prepare the method and purposes of Rebaudiodside A I
CN113549664A (en) * 2014-09-19 2021-10-26 谱赛科有限责任公司 High purity steviol glycosides
CN110225971A (en) * 2017-05-19 2019-09-10 中国科学院上海生命科学研究院 The UDP- glycosyl transferase and its application that one group of catalysis sugar chain extends
CN113302298A (en) * 2018-11-09 2021-08-24 银杏生物制品公司 Biosynthesis of mogrosides
CN113186141A (en) * 2021-04-08 2021-07-30 华南理工大学 Method for efficiently synthesizing rebaudioside M by one-pot method
CN113862319A (en) * 2021-09-16 2021-12-31 华南理工大学 Application of ginseng glycosyltransferase in synthesis of stevioside

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MAOQI HOU ET AL.: "Ginsenosides in Panax genus and their biosynthesis", ACTA PHARM SIN B *
卢骏: "甘草和人参不定根代谢调控及糖基转移酶UGT71A29的功能研究", 中国博士学位论文全文数据库 医药卫生科技辑 2020年 *

Also Published As

Publication number Publication date
CN114703159B (en) 2023-05-26

Similar Documents

Publication Publication Date Title
CN110734899B (en) Sucrose phosphorylase mutant with improved enzyme activity and construction method and application thereof
Hansen et al. The first archaeal ATP-dependent glucokinase, from the hyperthermophilic crenarchaeon Aeropyrum pernix, represents a monomeric, extremely thermophilic ROK glucokinase with broad hexose specificity
CN115427580A (en) Modified microorganisms and methods for improving ectoine production
EP2100956B1 (en) Method of enzymatically synthesizing 3&#39;-phosphoadenosine-5&#39;-phophosulfate
CN113528480B (en) Alpha-1, 2-fucosyltransferase mutant and construction method and application thereof
CN110791494A (en) Aspartic enzyme mutant, recombinant expression vector and recombinant bacterium containing aspartic enzyme mutant and application
CN109402081A (en) A kind of amylosucrase mutant and the preparation method and application thereof
US8852891B2 (en) N-acetylglucosamine-2-epimerase and method for producing CMP-neuraminic acid using the same
CN114703159B (en) Glycosyltransferase mutant and application thereof
JPWO2004009830A1 (en) Process for producing CMP-N-acetylneuraminic acid
KR101708974B1 (en) Novel sucrose isomerase and process for preparing the same
CN114763518B (en) Construction and application of yeast engineering bacteria for producing heparin by fermentation
CN116790540A (en) Sucrose synthase mutant with improved catalytic property
CN114015667B (en) Sucrose phosphorylase mutant with improved thermal stability and application thereof
JP3833584B2 (en) Process for producing CMP-N-acetylneuraminic acid
CN111534498B (en) Cyclodextrin glucosyltransferase mutant with improved disproportionation specific activity and AA-2G yield
CN114107244A (en) Cyclodextrin glycosyltransferase mutant, coding gene and application thereof
CN110055234B (en) Chondroitin sulfate synthase and coding gene and application thereof
CN117327684A (en) Enzyme for preparing tagatose, composition and application thereof
JP4272377B2 (en) New uses of uridine diphosphate glucose 4-epimerase
EP3772539A1 (en) Sialyltransferases for the production of 6&#39;-sialyllactose
CN113528482B (en) High-activity heparin skeleton synthase PmHS2 mutant and application thereof
JP3830015B2 (en) Method for producing uridine 5&#39;-diphosphate galactose
CN114958790B (en) Heparin skeleton synthase, mutant and application thereof
CN116064453B (en) Alpha-1, 2-fucosyltransferase mutant and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right

Effective date of registration: 20230406

Address after: 510006 South China University of Technology B6-334, Guangzhou University City, Panyu District, Guangzhou City, Guangdong Province

Applicant after: Lin Ying

Applicant after: Guangzhou South China University of Technology Asset Management Co.,Ltd.

Address before: 511458 Guangdong, Guangzhou, Nansha District, 25 South Road, South China Road, Guangzhou, China

Applicant before: SOUTH CHINA University OF TECHNOLOGY

TA01 Transfer of patent application right
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20231102

Address after: Room 605, 6th Floor, Building 2, No. 92, Banhe Road, Science City, Huangpu District, Guangzhou City, Guangdong Province, 510700

Patentee after: Eryuan Hesheng (Guangzhou) Biochemical Products Co.,Ltd.

Address before: 510006 South China University of Technology B6-334, Guangzhou University City, Panyu District, Guangzhou City, Guangdong Province

Patentee before: Lin Ying

Patentee before: Guangzhou South China University of Technology Asset Management Co.,Ltd.

TR01 Transfer of patent right