CN114686518A

CN114686518A - Construction and application of transgenic mouse model for exosome tracing

Info

Publication number: CN114686518A
Application number: CN202011595791.9A
Authority: CN
Inventors: 张翔; 谢菲; 徐彬; 叶扬扬; 杨婷; 施倩; 张辰宇; 李菁
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2020-12-29
Filing date: 2020-12-29
Publication date: 2022-07-01

Abstract

The invention discloses a construction method and application of a transgenic mouse model for exosome tracing, and the specific implementation process mainly comprises the following steps: constructing plasmids for expressing stop-EGFP-tracrRNA and crRNA or sgRNA; constructing a donor cell and verifying an exosome; constructing, breeding and identifying a transgenic mouse; verifying five parts of the exosomal tracing transgenic mouse model, and finally successfully obtaining the exosomal tracing transgenic mouse model; the successful construction of the model lays a foundation for the research of the exosome as a gene drug carrier, and scientists can observe the distribution of the exosome in the body more easily and definitely under pathological or physiological conditions.

Description

Construction and application of transgenic mouse model for exosome tracing

Technical Field

The invention relates to the technical field of biology, in particular to a construction method and application of a transgenic mouse model for exosome tracing.

Background

The CRISPR-Cas system is a natural immune system of prokaryotes, and a small segment of virus genes can be stored in DNA of certain bacteria or archaea after the bacteria or archaea are invaded by viruses, so that a storage space called CRISPR is formed; when the virus invades, the bacteria can recognize the virus according to the stored fragment and cut the DNA of the virus to disable the virus; the mechanism of CRISPR-Cas9 is to drive the immune action, and its mechanism of action can be understood in three phases 1: immunity is generated by uptake of exogenous DNA sequences and integration into a new CRISPR spacer; 2. expressing: the transcription of the CRISPR sequence under the control of the leader generates pre-crRNA (a precursor of crRNA), and tracrRNA complementary to the pre-crRNA sequence (trans-activating crRNA); the pre-crRNA forms double-stranded RNA with the tracrRNA by base complementary pairing and assembles into a complex with the protein encoded by Cas 9; 3. interference: the crRNA-Cas ribonucleoprotein complex will scan the entire exogenous DNA sequence and recognize the protospacer sequence complementary to the crRNA; at this time, the complex will be positioned in the region of PAM/original spacing sequence, and the DNA double strand will be untied to form R-Loop; the crRNA will hybridize to the complementary strand, while the other strand remains free; subsequently, the precise blunt-end cleavage site of the Cas9 protein is located 3 nucleotides upstream of the PAM, forming a blunt-end product; the HNH domain of Cas9 protein is responsible for cleaving the one DNA strand that is complementary paired to the crRNA, while the RuvC domain is responsible for cleaving the other non-complementary DNA strand; eventually DNA Double Strand Breaks (DSBs) under Cas 9.

In general, cells repair fragmented DNA using highly efficient non-homologous end joining (NHEJ); however, in the repair process, usually, the base insertion or deletion mismatch phenomenon occurs, which causes frame shift mutation, (frame shift mutation: a series of downstream codon changes caused by the reading frame change of some site base deletion or insertion of DNA molecule, which changes the gene originally encoding a certain peptide chain into a sequence encoding another completely different peptide chain), and the target gene is made to lose function, thereby realizing the expression of the source DNA to be silenced.

At present, the CRISPR/Cas9 system is widely applied to animals, plants, microorganisms and human cells with the advantages of wide application range, simple operation, high efficiency and the like; the gene editing technology is widely applied to the fields of gene knockout mouse construction, genetic disease research, antiviral research, cancer research, functional gene screening, transcription regulation and control research, single molecular marker research, gene therapy research and the like.

The exosome isOrigin of originIn the intracellular multivesicular body, actively secreting lipid bilayer vesicles with the size of 30-150 nm by cells; the surface of the exosome carries corresponding antigen on a source cell membrane, and the exosome internally comprises a plurality of small molecules in a source mother cell, including protein, DNA, RNA and the like; exosomes are widely present in a variety of body fluids including urine, saliva, blood and effusion, milk, amniotic fluid, ascites and the like; carry out information exchange among cells and exert regulation function

Along with the continuous development of cell biology and medicine, the research of exosome is more and more intensive, and a plurality of documents report the important application of exosome as a natural endogenous drug carrier; compared with the traditional viral vector and non-viral vector, the exosome serving as the carrier for transmitting signal molecules has the advantages of low immunogenicity, high drug carrying efficiency, strong osmotic retention Effect (EPR), certain targeting property, capability of better permeating into tumor or inflammation parts, complex and special protein and phospholipid bilayer structure different from the common synthesized liposome on the outer surface, contribution to protecting the loaded drug from being captured by a reticuloendothelial system, longer in-vivo circulation time, realization of passive targeting and the like; however, before using exosomes as carriers of gene drugs, we must study the distribution and degradation process of exosome drugs in vivo, so an animal model for in vivo tracing of exosomes is urgently needed.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a method for constructing a transgenic mouse model for exosome tracing; as is well known, the CRISPR/Cas9 system is composed of Cas9 protein/crRNA/tracr RNA, and in our earlier studies, we found that tracrRNA and crRNA are fused into single-stranded guide RNA (sgrna) to guide the target sequence of Cas9 to our target sequence; our previous experiments found that sgrnas or crrnas can be delivered to target cells encapsulated in exosomes; based on this finding, we designed the following exosome-tracing system: the system comprises an exosome donor and an exosome acceptor; in the donor, we stably expressed crRNA or sgRNA; in the receptor, we stably expressed tracrRNA, Cas9 protein and stop-EGFP element; the stop element can be specifically recognized and cleaved by sgRNA or crRNA expressed in the donor; due to the existence of a stop element, EGFP is subjected to frame shift mutation and cannot be translated into functional protein, at the moment, the receptor shows no green fluorescence, when an exosome containing sgRNA/crRNA is received, the sgRNA and the Cas9 protein are combined into a nucleoprotein complex, cleavage is carried out on two sides of the stop, EGFP is normally expressed, and the receptor emits green fluorescence; the crRNA can be combined with the tracrRNA to form sgRNA, and then combined with the Cas9 protein; on the basis, a transgenic mouse model with an exosome tracing function is constructed, a stop-EGFP-Cas9-tracrRNA element is stably expressed in a mouse, and a tool with the exosome tracing function is prepared;

the invention has the beneficial effects that: 1. the distribution condition of the exosomes in the body can be intuitively observed by utilizing the invention, and a good tool is provided for the research of the exosomes and the research of the exosome distribution in a disease state; 2. the invention can be used for testing the tissue distribution of the exosome as the drug carrier after being delivered into the animal body; 3. the safety of exosome drug carriers has been determined;

drawings

FIG. 1 schematic diagram of mouse model construction

FIG. 2 Donor element expression plasmid map

FIG. 3 receptor element expression plasmid map

FIG. 4Q-PCR expression of crRNA and sgRNA in exosomes

FIG. 5F 0 generation mouse PCR identification electrophoresis strip chart, wherein WT is wild type mouse genotype and Marker is 20bp DNA Marker

FIG. 6 shows the electrophoresis banding pattern of the F2 mouse PCR identification from the source number F0-17

FIG. 7 shows the electrophoresis banding pattern of the F2 mouse PCR identification from the source number F0-20

FIG. 8 shows the PCR identification electrophoresis band of F2 generation mice with the source number of F0-35

FIG. 9 two-photon microscopy of model validation of exosome-transgenic mice by tracing

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout; the embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention;

EXAMPLE 1 construction of a plasmid expressing stop-EGFP-Cas9-tracrRNA element (exosome receptor plasmid)

Constructing a plasmid for expressing a stop-EGFP-Cas9-tracrRNA element, wherein the plasmid comprises the stop-EGFP-Cas9-tracrRNA element and the like and is used for constructing an exosome receptor; wherein the plasmid vector contains a Cas9 protein sequence, and a stop-EGFP sequence and a tracrRNA sequence are inserted into the plasmid vector, and the specific operation method is as follows

Carrying out double digestion on the plasmid vector, running 1% agarose gel, and carrying out gel recovery on a larger gene fragment; synthesizing a stop-EGFP DNA sequence and a tracrRNA DNA sequence by a whole gene; double-enzyme digestion of a double-chain stop-EGFP sequence, column passing for recovering an enzyme digestion product, then connecting a vector subjected to double enzyme digestion with fragments, transforming the vector into DH5 alpha, carrying out bacterium selection and sequencing, and screening out a clone which is successfully constructed; cutting the clone obtained in the last step with a single enzyme, connecting the tracrRNA DNA sequence into a vector through homologous recombination, transforming the vector into DH5 alpha again, selecting bacteria, sequencing, and screening out the clone which is successfully constructed.

Example 2 construction of a plasmid expressing crRNA or sgRNA (exosome donor plasmid)

Constructing a plasmid for expressing crRNA or sgRNA, wherein the plasmid contains crRNA-1/crRNA-2 or sgRNA-1/sgRNA-2; for constructing an exosome donor; the method comprises the following specific operations of inserting a crRNA/sgRNA sequence behind a U6 promoter of a plasmid vector:

carrying out double enzyme digestion on a plasmid vector, running 1% agarose gel, carrying out gel recovery on a larger gene fragment, designing crRNA-1 and crRNA-2 sequences of a target stop sequence, annealing the sequences in vitro to form an oligo double strand, carrying out enzyme linkage on the crRNA-1 and crRNA-2 gene fragments and the double enzyme digestion plasmid vector, and screening out a clone which is successfully constructed after transformation and sequencing.

Example 3 construction of Donor cells and validation of exosomes

Constructing donor cells into two parts, preparing lentivirus expressing donor elements by using tool cells HEK 293T cells in the first part, obtaining virus suspension, infecting the obtained virus suspension into human non-small cell lung cancer A549 cells in the second part, picking a stable monoclonal cell strain after drug screening, expanding culture, collecting exosomes and detecting; the specific operation is as follows

1. Uniformly mixing Opti-MEM, Lipo2000/PEI, target plasmid and auxiliary plasmid according to a certain proportion, standing for 20 minutes, slowly dripping into a HEK 293T cell culture dish with the growth density of 70% -80%, and replacing with a fresh complete culture medium of 10% FBS after 6 hours; after 48h the cell culture medium (containing lentivirus) was collected in a biosafety cabinet and filtered through a 0.45 μm filter to obtain virus supernatant for infecting the cells of interest.

2. Infecting A549 cells by using the lentivirus suspension obtained in the first step, and adding antibiotics with proper concentration for drug screening after infecting for 36-48 h; after the drug screening is maintained for two weeks, selecting monoclonal cells, performing amplification culture, collecting supernatant, obtaining exosomes by adopting a density gradient centrifugation method, dissolving the exosomes by using a PBS (phosphate buffer solution), extracting RNA (ribonucleic acid) in the exosomes by using a Trizol Reagent solution, reversely converting the extracted RNA into cDNA (complementary deoxyribonucleic acid) by using a stem-loop method, and detecting the content of crRNA/sgRNA in the exosomes by using a fluorescent quantitative PCR (polymerase chain reaction) method; the results indicate that crRNA/sgRNA was also contained in the exosomes.

Example 4 transgenic mice construction, breeding and identification

The receptor plasmid successfully constructed in example 1 was handed over to seiko (suzhou) biotechnology limited to construct transgenic mice by fertilized egg microinjection; when the F0 generation mouse grows to 8 weeks, the mouse tail is taken to extract genome, the target sequence is amplified by designing primers according to the sequences of various elements in the plasmid of G2 constructed by people, the amplified PCR product is subjected to 2% agarose gel electrophoresis, and the mice numbered 17, 20 and 35 in the F0 generation are positive heterozygote transgenic mice according to the electrophoresis result.

Breeding transgenic mice specifically comprises the steps of mating F0 mouse with wild mouse after sexual maturity is achieved (8 weeks) to obtain F1 mouse; the positive F1 generation mice from the same F0 are mated with one another to obtain F2 generation mice, the obtained F2 generation mice are subjected to PCR and agarose gel identification, the F2 generation mice with the genotype identified as homozygote are the tracer model mice which are required to be constructed and express the stop-EGFP-Cas9-tracrRNA systemically, and the primers identified by PCR of the F0, F1 and F2 generation mice are all the same; the results show that the mice numbered 1, 2 and 3 in the F2 generation of the original F0-17 mouse are positive mice, and the mice numbered 2, 6, 7, 8 and 10 in the F2 generation of the original F0-20 mouse are positive mice; the mice numbered 1, 2, 4, 5 in the F2 generation of the derived F0-35 mice were positive mice.

Example 5 validation of Trace exosome transgenic mouse model

Carrying out extensive culture on a large number of donor cells successfully verified in the third embodiment, extracting exosomes, injecting exosomes into tail veins of five transgenic mice in the third embodiment, taking partial organs of livers of the mice, and observing the organs by using a two-photon laser confocal microscope; the observation result shows that the liver has green fluorescence, which shows that the animal model is successfully constructed.

The above embodiments are merely illustrative of the technical concepts and features of the present invention, and the purpose of the embodiments is to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the protection scope of the present invention; all the equivalent structures or equivalent processes performed by using the contents of the specification and the drawings of the present invention, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.

Claims

1. A construction method and application of a transgenic mouse model for exosome tracing are characterized in that: the constructed transgenic mouse systemically expresses a stop-EGFP-Cas9-tracrRNA element, a modified donor cell-derived exosome comprises crRNA or sgRNA, the gene reading frame of the EGFP has a frame shift mutation due to the existence of the stop element, the constructed transgenic mouse does not express green fluorescence at first, when the exosome carrying the crRNA or sgRNA is injected into the mouse by tail vein injection, a ribonucleoprotein complex (RNP) is formed by the three Cas9/tracrRNA/crRNA or the two Cas9/sgRNA in cells, both ends of the stop sequence are sheared, non-homologous end repair (NHEJ) occurs inside the cells, the EGFP gene reading frame is corrected, the EGFP protein is normally expressed, and the distribution of the exosome in vivo can be visually observed through the green fluorescent protein. The specific operation comprises the following steps

Construction of plasmid expressing stop-EGFP-Cas9-tracrRNA element

Construction of plasmids expressing crRNA or sgRNA elements

Construction of Donor cells and validation of exosomes

Construction, breeding and identification of transgenic mice

And (5) verifying a tracing exosome transgenic mouse model.

2. The method of claim 1, wherein the plasmid expressing the stop-EGFP-Cas9-tracrRNA element comprises a sequence of stop-EGFP, and the combined expression sequence comprises the following nucleotides:

3. the method of claim 1, wherein the plasmid expressing the stop-EGFP-Cas9-tracrRNA element comprises a tracrRNA sequence consisting of the following nucleotides:

tracrRNA：5’-AGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT-3’。

4. the method of claim 1, wherein the crRNA/sgRNA sequence in the plasmid expressing the crRNA or sgRNA element consists of

crRNA-1：5’-ACAGCAGAATATCACACAGCGTTTTAGAGCTATGCT-3’

crRNA-2：5’-AATCCATGCAAAACTGACTGGTTTTAGAGCTATGCT-3’

sgRNA-1：5’-ACAGCAGAATATCACACAGCGTTTTAGAGCTAGAAATAGCAAGTTAAAA TAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3’

sgRNA-2：5’-AATCCATGCAAAACTGACTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3’。

5. The method according to claim 1, characterized in that the donor-derived exosomes comprise crRNA/sgRNA sequences targeted to both ends of the stop sequence.

6. The method of claim 1, wherein the donor cells for providing exosomes are cells of the immune system, such as dendritic cells, macrophages, B cells, T cells, and the like, or various cancer cells such as mesenchymal stem cells, endothelial cells, and epithelial cells, or HEK-293 cells, a549 cells, and the like.

7. The method of claim 1, wherein the receptor for systemic expression of stop-EGFP-Cas9-tracrRNA element comprises mouse, rat, nude mouse, zebrafish, etc.

8. The method according to claim 1, characterized in that the donor-derived exosomes comprise proteins, nucleic acids, lipids etc. in addition to crRNA or sgRNA.

9. Vectors encoding the sequences of claims 2-4, including plasmid vectors and viral vectors; wherein the viral vector comprises at least one of a retroviral, lentiviral, adenoviral, and adeno-associated viral vector.