CN114685676B - Recombinant protein, expression method, purification method and application thereof - Google Patents

Abstract

The invention relates to a recombinant protein, an expression method, a purification method and application thereof. The recombinant protein is the F protein of RSV, namely RSV-F, the nucleotide sequence of the RSV-F is the sequence table SEQ ID No.1, and the amino acid sequence of the RSV-F protein is the sequence table SEQ ID No.2. The expression method of the recombinant protein comprises the following steps: 1) Amplification of RSV-F coding fragments; 2) Constructing subclone plasmids containing F protein according to the amplified RSV-F coding fragment; 3) Constructing eukaryotic expression plasmids of RSV-F according to the subclone plasmids; 4) Eukaryotic expression plasmids transfected with the RSV-F were cultured in HEK293E cells in medium. Purifying the recombinant protein by an anion exchange column, a cation exchange column and a gel filtration chromatographic column. The purified RSV-F recombinant protein has immunogenicity and can be used for the development of RSV subunit vaccine or the immunodiagnosis of RSV infection.

Description

Recombinant protein, expression method, purification method and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a recombinant protein, an expression method, a purification method and application thereof.

Background

Respiratory syncytial virus (respiratory syncytial virus, RSV) is the most prominent causative agent of acute lower respiratory illness in infants and young children. Children under 3400 and ten thousand years old, about 340 ten thousand hospitalizations, 16-20 ten thousand deaths, suffer RSV infection worldwide each year, and 99% of the deaths of RSV infection occur in low-and medium-income developing countries. Infants within 24 months are infected almost once with RSV, and all children under 3 years of age are infected with RSV and repeatedly infected multiple times throughout life. Worldwide, RSV causes mortality in infants under 1 year of age up to 6.7%, the second cause of mortality outside malaria. In addition, the elderly and immunocompromised patients are also susceptible to RSV infection, with the disease burden associated with RSV being comparable to that associated with influenza in non-epidemic seasons. Ribavirin is an antiviral drug used for the treatment of RSV disease, but its efficacy is uncertain, costly and difficult to administer, limited to severely symptomatic patients. Palivizumab is a monoclonal antibody for passively preventing RSV disease, which can effectively reduce the hospitalization rate caused by RSV, but is expensive and needs to be injected monthly, and is only currently applied to infants with high risk of RSV disease in developed countries. Severe RSV disease burden there is an urgent need to develop RSV vaccines, for which RSV vaccines are listed by the world health organization as one of the most developed vaccines worldwide.

The F protein is glycoprotein on the surface of respiratory syncytial virus, and belongs to type I glycoprotein. In the intracellular synthesis of inactive precursor F0, F0 is cleaved by furin during maturation to form F2 (aa 1-109), P27 (aa 110-136) and F1 (aa 137-574), F2 forms a heterodimer with F1 as disulfide, i.e., monomers of F protein, and the three monomers assemble to form a trimer. Functional F proteins on the respiratory syncytial virus envelope exist in an unstable pre-fusion conformation that folds to form a stable post-fusion conformation under the initiation of factors not yet identified. The F protein mediates fusion of the viral and host cell membranes, which is necessary for viral entry into the cell. The sequences of the F proteins of the two subtypes of RSV are highly conserved, and the homology is as high as more than 90%; monoclonal antibodies to protein F have been shown to reduce the incidence of severe RSV disease in infants at high risk, and have been approved for the prevention of RSV disease in infants, so protein F is the primary target antigen for developing vaccines.

The F protein is envelope protein, and can be obtained by culturing and splitting the virus in vitro, but the yield is lower; and is prone to losing its activity during purification of the F protein. To develop F protein vaccines, new methods of F protein preparation and purification must be established.

Disclosure of Invention

The invention provides a recombinant protein, an expression method, a purification method and application thereof.

A recombinant protein which is prepared from the recombinant protein,

the recombinant protein is F protein of RSV, namely RSV-F;

the nucleotide sequence of the RSV-F is a sequence table SEQ ID No.1.

Further, the method comprises the steps of,

the amino acid sequence of the RSV-F protein is SEQ ID No.2 of the sequence table.

Further, the method comprises the steps of,

a method of expressing a recombinant protein, the method comprising:

(1) Amplification of RSV-F coding fragments;

(2) Constructing subclone plasmids containing F protein according to the amplified RSV-F coding fragment;

(3) Constructing eukaryotic expression plasmids of RSV-F according to the subclone plasmids;

(4) Eukaryotic expression plasmids transfected with the RSV-F were cultured in HEK293E cells in medium.

Further, the method comprises the steps of,

the amplification of the RSV-F coding fragment takes an optimized RSV-F nucleotide sequence as a template, and the RSV-F fragment is amplified by PCR.

Further, the method comprises the steps of,

the RSV-F nucleotide sequence is nt94-nt1563 of the sequence table SEQ ID No.1.

Further, the method comprises the steps of,

the construction of the subclone plasmid containing the F protein is to connect the F protein with a pGEM-Teasy vector, thereby constructing a subclone plasmid pTe-F containing the F protein.

Further, the method comprises the steps of,

the eukaryotic expression plasmid of the RSV-F is constructed by respectively carrying out enzyme digestion and purification on the pTe-F and the expression vector pSEC and then connecting the pTe-F and the expression vector pSEC.

Further, the method comprises the steps of,

the eukaryotic expression plasmid of the RSV-F is transfected into HEK293E cells by a Lipofectamine2000 or PEI method;

the culture medium is a serum-free culture medium.

A method of purifying a recombinant protein, the method comprising:

(1) Amplification of RSV-F coding fragments;

(2) Constructing subclone plasmids containing F protein according to the amplified RSV-F coding fragment;

(3) Constructing eukaryotic expression plasmids of RSV-F according to the subclone plasmids;

(4) Transfecting eukaryotic expression plasmids of the RSV-F in HEK293E cells and culturing in a culture medium;

(5) Collecting supernatant RSV-F of the culture solution;

(6) Purifying the collected supernatant RSV-F by Capto Q anion exchange column;

(7) Purifying the RSV-F purified in the step (6) by a Sepharose sp hp cation exchange column;

(8) And (3) purifying the RSV-F purified in the step (7) by a Surperdex 200 gel filtration chromatographic column.

Further, the method comprises the steps of,

the anion exchange column is used for purifying, a liquid A equilibrium chromatographic column and a chromatographic system are used for loading concentrated supernatant containing target protein diluted by liquid A, and flow-through liquid is collected;

the A liquid is NaH ₂ PO ₄ ，Na ₂ HPO ₄ ，pH 7.0。

Further, the method comprises the steps of,

the anion exchange column is purified by using a B liquid equilibrium chromatographic column and a chromatographic system, and linear gradient elution is carried out by using a C liquid;

the solution B is a citric acid-sodium citrate buffer solution, and the pH value is 6.0; the solution C is NaCl.

Further, the method comprises the steps of,

the gel filtration chromatographic column is purified by using a D liquid balance chromatographic column and a chromatographic system, and then the D liquid is used for eluting to remove trace impurity proteins;

the solution D is Tris buffer solution, naCl, tween 20 and pH 7.4.

Further, the method comprises the steps of,

the purified RSV-F recombinant protein has immunogenicity and can be used for the development of RSV subunit vaccine or the immunodiagnosis of RSV infection.

The invention has the following advantages:

(1) The recombinant protein expressed RSV-F only comprises the extracellular region of the F protein, and does not comprise the transmembrane region and extracellular region of the F protein;

(2) The secretion signal peptide is adopted to replace the protein signal peptide, so that the expressed protein is soluble protein and is secreted into a culture medium, and the later protein purification is facilitated;

(3) A serum-free suspension culture system is adopted, so that the amplification of the culture scale and the protein purification are convenient;

(4) The expressed recombinant protein is purified in three steps to obtain high-purity RSV-F recombinant protein, has immunogenicity, and can be used for the research and development of RSV subunit vaccine or the immunodiagnosis of RSV infection;

(5) The RSV-F recombinant protein realizes secretion, solubility and high-level expression of the recombinant protein.

Additional features and advantages of the invention will be set forth in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objectives and other advantages of the invention may be realized and attained by the structure particularly pointed out in the written description and claims hereof as well as the appended drawings.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, a brief description will be given below of the drawings that are needed in the embodiments or the prior art descriptions, and it is obvious that the drawings in the following description are some embodiments of the present invention.

FIG. 1 shows electrophoresis results of gene amplification products of RSV-F recombinant proteins according to an embodiment of the present invention;

FIG. 2 shows the results of the subcloning of the recombinant protein plasmid for RSV-F (EcoRI) according to an embodiment of the present invention;

FIG. 3 shows the results of the restriction enzyme assay (Age I/Kpn I) of eukaryotic expression plasmids for RSV-F recombinant proteins according to an embodiment of the invention: 1, pSEC;2, pSEC-F;

FIG. 4 shows SDS-PAGE (left) and Westernblot (right) identification of RSV-F recombinant proteins according to an embodiment of the invention: 1, pSEC-F;2, pSEC;

FIG. 5 shows an anion exchange chromatography of RSV-F recombinant protein according to an embodiment of the invention;

FIG. 6 shows a RSV-F recombinant protein cation exchange chromatography diagram according to an embodiment of the invention;

FIG. 7 shows a gel filtration chromatogram of RSV-F recombinant protein according to an embodiment of the invention;

FIG. 8 shows SDS-PAGE (left) and Westernblot (right) results of purified RSV-F recombinant proteins according to an embodiment of the invention;

FIG. 9 shows the induced anti-serum titers following immunization of mice with RSV-F recombinant proteins according to an embodiment of the invention.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

1. Materials, reagents and instruments

The main materials are as follows:

and (3) cells: human embryonic kidney cells HEK293E

Main reagents, instruments:

EasApolymerase is available from Agilent corporation;

DNA markers, benchMark Prestained Protein Ladder and Bioluninescence Protein Ladder were purchased from Takara corporation;

EcoRI, age I, kpn I were purchased from NEB corporation;

QIAquick Gel Extraction kit, QIAprep Spin Miniprep Kit and Endo-free Plasmid Maxi Kit are purchased from QIAGEN;

amp, X-gal, IPTG were purchased from Beijing Ding national company;

polypepton is available from Japanese pharmaceutical Co;

yeast extract was purchased from OXOID corporation;

coli Top10 was purchased from Thermofiser, inc., saved by the applicant; na (Na) ₂ HPO ₄ .12H ₂ O、NaH ₂ PO ₄ .2H ₂ O, naCl, naOH, tween-20, etc. are available from national pharmaceutical group chemical company, inc.;

trizma@base, lumi-LightWestern BlottingSubstrate was purchased from Sigma corporation;

mouse monoclone [2F7] to RSV (ab 43812), goat Anti-Mouse IgG H & L (HRP) (ab 205719) are available from Abcam corporation;

FBS is purchased from excel corporation;

freeform F17 Expression Medium is available from Gibco corporation;

pen Strep, 0.05% Trypsin-EDTA, opti-MEM, DMEM from Gibco Lipofectamine2000 from Invitrogen;

PEI was purchased from Sigma company;

capto Q, sepharose sp hp, superdex 200 from GE company;

ultrafiltration concentrate columns were purchased from Millipore Ireland Ltd.

The materials, reagents and experimental equipment related to the embodiment of the invention are all commercial products conforming to the technical field of bioengineering unless otherwise specified.

EXAMPLE 1 expression method of RSV-F recombinant protein

1. Amplification of RSV-F-encoding fragments

The amplification of the RSV-F coding fragment takes the optimized RSV-F nucleotide sequence as a template, and the RSV-F fragment is amplified by PCR;

in particular, the method comprises the steps of,

the RSV-F nucleotide sequence is nt94 th to nt1563 th of a sequence table SEQ ID No. 1;

in particular, the method comprises the steps of,

taking an optimized sequence of a natural fusion protein gene coding sequence of a Long strain of wild RSV as a template, and designing the following primers according to the optimized sequence:

F-f GAAACCGGTCAGAATATCACCGAGGAGTTC(Age I)

F-r CTTGGTACCTCATTACAGCAGCTCATCGGACTTCC(KpnI)

amplifying the gene sequence of the extracellular region (AA 26-AA 512) of the RSV-F protein without signal peptide, namely the gene open reading frame nt94-nt1557;

in particular, the method comprises the steps of,

reaction conditions for PCR: pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 1.5min,30 cycles, and extension at 72 ℃ for 10min;

the PCR reaction system is as follows:

reagent(s)	Dosage (uL)
		Stencil (pTe-F, 20 ng/ul)	1
dNTP(10mM)	4
		EasyA polymerase	0.5
10xEasyA buffer	5
		Forward primer (10 uM)	2
Reverse primer (10 uM)	2
		Double distilled water	35.5
Total volume of	50

The result of electrophoresis of the amplified product is shown in FIG. 1, and FIG. 1 shows that the PCR amplified fragment has a length of 1488bp.

2. Construction of subclone plasmids containing F fragments

The construction of the subclone plasmid containing the F fragment is to connect the F fragment with a pGEM-Teasy vector so as to construct a subclone plasmid pTe-F containing the F fragment;

in particular, the method comprises the steps of,

the eukaryotic expression plasmid of the RSV-F is constructed by respectively carrying out enzyme digestion and purification on the pTe-F and an expression vector pSEC and then connecting;

after the PCR product is recovered and purified by gel, the PCR product is connected with pGEM-Teasy to construct a subclone vector pTe-F containing RSV gene fragments, and the EcoRI digestion result shows that the sum of the sizes of the two fragments is equivalent to the size of the insert fragment, as shown in figure 2. The sequence of the inserted fragment is 100% homologous with the target gene sequence.

3. Construction of eukaryotic expression plasmids for RSV-F

The eukaryotic expression plasmid of the RSV-F is constructed by respectively carrying out enzyme digestion and purification on the pTe-F and the expression vector pSEC, and the enzyme digestion identification result is shown in figure 3.

In particular, the method comprises the steps of,

the subclone plasmid of RSV-F and the empty vector pSEC of eukaryotic expression plasmid are digested by Age I/Kpn I, and after electrophoresis, the target fragment and vector arm are recovered and purified by gel, and then the eukaryotic expression plasmid of RSV-F (pSEC-F) is constructed by ligation and transformation. The sequence of the inserted fragment is 100% homologous with the target gene sequence. Eukaryotic expression plasmids were prepared in large quantities using Endo-free Plasmid Maxi Kit, see the Endo-free Plasmid Maxi Kit Specification (Endo-free Plasmid Maxi Kit from QIAGEN).

4. Transfecting eukaryotic expression plasmid of RSV-F in HEK293E cells, and culturing in a culture medium

The eukaryotic expression plasmid of the RSV-F is transfected into HEK293E cells by a Lipofectamine2000 or PEI method, namely, the transfection reagent adopted is Lipofectamine2000 or PEI;

in particular, the method comprises the steps of,

at a cell concentration of 1X 10 ⁶ Transfecting eukaryotic expression plasmids of RSV-F in HEK293E cells under transfection conditions of cells/mL, cell sap, transfection reagent Lipofectamine2000 or PEI and RSV-F at 1.5mL-2mL/1 μg;

in particular, the method comprises the steps of,

the culture medium is a serum-free culture medium;

in particular, the method comprises the steps of,

reach 2X 10 at cell density ⁶ At the time of cell/ml, the ratio was 0.5X10 ⁶ cells/ml were inoculated into F17 medium containing 2% glutamine and placed at 37℃in 5% CO ₂ Culturing the cells in a shaker at 225 rpm;

in particular, the method comprises the steps of,

collecting culture supernatant on day 5 after transfection;

in particular, the method comprises the steps of,

concentrating by a concentration column for 4 times, concentrating the supernatant of the culture solution, and further centrifuging at 500xg for 10min at 4 ℃ to collect the culture solution.

Experiments show that: the expression plasmid was transfected into HEK293E cells using Lipofectamine2000, see Lipofectamine2000 instructions, followed by optimization of transfected cell density and recombinant protein harvest time:

mu.g pSEC-Fecto and 40. Mu.l of upper transfection reagent were mixed, 30ml HEK293E cells of different densities were transfected, and recombinant proteins were harvested at different times after transfection, results tableMing Dang cell density of 1X 10 ⁶ At the time of cells/ml, the recombinant protein harvested on day 5 has higher protein expression amount.

Harvesting the recombinant protein of interest in the cell culture supernatant: collecting the cell culture solution in a centrifuge tube, centrifuging at 500xg for 10min at 4 ℃, and collecting the cell culture solution supernatant; adding into ultrafiltration concentration column for 4 times, and storing the concentrated solution in refrigerator at 4deg.C for purifying recombinant protein.

Further, the method comprises the steps of,

SDS-PAGE and Western blot analysis of the RSV-F recombinant protein, the identification results are shown in FIG. 4.

In particular, the method comprises the steps of,

taking 100 mu l of supernatant concentrate of the culture solution, respectively adding SDS-PAGE loading buffer solution, and boiling for SDS-PAGE and Western blot analysis;

in particular, the method comprises the steps of,

samples were spotted on two different gels, one of which was stained with SDS-PAGE followed by direct coomassie brilliant blue staining and destaining with destaining solution. The other block was subjected to Western blot analysis using 1: goat anti-RSV polyclonal antibody at 1000-fold dilution;

the secondary antibody is prepared by using HRP to mark goat anti-mouse IgG, adding the developing solution prepared by equal volumes of liquid A and liquid B, dropwise adding the developing solution onto a PVDF film for developing color, and placing the film in a gel imager for photographing.

Successful expression of the RSV-F recombinant protein was confirmed by SDS-PAGE and Western blot analysis, and the identification result is shown in FIG. 4.

EXAMPLE 2 purification method of RSV-F recombinant protein

The recombinant protein of RSV-F expressed in example 1 was purified by the following steps:

1. anion exchange purification: purification was performed using Capto Q anion exchange column, using 15 column volumes of binding buffer A (0.04M NaH) ₂ PO ₄ ，0.06M Na ₂ HPO ₄ pH 7.0) equilibrated column; then diluting the concentrated solution of the culture solution supernatant containing the target protein by using a buffer solution A, and adjusting the pH of the sample to be the same as the pH of the buffer solution; loading with loading pump, setting loading volume (500 ml), flow rate (3 ml/mi)n), pre-column pressure (0.3 MPa), column pressure difference (0.2 MPa) and the like, so that a sample flows through the column under a set condition, and flow-through liquid is collected for SDS-PAGE analysis. The chromatographic chart is shown in FIG. 5, and the electrophoretic chart is shown in FIG. 8.

2. Cation exchange purification: purifying with Sepharose sp hp cation exchange column, and balancing column with buffer B (citric acid-sodium citrate, pH 6.0) with flow rate of 10ml/min; concentrating the collected flow-through liquid, diluting with a buffer solution B, and regulating the pH of the sample; loading the sample by a loading pump, and setting parameters such as loading volume (200 ml), flow rate (2 ml/min), column front pressure (0.3 MPa), column pressure difference (0.2 MPa) and the like, so that the sample flows through the column under set conditions; after the sample loading is finished, carrying out linear gradient elution by using a buffer solution C (1M NaCl), wherein the ion concentration is 1% -100%, and eluting by using 10 times of column volume; the elution peaks were collected and subjected to SDS-PAGE and Western Blot analysis to obtain positive eluate fractions. The chromatographic chart is shown in FIG. 6, and the electrophoretic chart is shown in FIG. 8.

3. Gel filtration and purification: purifying with Superdex 200 (10/300) gel filtration chromatographic column, and balancing column with buffer D (Tris, naCl, tween 20, pH 7.4) to 1.5 times column volume at flow rate of 0.45ml/min; concentrating the components containing the target sample obtained by cation exchange, and taking 500ml for loading; eluting with buffer D (TBS pH 7.4) at a flow rate of 0.45ml/min for 1.5 times column volume, collecting each eluting peak, and performing SDS-PAGE and Western Blot analysis to obtain positive eluate. The chromatographic chart is shown in FIG. 7, and the electrophoretic chart is shown in FIG. 8.

EXAMPLE 3 analysis of purity of RSV-F recombinant protein

1. Protein content determination by BCA method

Standard protein BSA (2 mg/ml) was diluted with PBS to prepare standard series of 0, 25, 125, 250, 500, 750 and 1000. Mu.g/ml. 4ul of each series of standard substances and purified samples of recombinant proteins after proper dilution are taken and added into standard substance wells of a 96-well plate, 200ml of BCA working solution is added into each well, and the wells are placed at room temperature for 5min, and absorbance at 595nm is measured by an enzyme-labeled instrument. A standard curve (y= 1.2787 x-0.516) was drawn with the standard concentration and absorbance, where y is the protein concentration and x is the absorbance, and the sample concentration was calculated.

2. Protein purity analysis using a gray scale scanner

Purifying the expressed target protein, performing SDS-PAGE on the target protein obtained after three steps of purification, and analyzing the purity of the expressed protein by using a gray-scale scanner, wherein the purities of the three batches of expressed proteins are 92.2%, 96.7% and 98.7% respectively.

EXAMPLE 4 analysis of immunogenicity of RSV-F recombinant proteins

To confirm immunogenicity of the RSV-F recombinant protein, 36 BALB/C females of 6 weeks old were selected and divided into 6 groups of 6, 6 each, and the mice were vaccinated with TBS,1ug F (aluminum adjuvant), 5ug F (aluminum adjuvant), FI-RSV (1.78 mg) on days 0 and 28, respectively, and venous blood was collected in the tail of the mice on days 14, 28, 42 and 49, respectively, after vaccination. Antigen-specific IgG antibody titers in serum samples by ELISA according to standard procedures. Purified inactivated rsvp long was embedded in 96-well plates and incubated overnight at 4 ℃. Serum samples were diluted in blocking buffer at a gradient of 1:10 initial serum dilution, after which they were diluted in 2-fold series to different concentrations. There were also blank (serum dilution), negative control (1:100 diluted non-immune animal serum) and positive serum (1:6000 diluted murine anti-RSV serum), 100 μl of the above anti-serum dilution was added to the ELISA plate per well and incubated at 37℃for 1 hour. A horseradish peroxidase (HRP) -conjugated anti-mouse IgG (1:2000) secondary antibody was used. 3,3A, 5A-tetramethylbenzidine (TMB, BD Opt EIATM, BD Biosciences, ON) was used as a substrate for HRP. Mu.l of 1M H are added to each well ₂ SO ₄ The reaction was terminated. Absorbance at 450nm was measured using a microplate reader (Molecular Devices, USA) and the absorbance results are shown in figure 9. The results show that RSV-F has high immunogenicity, the immune response is dose dependent, and the aluminium adjuvant has the effect of enhancing the immune response.

Although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.

Sequence listing

<110> all Limited for Lanzhou biological research

<120> a recombinant protein, and expression method, purification method and use thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1563

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggggatcc ttcccagccc tgggatgcct gcgctgctct ccctcgtgag ccttctctcc 60

gtgctgctga tgggttgcgt agctgaaacc ggtcagaata tcaccgagga gttctaccag 120

tccacatgtt ctgccgtgag caagggctac ctgagcgccc tgaggacagg atggtatacc 180

tctgtgatca caatcgagct gagcaacatc aaggagaaca agtgcaatgg caccgacgcc 240

aaggtgaagc tgatcaacca ggagctggat aagtacaaga atgccgtgac agagctgcag 300

ctgctgatgc agtccaccac agccgccaac aatcgggccc ggagagagct gccacggttc 360

atgaactata ccctgaacaa taccaagaag acaaatgtga ccctgagcaa gaagaggaag 420

aggcgcttcc tgggctttct gctgggagtg ggatccgcca tcgcctctgg catcgccgtg 480

tccaaggtgc tgcacctgga gggcgaggtg aacaagatca agagcgccct gctgtccacc 540

aacaaggccg tggtgtctct gagcaatggc gtgtctgtgc tgacaagcaa ggtgctggac 600

ctgaagaatt atatcgataa gcagctgctg cccatcgtga acaagcagtc ctgtaggatc 660

tctaatatcg agaccgtgat cgagttccag cagaagaaca ataggctgct ggagatcaca 720

cgcgagtttt ctgtgaacgc cggcgtgacc acacctgtga gcacctacat gctgacaaat 780

agcgagctgc tgtccctgat caacgacatg ccaatcacca atgatcagaa gaagctgatg 840

tctaacaatg tgcagatcgt gcgccagcag tcctattcta tcatgagcat catcaaggag 900

gaggtgctgg cctacgtggt gcagctgcca ctgtatggcg tgatcgacac cccctgctgg 960

aagctgcaca catcccctct gtgcaccaca aacaccaagg agggctctaa tatctgcctg 1020

acccggacag acagaggctg gtactgtgat aacgccggca gcgtgtcctt ctttccccag 1080

gccgagacct gcaaggtgca gagcaaccgg gtgttctgtg acaccatgaa ttctctgaca 1140

ctgccaagcg aggtgaacct gtgcaatgtg gacatcttta atcccaagta tgattgtaag 1200

atcatgacat ctaagaccga cgtgagcagc agcgtgatca ccagcctggg cgccatcgtg 1260

tcctgctacg gcaagacaaa gtgtaccgcc tccaacaaga atagaggcat catcaagaca 1320

ttctccaacg gctgcgacta cgtgagcaac aagggcgtgg ataccgtgtc cgtgggcaac 1380

acactgtact atgtgaacaa gcaggagggc aagtctctgt acgtgaaggg cgagcccatc 1440

atcaacttct atgaccccct ggtgttccct agcgacgagt ttgatgcctc tatcagccag 1500

gtgaacgaga agatcaatca gagcctggcc tttatcagga agtccgatga gctgctgtaa 1560

tga 1563

<210> 1

<211> 519

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Gly Ile Leu Pro Ser Pro Gly Met Pro Ala Leu Leu Ser Leu Val

1 5 10 15

Ser Leu Leu Ser Val Leu Leu Met Gly Cys Val Ala Glu Thr Gly Gln

20 25 30

Asn Ile Thr Glu Glu Phe Tyr Gln Ser Thr Cys Ser Ala Val Ser Lys

35 40 45

Gly Tyr Leu Ser Ala Leu Arg Thr Gly Trp Tyr Thr Ser Val Ile Thr

50 55 60

Ile Glu Leu Ser Asn Ile Lys Glu Asn Lys Cys Asn Gly Thr Asp Ala

65 70 75 80

Lys Val Lys Leu Ile Asn Gln Glu Leu Asp Lys Tyr Lys Asn Ala Val

85 90 95

Thr Glu Leu Gln Leu Leu Met Gln Ser Thr Thr Ala Ala Asn Asn Arg

100 105 110

Ala Arg Arg Glu Leu Pro Arg Phe Met Asn Tyr Thr Leu Asn Asn Thr

115 120 125

Lys Lys Thr Asn Val Thr Leu Ser Lys Lys Arg Lys Arg Arg Phe Leu

130 135 140

Gly Phe Leu Leu Gly Val Gly Ser Ala Ile Ala Ser Gly Ile Ala Val

145 150 155 160

Ser Lys Val Leu His Leu Glu Gly Glu Val Asn Lys Ile Lys Ser Ala

165 170 175

Leu Leu Ser Thr Asn Lys Ala Val Val Ser Leu Ser Asn Gly Val Ser

180 185 190

Val Leu Thr Ser Lys Val Leu Asp Leu Lys Asn Tyr Ile Asp Lys Gln

195 200 205

Leu Leu Pro Ile Val Asn Lys Gln Ser Cys Arg Ile Ser Asn Ile Glu

210 215 220

Thr Val Ile Glu Phe Gln Gln Lys Asn Asn Arg Leu Leu Glu Ile Thr

225 230 235 240

Arg Glu Phe Ser Val Asn Ala Gly Val Thr Thr Pro Val Ser Thr Tyr

245 250 255

Met Leu Thr Asn Ser Glu Leu Leu Ser Leu Ile Asn Asp Met Pro Ile

260 265 270

Thr Asn Asp Gln Lys Lys Leu Met Ser Asn Asn Val Gln Ile Val Arg

275 280 285

Gln Gln Ser Tyr Ser Ile Met Ser Ile Ile Lys Glu Glu Val Leu Ala

290 295 300

Tyr Val Val Gln Leu Pro Leu Tyr Gly Val Ile Asp Thr Pro Cys Trp

305 310 315 320

Lys Leu His Thr Ser Pro Leu Cys Thr Thr Asn Thr Lys Glu Gly Ser

325 330 335

Asn Ile Cys Leu Thr Arg Thr Asp Arg Gly Trp Tyr Cys Asp Asn Ala

340 345 350

Gly Ser Val Ser Phe Phe Pro Gln Ala Glu Thr Cys Lys Val Gln Ser

355 360 365

Asn Arg Val Phe Cys Asp Thr Met Asn Ser Leu Thr Leu Pro Ser Glu

370 375 380

Val Asn Leu Cys Asn Val Asp Ile Phe Asn Pro Lys Tyr Asp Cys Lys

385 390 395 400

Ile Met Thr Ser Lys Thr Asp Val Ser Ser Ser Val Ile Thr Ser Leu

405 410 415

Gly Ala Ile Val Ser Cys Tyr Gly Lys Thr Lys Cys Thr Ala Ser Asn

420 425 430

Lys Asn Arg Gly Ile Ile Lys Thr Phe Ser Asn Gly Cys Asp Tyr Val

435 440 445

Ser Asn Lys Gly Val Asp Thr Val Ser Val Gly Asn Thr Leu Tyr Tyr

450 455 460

Val Asn Lys Gln Glu Gly Lys Ser Leu Tyr Val Lys Gly Glu Pro Ile

465 470 475 480

Ile Asn Phe Tyr Asp Pro Leu Val Phe Pro Ser Asp Glu Phe Asp Ala

485 490 495

Ser Ile Ser Gln Val Asn Glu Lys Ile Asn Gln Ser Leu Ala Phe Ile

500 505 510

Arg Lys Ser Asp Glu Leu Leu

515

Claims (9)

1. A method for purifying recombinant protein is characterized in that,

the recombinant protein is RSV-F protein; the amino acid sequence of the RSV-F protein is the amino acid sequence of the 32 th to 519 th positions in a sequence table SEQ ID No. 2;

the method comprises the following steps:

(1) Amplification of RSV-F coding fragments;

(2) Constructing subclone plasmids containing F protein according to the amplified RSV-F coding fragment;

(3) Constructing eukaryotic expression plasmids of RSV-F according to the subclone plasmids;

(4) Transfecting eukaryotic expression plasmids of the RSV-F in HEK293E cells and culturing in a culture medium;

(5) Collecting supernatant RSV-F of the culture solution;

(6) Purifying the collected supernatant RSV-F by Capto Q anion exchange column;

(7) Purifying the RSV-F purified in the step (6) by a Sepharose sp hp cation exchange column;

(8) And (3) purifying the RSV-F purified in the step (7) by a Surperdex 200 gel filtration chromatographic column.

2. The method for purifying a recombinant protein according to claim 1, wherein,

the amplification of the RSV-F coding fragment takes an optimized RSV-F nucleotide sequence as a template, and the RSV-F fragment is amplified by PCR.

3. The method for purifying a recombinant protein according to claim 1, wherein,

the RSV-F nucleotide sequence is nt94-nt1563 of the sequence table SEQ ID No.1.

4. The method for purifying a recombinant protein according to claim 1, wherein,

the construction of the subclone plasmid containing the F protein is to connect the F protein with a pGEM-Teasy vector, thereby constructing a subclone plasmid pTe-F containing the F protein.

5. The method for purifying a recombinant protein according to claim 1, wherein,

the eukaryotic expression plasmid of the RSV-F is constructed by respectively carrying out enzyme digestion and purification on the pTe-F and the expression vector pSEC and then connecting the pTe-F and the expression vector pSEC.

6. The method for purifying a recombinant protein according to claim 1, wherein,

the eukaryotic expression plasmid of the RSV-F is transfected into HEK293E cells by a Lipofectamine2000 or PEI method;

the culture medium is a serum-free culture medium.

7. The method for purifying a recombinant protein according to claim 1, wherein,

the anion exchange column is used for purifying, a liquid A equilibrium chromatographic column and a chromatographic system are used for loading concentrated supernatant containing target protein diluted by liquid A, and flow-through liquid is collected;

the A liquid is NaH ₂ PO ₄ ，Na ₂ HPO ₄ ，pH 7.0。

8. The method for purifying a recombinant protein according to claim 1, wherein,

the cation exchange column is purified by using a B liquid equilibrium chromatographic column and a chromatographic system, and linear gradient elution is carried out by using a C liquid;

the solution B is a citric acid-sodium citrate buffer solution, and the pH value is 6.0; the solution C is NaCl.

9. The method for purifying a recombinant protein according to claim 1, wherein,

the gel filtration chromatographic column is purified by using a D liquid balance chromatographic column and a chromatographic system, and then the D liquid is used for eluting to remove trace impurity proteins;

the solution D is Tris buffer solution, naCl, tween 20 and pH 7.4.