CN114685585A

CN114685585A - Nucleotide sequence, double-stranded oligonucleotide, pharmaceutical composition and conjugate, and preparation method and application thereof

Info

Publication number: CN114685585A
Application number: CN202111659092.0A
Authority: CN
Inventors: 梁子才; 杨志伟; 张鸿雁; 曹力强; 李海涛
Original assignee: Suzhou Ruibo Biotechnology Co ltd
Current assignee: Suzhou Ruibo Biotechnology Co ltd
Priority date: 2020-12-31
Filing date: 2021-12-30
Publication date: 2022-07-01
Anticipated expiration: 2041-12-30

Abstract

A nucleotide sequence, each nucleotide in the nucleotide sequence is a modified or unmodified nucleotide, wherein the nucleotide sequence comprises a nucleotide sequence I, the nucleotide sequence I is formed by replacing at least one of nucleotides 2 to 8 in the 5 'end-3' end direction in the nucleotide sequence A by an acyclic dealkali group, the nucleotide sequence A has 16 to 30 nucleotides, and the nucleotide sequence A is reversely complementary with at least 14 nucleotides in a nucleotide sequence in a target mRNA, and the acyclic dealkali group has a structure shown in a formula (101). The nucleotide sequence, the double-stranded oligonucleotide containing the nucleotide sequence as an antisense strand, the pharmaceutical composition and the siRNA conjugate containing the double-stranded oligonucleotide are effectiveReducing off-target effect and achieving the purpose of reducing toxicity.

Description

Nucleotide sequence, double-stranded oligonucleotide, pharmaceutical composition and conjugate, and preparation method and application thereof

Technical Field

The present disclosure relates to a nucleotide sequence, double-stranded oligonucleotides comprising the nucleotide sequence, pharmaceutical compositions and conjugates and methods of making and using the same.

Background

Nucleic acid drugs are increasingly showing excellent development and application potential as important novel drugs. Among them, double-stranded oligonucleotides are known as pharmaceutically active ingredients. In recent years, research in the field of double-stranded oligonucleotide pharmacy has been greatly advanced. In the patent drug research of double-stranded oligonucleotide, off-target effect is one of the important effects related to drug toxicity.

However, many nucleic acid drugs such as double-stranded oligonucleotides showing excellent pharmaceutical activity in preclinical pharmaceutical studies are difficult to be used for actual drug development due to toxicity resulting from their significant off-target effect. In this regard, those skilled in the art have been striving to develop nucleic acid drugs such as double-stranded oligonucleotides that are synthesized with both good pharmaceutical activity and low off-target effects. Therefore, how to maintain good pharmaceutical activity while reducing off-target effect of nucleic acid drugs is an important problem to be solved urgently in the field.

Disclosure of Invention

In order to develop a nucleotide sequence which has good pharmaceutical activity and simultaneously shows reduced off-target effect and a double-stranded oligonucleotide containing the same, the inventors of the present disclosure surprisingly found that, at a specific position in the nucleotide sequence, the off-target effect of the nucleotide sequence and a nucleic acid drug containing the same can be effectively reduced by replacing the original nucleotide with an acyclic abasic group, and at the same time, the pharmaceutical activity can be substantially maintained at a high level. To obtain a nucleic acid drug having well-balanced target mRNA inhibitory efficiency and safety. Thus, the inventors have made the following inventions:

in one aspect, the present disclosure provides a nucleotide sequence, each nucleotide in the nucleotide sequence being a modified or unmodified nucleotide, wherein the nucleotide sequence has 16-30 nucleotides; the nucleotide sequence is reversely complementary with a nucleotide sequence in a target mRNA with at least 14 nucleotides; at least one nucleotide between the nucleotides from position 2 to position 8 of the nucleotide sequence is replaced by an acyclic abasic group in the direction from the 5 'end to the 3' end.

In another aspect, the disclosure also provides a double-stranded oligonucleotide formed comprising an antisense strand formed from a nucleotide sequence of the disclosure and a sense strand at least partially reverse complementary thereto.

In yet another aspect, the present disclosure also provides a pharmaceutical composition comprising a double-stranded oligonucleotide of the present disclosure, the pharmaceutical composition comprising a double-stranded oligonucleotide of the present disclosure and a pharmaceutically acceptable carrier.

In yet another aspect, the present disclosure also provides a conjugate comprising a double-stranded oligonucleotide of the present disclosure, the conjugate comprising a double-stranded oligonucleotide of the present disclosure and a ligand conjugated to the double-stranded oligonucleotide.

In a further aspect, the present disclosure provides the use of a double-stranded oligonucleotide, a pharmaceutical composition or a conjugate of the present disclosure in the manufacture of a medicament for the treatment and/or prevention of a pathological condition or disease caused by the expression of a specific gene in a liver cell.

In yet another aspect, the present disclosure provides a method of treating a pathological condition or disease caused by expression of a particular gene in a hepatocyte, the method comprising administering to a subject having the disease a double-stranded oligonucleotide, pharmaceutical composition or conjugate of the present disclosure.

In yet another aspect, the present disclosure provides a method of inhibiting the expression of a specific gene in a hepatocyte, the method comprising contacting a double-stranded oligonucleotide, pharmaceutical composition or conjugate of the present disclosure with the hepatocyte.

In addition, the present disclosure provides a kit comprising a double-stranded oligonucleotide, a pharmaceutical composition, or a conjugate of the present disclosure.

Is incorporated by reference

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Drawings

FIG. 1 is a bar graph of the relative expression of APOC3mRNA in the psi-CHECK system after transfection with conjugates 1-8 or reference conjugate 1, respectively.

FIG. 2 is a bar graph of the relative expression of APOC3mRNA in the psi-CHECK system after transfection with conjugates 9-11, respectively, or reference conjugates 2-4, respectively.

Figure 3 is a line graph of serum triglyceride levels in mice over a 36 day period after transfection with conjugates 26-30, or reference conjugate 5, or negative reference conjugate, respectively.

Figure 4 is a bar graph of the number of genes whose gene expression levels were significantly up-regulated, down-regulated, and unchanged for non-target genes after transfection with conjugate 32, or reference conjugates 15-17, or negative reference conjugates, respectively.

Fig. 5 is a semi-quantitative result of stability test of siRNA conjugates of the present disclosure in vitro lysosomal lysates.

Advantageous effects

The nucleotide sequences, double-stranded oligonucleotides, pharmaceutical compositions or conjugates of the present disclosure have significantly reduced off-target effects while at the same time. Also shows higher target mRNA regulatory activity and has good stability, as described in detail below.

First, the nucleotide sequences, double-stranded oligonucleotides, pharmaceutical compositions, or conjugates of the present disclosure can have significantly lower off-target effects in vitro or in vivo. For example, in an in vitro psi-CHECK system, none of the conjugates of the present disclosure have an inhibitory activity against off-target sequences of greater than 25% over the tested concentration range, all showing a significantly reduced off-target effect, as compared to siRNA conjugates having the same sequence but no acyclic abasic group. For another example, the double-stranded oligonucleotides of the present disclosure all have significantly reduced off-target effects as compared to various double-stranded oligonucleotides of different modification schemes that do not comprise an acyclic abasic group. Also, the siRNA conjugates of the present disclosure having different numbers of acyclic abasic groups of different steric configurations at different positions all showed significantly reduced off-target effects compared to the siRNA conjugates without acyclic abasic groups. As another example, the conjugates of the present disclosure for modulating HAO1mRNA inhibitory activity exhibit a lower amount of gene up-or down-regulation, exhibiting significantly lower off-target effects, than conjugates with other acyclic abasic groups, or conjugates that do not contain acyclic abasic groups. As another example, none of the siRNA conjugates of the present disclosure for modulating ANGPTL3mRNA have an inhibitory activity against off-target sequences high enough to allow calculation of IC₅₀I.e. none showed a significant off-target effect

Second, the nucleotide sequences, double-stranded oligonucleotides, pharmaceutical compositions, or conjugates of the present disclosure can exhibit higher target mRNA modulating activity in vitro or in vivo, and even exhibit higher target mRNA inhibitory activity than siRNA conjugates without acyclic abasic groups. For example, at a concentration of 50nM, the siRNA conjugates of the present disclosure exhibited APOC3mRNA inhibitory activity of up to 71.43%, even 77.14%, 9.52% higher than the reference conjugate that did not contain the acyclic abasic group. For another example, the siRNA conjugates provided by the present disclosure show higher APOC3mRNA inhibitory activity in mouse liver primary cells, and at a siRNA conjugate concentration of 20nM, the inhibition rates of APOC3mRNA are all over 91.5%, which are all higher than the inhibition rate of the reference conjugate to APOC3 mRNA. And under the condition of the administration dosage of 3mg/kg, the inhibition rate of the siRNA conjugate to triglyceride is always maintained to be more than 78% and the maximum inhibition rate is as high as 84.63% within 36 days after single administration. For another example, double-stranded oligonucleotides comprising acyclic abasic groups of the present disclosure have significantly higher HBV mRNA inhibitory activity than double-stranded oligonucleotides comprising other acyclic abasic groups. For another example, the conjugates of the present disclosure all inhibited HAO1mRNA by more than 91.5% at a siRNA conjugate concentration of 20 nM. At a concentration of 50nM, the conjugates of the present disclosure exhibited ANGPTL3mRNA inhibitory activity of up to 82.5%, 28% higher than the reference conjugate. And, at a siRNA conjugate concentration of 20nM, the inhibition rates of the conjugates of the present disclosure on ANGPTL3mRNA in mice were all as high as 92% or more, 64.33% and 65.14% higher than the inhibition rates of the reference conjugates.

Third, the disclosed nucleotide sequences, double-stranded oligonucleotides, pharmaceutical compositions, or conjugates have good stability, e.g., the disclosed conjugates exhibit high stability in lysosomal lysing solutions and can remain undegraded for long periods of time.

Additional features and advantages of the disclosure will be set forth in the detailed description which follows.

Detailed Description

The following describes in detail specific embodiments of the present disclosure. It should be understood that the detailed description and specific examples, while indicating the present disclosure, are given by way of illustration and explanation only, not limitation.

In the present disclosure, the HBV gene refers to a viral gene of Hepatitis B Virus (HBV), for example, a gene having a sequence shown as Genbank registration number NC _003977.2, and HBV mRNA refers to mRNA transcribed from the above HBV gene, unless otherwise specified; the APOC3mRNA is mRNA having a sequence represented by Genbank accession No. NM _000040.3, and the APOC3 gene is a gene for transcribing the APOC3 mRNA; ANGPTL3mRNA refers to mRNA having a sequence shown by Genbank registration No. NM _014495.4, ANGPTL3 gene refers to a gene that transcribes the aforementioned ANGPTL3mRNA, HAO1mRNA refers to mRNA having a sequence shown by Genbank registration No. NM _017545.3, and HAO1 gene refers to a gene that transcribes the aforementioned HAO1 mRNA.

Definition of

In the above and below, capital C, G, U, A represents the base composition of nucleotides, unless otherwise specified; the lower case letter m indicates that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide; the lower case letter f indicates that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide; the lower case letter s indicates a phosphorothioate-based linkage between two nucleotides adjacent to the left and right of the letter s; p1 indicates that the nucleotide adjacent to the right of the P1 is a 5' -phosphate nucleotide or a 5' -phosphate analog modified nucleotide, the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate modified nucleotide, the letter combination Ps indicates that the nucleotide adjacent to the right of the letter combination Ps is a phosphorothioate modified nucleotide, and the capital letter P indicates that the nucleotide adjacent to the right of the letter P is a 5' -phosphate nucleotide. The letter combination (GLY) indicates that two nucleotides adjacent to the left and right of (GLY) are linked by an acyclic abasic group represented by formula (A101); (GLY-Ac) represents that two nucleotides adjacent to the left and right of the (GLY-Ac) are linked by an acyclic abasic group represented by the formula (A102); (GLY-Ph) two nucleotides adjacent to the (GLY-Ph) on the left and right are linked by an acyclic abasic group represented by formula (A103); (GLY-TOS) represents that two nucleotides adjacent to the left and right of the (GLY-TOS) are linked by an acyclic abasic group represented by formula (A104); (GLY-iBu) represents that two nucleotides adjacent to the left and right of the (GLY-iBu) are linked by an acyclic abasic group represented by formula (A105); (GLY-laev) represents that two nucleotides adjacent to the left and right of the (GLY-laev) are linked by an acyclic abasic group represented by formula (A106); (GLY-Cro) represents that two nucleotides adjacent to the left and right of (GLY-Cro) are linked by an acyclic abasic group represented by formula (A107).

In the above and below, the "fluorine-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group of the nucleotide is substituted with fluorine, and the "non-fluorine-modified nucleotide" refers to a nucleotide or a nucleotide analog in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group.

"nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Such as a heteronucleotide, a bridged nucleotide (BNA for short) or an acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2' -hydroxyl group of the ribosyl group is substituted with a methoxy group.

In the present context, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning well known to the skilled person, i.e. in a double stranded nucleic acid molecule, the bases of one strand pair with the bases on the other strand in a complementary manner. In DNA, the purine base adenine (a) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair comprises a purine and a pyrimidine. Two strands are considered to be complementary to each other when adenine on one strand always pairs with thymine (or uracil) on the other strand and guanine always pairs with cytosine, and the sequence of a strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at the corresponding positions are not paired in a complementary fashion.

In the above and in the following, unless otherwise specified, "essentially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that no more than 1 base mismatch exists between two nucleotide sequences; "completely reverse complementary" means that there is no base mismatch between two nucleotide sequences.

In the above and below, the "nucleotide difference" between one nucleotide sequence and another nucleotide sequence means that the former has a change in the base type of the nucleotide at the same position as compared with the latter, for example, in the latter, when one nucleotide base is A, in the case where the corresponding nucleotide base at the same position of the former is U, C, G or T, it is considered that there is a nucleotide difference between the two nucleotide sequences at that position. In some embodiments, when a nucleotide in situ is replaced with a nucleotide or nucleotide analog without a base, it is also believed that a nucleotide difference is created at that position.

In the above and the following, particularly in describing the preparation method of the double-stranded oligonucleotide, the pharmaceutical composition and/or the siRNA conjugate of the present disclosure, unless otherwise specified, the Nucleoside monomer (Nucleoside monomer) refers to a modified or unmodified Nucleoside monomer (sometimes referred to as "RNA phosphoramidites") used in solid phase synthesis of phosphoramidites, depending on the kind and order of nucleotides in the double-stranded oligonucleotide, the pharmaceutical composition and/or the siRNA conjugate to be prepared. Solid phase phosphoramidite synthesis is a method used in RNA synthesis well known to those skilled in the art. Nucleoside monomers for use in the present disclosure are all commercially available.

In the context of the present disclosure, "conjugated," means that two or more chemical moieties, each having a particular function, are linked to each other in a covalent linkage, unless otherwise indicated; accordingly, "conjugate" refers to a compound formed by covalent linkage between the various chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently attaching one or more chemical moieties having a specific function to siRNA. Hereinafter, the siRNA conjugates of the present disclosure are also sometimes simply referred to as "conjugates". The siRNA conjugate is understood as a general term of the siRNA conjugate, a general term of the siRNA conjugate represented by formula (305) and formula (307), or an siRNA conjugate represented by formula (305), formula (307), formula (308), depending on the context. In the context of the present disclosure, a "conjugate molecule" should be understood as a specific compound that can be conjugated to an siRNA by a reaction, ultimately forming an siRNA conjugate of the present disclosure.

Substituted radicals, such as substituted alkyl, substituted alkoxy, substituted amino, substituted aliphatic, substituted heteroaliphatic, substituted acyl, substituted aryl, in the text above or belowOr substituted heteroaryl, unless otherwise specified, a "substituted" group refers to a group in which a hydrogen atom in the group is replaced with one or more substituents. For example, "substituted alkoxy" refers to a group formed by replacing one or more hydrogen atoms in an alkoxy group with a substituent. It will be appreciated by those skilled in the art that compounds useful in the application of the present disclosure may contain various substituents, and that the introduction of such substituents may be useful in the present disclosure as long as the introduction does not interfere with the function of the present disclosure and the purpose of the present disclosure can be achieved. In some embodiments, the substituents are selected from the group consisting of: c₁-C₁₀Alkyl radical, C₆-C₁₀Aryl radical, C₅-C₁₀Heteroaryl group, C₁-C₁₀Haloalkyl, -OC₁-C₁₀Alkyl, -OC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-OH, -OC₁-C₁₀Haloalkyl, -SC₁-C₁₀Alkyl, -SC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-SH, -SC₁-C₁₀Haloalkyl, halogen substituents, -OH, -SH, -NH₂、-C₁-C₁₀alkyl-NH₂、-N(C₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -NH (C)₁-C₁₀Alkyl), -N (C)₁-C₁₀Alkyl) (C₁-C₁₀Alkylphenyl), -NH (C)₁-C₁₀Alkylphenyl), cyano, nitro, -CO₂H、-C(O)O(C₁-C₁₀Alkyl), -CON (C)₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -CONH (C)₁-C₁₀Alkyl), -CONH₂，-NHC(O)(C₁-C₁₀Alkyl), -NHC (O) (phenyl), -N (C)₁-C₁₀Alkyl radical C (O) (C)₁-C₁₀Alkyl), -N (C)₁-C₁₀Alkyl group C (O) (phenyl), -C (O) C₁-C₁₀Alkyl, -C (O) C₁-C₁₀Alkylphenyl, -C (O) C₁-C₁₀Haloalkyl, -OC (O) C₁-C₁₀Alkyl, -SO₂(C₁-C₁₀Alkyl), -SO₂(phenyl), -SO₂(C₁-C₁₀Haloalkyl), -SO₂NH₂、-SO₂NH(C₁-C₁₀Alkyl), -SO₂NH (phenyl), -NHSO₂(C₁-C₁₀Alkyl), -NHSO₂(phenyl) and-NHSO₂(C₁-C₁₀Haloalkyl). In some embodiments, the substituent is C₁-C₃Alkyl radical, C₆-C₈Aryl, -OC₁-C₃Alkyl, -OC₁-C₃Alkylphenyl, halogen, -OH, -NH₂One of cyano or nitro. It will be understood by those skilled in the art that, for any group containing one or more substituents, these groups are not intended to introduce any substitution or substitution pattern that is sterically impractical, synthetically non-feasible, and/or inherently unstable.

As used herein, "alkyl" refers to straight and branched chains having the specified number of carbon atoms, typically from 1 to 20 carbon atoms, for example from 1 to 10 carbon atoms, such as from 1 to 8 or from 1 to 6 carbon atoms. E.g. C₁-C₆Alkyl groups include straight and branched chain alkyl groups of1 to 6 carbon atoms. When referring to an alkyl residue having a particular number of carbons, it is intended to encompass all branched and straight chain forms having that number of carbons; thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl, and tert-butyl; "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl and refers to the same residue as alkyl but with two points of attachment.

As used herein, "alkenyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon double bond obtained by removing a molecule of hydrogen from the adjacent carbon atom of the parent alkyl group. The group may be in the cis or trans configuration of the double bond. Typical alkenyl groups include, but are not limited to: a vinyl group; propenyl, such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl; butenyl, e.g., but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-2-yl, but-1, 3-dien-1-yl, but-1, 3-dien-2-yl, and the like. In certain embodiments, alkenyl groups have 2 to 20 carbon atoms, and in other embodiments, 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl and refers to the same residue as alkenyl, but with two points of attachment.

As used herein, "alkynyl" refers to an unsaturated branched or straight-chain alkyl group having at least one carbon-carbon triple bond obtained by removing two molecules of hydrogen from adjacent carbon atoms of the parent alkyl group. Typical alkynyl groups include, but are not limited to: an ethynyl group; propynyl groups, such as prop-1-yn-1-yl, prop-2-yn-1-yl; butynyl groups such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl and the like. In certain embodiments, alkynyl groups have 2 to 20 carbon atoms, and in other embodiments 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkynylene is a subset of alkynyl and refers to the same residue as alkynyl, but with two points of attachment.

As used herein, "alkoxy" refers to an alkyl group of the indicated number of carbon atoms attached through an oxygen bridge, e.g., methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-methylpentyloxy, and the like. Alkoxy groups typically have 1 to 10,1 to 8, 1 to 6, or 1 to 4 carbon atoms connected by an oxygen bridge.

As used herein, "aryl" refers to a group derived from an aromatic monocyclic or polycyclic hydrocarbon ring system formed by the removal of a hydrogen atom from a ring carbon atom. The aromatic monocyclic or polycyclic hydrocarbon ring systems contain only hydrogen and carbon of 6 to 18 carbon atoms, wherein at least one of the rings in the ring system is fully unsaturated, i.e. it comprises a cyclic, delocalized (4n +2) pi-electron system according to huckel theory. Aryl groups include, but are not limited to, phenyl, fluorenyl, naphthyl, and the like. Arylene is a subset of aryl and refers to the same residue as aryl, but with two points of attachment.

As used herein, "halogen substituent" or "halo" refers to fluoro, chloro, bromo, or iodo, and the term "halogen" includes fluoro, chloro, bromo, or iodo.

As used herein, "haloalkyl" refers to an alkyl group as defined above wherein the specified number of carbon atoms are substituted with one or more, up to the maximum allowable number of halogen atoms. Examples of haloalkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, or pentafluoroethyl.

"heterocyclyl" refers to a stable 3-to 18-membered non-aromatic ring radical containing 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise indicated in the specification, heterocyclyl is a monocyclic, bicyclic, tricyclic or tetracyclic ring system, and may include fused or bridged ring systems. The heteroatoms in the heterocyclic group may be optionally oxidized. One or more nitrogen atoms (if present) are optionally quaternized. Heterocyclyl groups are partially or fully saturated. The heterocyclyl group may be attached to the remainder of the molecule through any ring atom. Examples of such heterocyclic groups include, but are not limited to: dioxanyl, thienyl [1,3] dithioyl (thienyl [1,3] dithianyl), decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxapiperazinyl, 2-oxapiperidinyl, 2-oxapyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidinonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithioyl (trithiofuranyl), tetrahydropyranyl, thiomorpholinyl (thiomorpholinyl), 1-oxothiomorpholinyl (1-oxo-thiomorpholinyl), and 1, 1-dioxothiomorpholinyl (1, 1-dioxothiomorpholinyl). Heterocyclylene is a subset of heterocyclyl and refers to the same residue as heterocyclyl, but with two points of attachment.

"heteroaryl" refers to a group derived from a 3-to 18-membered aromatic ring radical containing 2 to 17 carbon atoms and 1 to 6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, a heteroaryl group can be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, wherein at least one ring in the ring system is fully unsaturated, i.e., comprises a cyclic delocalized (4n +2) pi-electron system according to huckel theory. Heteroaryl includes fused or bridged ring systems. The heteroatoms in the heteroaryl group are optionally oxidized. One or more nitrogen atoms (if present) are optionally quaternized. The heteroaryl group is attached to the remainder of the molecule through any ring atom. Examples of heteroaryl groups include, but are not limited to: azacyclotrienoyl, acridinyl, benzimidazolyl, benzindolyl, 1, 3-benzodioxazolyl, benzofuranyl, benzoxazolyl, benzo [ d ] thiazolyl, benzothiadiazolyl, benzo [ b ] [1,4] dioxepinyl (benzo [ b ] [1,4] dioxepinyl), benzo [ b ] [1,4] oxazinyl (benzo [ b ] [1,4] oxazinyl), 1,4-benzodioxanyl (1,4-benzodioxanyl), benzonaphthofuranyl, benzoxazolyl, benzodioxolyl (benzodioxolyl), benzodioxinyl (benzodioxanyl), benzopyranyl, benzopyranonyl, benzofuranyl, benzofuranonyl, benzothiophenyl, benzothieno [3,2-d ] pyrimidinyl, benzotriazolyl, benzo [4,6] imidazo [1,2-a ] pyridinyl, Carbazolyl, cinnolinyl, cyclopenta [ d ] pyrimidinyl, 6, 7-dihydro-5H-cyclopenta [4,5] thieno [2,3-d ] pyrimidinyl, 5,6-dihydrobenzo [ H ] quinazolinyl (5,6-dihydrobenzo [ H ] quinazolinyl), 5,6-dihydrobenzo [ H ] cinnolinyl (5,6-dihydrobenzo [ H ] cinnolinyl), 6, 7-dihydro-5H-benzo [6,7] cyclohepta [1,2-c ] pyridazinyl, dibenzofuranyl, dibenzothienyl, furanyl, furanonyl, furo [3,2-c ] pyridinyl, 5,6,7,8,9, 10-hexahydrocycloocta [ d ] pyrimidinyl, 5,6,7,8,9, 10-hexahydrocycloocta [ d ] pyridazinyl, 5,6,7,8,9, 10-hexahydrocycloocta [ d ] pyridyl, isothiazolyl, imidazolyl, indazolyl (indazolyl), indolyl, isoindolyl, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5, 8-methanol-5, 6,7,8-tetrahydroquinazolinyl (5,8-methano-5,6,7,8-tetrahydroquinazolinyl), naphthyridinyl (naphthyridinyl), 1,6-naphthyridinonyl (1,6-naphthyridinonyl), oxadiazolyl, 2-oxazepinyl (2-oxoazepinyl), oxazolyl, oxacyclopropane (oxacinnanyl), 5,6,6a,7,8,9,10,10 a-octahydrobenzo [ H ] quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, and oxazolyl, Phthalazinyl (phthalazinyl), pteridinyl (pteridinyl), purinyl, pyrrolyl, pyrazolyl, pyrazolo [3,4-d ] pyrimidinyl, pyridyl, pyrido [3,2-d ] pyrimidinyl, pyrido [3,4-d ] pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolinyl, tetrahydroquinolinyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7, 8-tetrahydrobenzo [4,5] thieno [2,3-d ] pyrimidinyl, 6,7,8, 9-tetrahydro-5H-cyclohepta [4,5] thieno [2,3-d ] pyrimidinyl, 5,6,7, 8-tetrahydropyrido [4,5-c ] pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, pyridazinyl, pyridyl, pyridazinyl, pyridyl, pyridazinyl, pyridyl, pyridazinyl, pyridyl, pyridazinyl, and so 1, pyridazinyl, and so n-yl, benzyl, triazinyl, thieno [2,3-d ] pyrimidinyl, thieno [3,2-d ] pyrimidinyl, thieno [2,3-c ] pyridinyl (thieno [2,3-c ] pridinyl) and thienyl (thiophenyl/thiophenyl). Heteroarylene is a subset of heteroaryl and refers to the same residue as heteroaryl, but with two points of attachment.

Various hydroxyl protecting groups may be used in the present disclosure. In general, protecting groups render a chemical functionality insensitive to particular reaction conditions, and can be added to and removed from the molecule at that functionality without substantially damaging the rest of the molecule. Representative hydroxyl protecting Groups are disclosed in Beaucage et al, Tetrahedron 1992,48,2223-2311, and Greenea and Wuts, Protective Groups in Organic Synthesis, Chapter 2,2d ed, John Wiley & Sons, New York, 1991, each of which is incorporated herein by reference in its entirety. In some embodiments, the protecting group is stable under basic conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include dimethoxytrityl (DMTr), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9- (p-methoxyphenyl) xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that may be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4 '-dimethoxytrityl), and TMTr (4,4',4 "-trimethoxytrityl).

The term "subject", as used herein, refers to any animal, e.g., a mammal or a marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, rabbits, and any species of poultry.

As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. By "therapeutic benefit" is meant eradication or amelioration of the underlying disorder being treated. In addition, therapeutic benefit is achieved by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," a double-stranded oligonucleotide, pharmaceutical composition, or oligonucleotide conjugate can be administered to a subject at risk for developing a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though a diagnosis of the disease may not have been made.

Nucleotide sequence

In one aspect, the present disclosure provides a nucleotide sequence. The nucleotide sequences of the present disclosure contain a nucleotide group as a basic structural unit, which is well known to those skilled in the art, and the nucleotide group contains a phosphate group, a ribose group and a base, which are not described in detail herein.

Each nucleotide in the nucleotide sequence of the present disclosure is a modified or unmodified nucleotide, wherein the nucleotide sequence comprises a nucleotide sequence I, wherein the nucleotide sequence I is a nucleotide sequence formed by replacing at least one of nucleotides 2 to 8 in the 5 '-terminal-3' -terminal direction in a nucleotide sequence a with an acyclic abasic group, the nucleotide sequence a has 16-30 nucleotides, and the nucleotide sequence a is reverse complementary to a nucleotide sequence in a target mRNA by at least 14 nucleotides.

That is, the nucleotide sequence a is a nucleotide having a length of 16-30 nucleotides, and the nucleotide sequence a is at least partially reverse complementary to a stretch of nucleotide sequence in the target mRNA. The nucleotide sequence I is a nucleotide sequence formed by the following modes: at least one nucleotide from the 2 nd nucleotide to the 8 th nucleotide in the nucleotide sequence A is substituted with an acyclic abasic group in the 5 'terminal-3' terminal direction. In some embodiments, the nucleotide sequence a is reverse complementary to a stretch of sequence in the target mRNA for more than 85% of the nucleotides; in some embodiments, the nucleotide sequence a has no more than 2 base mismatches to a stretch of sequence in the target mRNA.

The acyclic dealkalization group has a structure shown as a formula (101):

wherein R is₁、R₂And R₃Each independently has a structure represented by formula (201):

R₄has a structure as shown in formula (202):

represents the site of covalent attachment of a group, each n is independently selected from an integer from 0 to 4, each m is independently selected from an integer from 1 to 4, E₁Selected from OH, SH or BH₂；

Each R₁₀₁Independently selected from H, C₁-C₅Straight chain alkyl, C₁-C₅Alkoxy radical, C₁-C₁₀Acyl radical, C₁-C₅Alkylsulfonyl and C₆-C₁₀Arylsulfonyl groups;

R₂₀₁selected from OH or NHR₂₀₂Wherein R is₂₀₂Selected from the group consisting of H, C₁-C₅Straight chain alkyl, C₁-C₁₀Acyl and C₁-C₅Alkylsulfonyl and C₆-C₁₀Aryl sulfonyl group.

In some embodiments, each n is independently selected from an integer from 0 to 4, and m is independently selected from an integer from 1 to 4. In some embodiments, each n is independently selected from 0 or 1, and m is independently selected from 1 or 2. In some embodiments, n is 0 and m is 1.

In some embodiments, E₁Selected from OH, SH or BH₂. In some embodiments, E is for raw materials to be readily available₁Selected from OH or SH.

In some embodiments, each R is₁₀₁Each independently selected from the group consisting of H, C₁-C₅Straight chain alkyl, C₁-C₅Alkoxy radical, C₁-C₁₀Acyl radical, C₁-C₅Alkylsulfonyl and C₆-C₁₀Aryl sulfonyl group. In some embodiments, each R is independently selected from R, and R₁₀₁Independently selected from the group consisting of H, methyl, ethyl and methoxy. In some embodiments, each R is₁₀₁Independently selected from the group consisting of H, methyl, ethyl and methoxy.

In some embodiments, R₂₀₁Selected from OH or NHR₂₀₂. In some embodiments, R₂₀₁Is NHR₂₀₂And R is₂₀₂Is selected from the group consisting of H, C₁-C₅Straight chain alkyl, C₁-C₁₀Acyl and C substituted by sulfonyl₁-C₁₀Acyl group. In some embodiments, R₂₀₂Selected from the group consisting of H, C₁-C₅Aliphatic acyl group, C₁-C₅Aromatic acyl group, C₁-C₅Alkylsulfonyl and C₆-C₁₀Aryl sulfonyl group. In some embodiments, R₂₀₂Selected from acetyl, isobutyryl, benzoyl, p-toluenesulfonyl, ethylAcyl propionyl group and crotonyl group.

In some embodiments, each nucleotide in the nucleotide sequence is independently a modified or unmodified nucleotide. In some embodiments, all nucleotides in the nucleotide sequence are modified nucleotides. In some embodiments, the nucleotides in the nucleotide sequence are all unmodified nucleotides.

In some embodiments, the nucleotide sequence a ranges from 16 to 30 nucleotides in length. In some embodiments, the nucleotide sequence a is 19-25, 21-25, 19-21, or 21-23 nucleotides in length. In some embodiments, the nucleotide sequence a is 19-21 nucleotides in length. In some embodiments, the nucleotide sequence a is 19 or 21 nucleotides in length.

In some embodiments, the nucleotide sequence a is reverse complementary to a stretch of nucleotides in the target mRNA by at least 14 nucleotides. In some embodiments, the nucleotide sequence a is reverse complementary to a stretch of nucleotides in the target mRNA by at least 16 nucleotides. In some embodiments, the nucleotide sequence a is reverse complementary to a stretch of nucleotides in the target mRNA by at least 18 nucleotides.

In order to simplify the structure of the nucleotide sequence, in some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing at least one of nucleotides 2,3,4, 5,6,7, and 8 in the 5 'end-3' end direction in the nucleotide sequence A with an acyclic abasic group. In some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing at least one of the nucleotides at positions 3,4, 5,6, and 7 in the 5 'end-3' end direction in the nucleotide sequence a with an acyclic abasic group. In some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing at least one nucleotide of nucleotides 2, 6,7 and 8 in the 5 'end-3' end direction in the nucleotide sequence A with an acyclic abasic group. In some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing one of the nucleotides at position 4,5, 6 or 7 in the 5 'end-3' end direction in the nucleotide sequence a with an acyclic abasic group. In some embodiments, the nucleotide sequence I is a nucleotide sequence in which one of the nucleotides at position 6,7 or 8 in the 5 'to 3' direction in the nucleotide a is replaced with an acyclic abasic group.

In some embodiments, the nucleotide sequence I is a nucleotide sequence in which any 2 nucleotides of nucleotides in positions 2 to 8 in the 5 'to 3' direction in the nucleotide sequence a are replaced with an acyclic base group. In some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing any 2 nucleotides at positions 4,5, 6 or 7 in the 5 'end-3' direction in the nucleotide sequence a with an acyclic abasic group. In some embodiments, the nucleotide sequence I is a nucleotide sequence formed by replacing any 1 nucleotide and the seventh nucleotide at positions 4,5 or 6 in the 5 'end-3' end direction in the nucleotide sequence a with an acyclic abasic group.

In some embodiments, each acyclic abasic group is independently selected from the group consisting of groups a101-a 107:

wherein, the carbon atom marked with "-" indicates that the carbon atom is in an R configuration, an S configuration or a racemic configuration.

In some embodiments, each nucleotide in the nucleotide sequence a is a modified nucleotide.

In some embodiments, at least two nucleotides from position 2 to position 16 in the 5' end-3 ' direction in the nucleotide sequence a are ribosyl 2' nucleotides having a fluoro modification, and each nucleotide at other positions of the nucleotide sequence a is independently one of non-fluoro modified nucleotides. In some embodiments, at least two nucleotides at positions 2, 6, 14, 16 of the nucleotide sequence a in the 5' to 3' direction are ribosyl 2' nucleotides with a fluoro modification, and each nucleotide at other positions of the nucleotide sequence a is independently one of the non-fluoro modified nucleotides. In some embodiments, at least two nucleotides at positions 2, 6, 8,9, 14, 16 of the nucleotide sequence a in the 5' to 3' direction are ribosyl 2' nucleotides having a fluoro modification, and each nucleotide at other positions of the nucleotide sequence a is independently one of the non-fluoro modified nucleotides.

In the present disclosure, above and below, "fluoro-modified nucleotide", "2 '-fluoro-modified nucleotide", "nucleotide in which 2' -hydroxyl group of ribose group is substituted with fluorine", and "2 '-fluoro-ribosyl group" have the same meaning, and all refer to a compound having a structure represented by formula (401) in which 2' -hydroxyl group of nucleotide is substituted with fluorine, wherein Base represents a Base selected from C, G, A or U. The terms "methoxy-modified nucleotide", "2 '-methoxy-modified nucleotide", "nucleotide in which 2' -hydroxyl group of ribose group is substituted with methoxy group" and "2 '-methoxy ribosyl group" have the same meaning, and refer to that 2' -hydroxyl group of ribose group of nucleotide is substituted with methoxy group to form a structure as shown in formula (402).

In the context of the present disclosure, "non-fluorinated modified nucleotide" refers to a nucleotide analog or a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from one of a nucleotide analog or a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group.

In some embodiments, the 2 '-alkoxy-modified nucleotide may be a methoxy-modified nucleotide (2' -OMe), as shown in formula (402). In some embodiments, the 2' -substituted alkoxy modified nucleotide may be a 2' -O-methoxyethyl modified nucleotide (2' -MOE), as shown in formula (403). In some embodiments, 2 '-amino modified nucleotides (2' -NH)₂) As shown in equation 404. In some embodiments, the 2' -Deoxynucleotide (DNA) is according to formula (405).

In some embodiments, the nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group of the nucleotide is substituted with a non-fluorine group is selected from one of 2' -alkoxy-modified nucleotides, 2 '-substituted alkoxy-modified nucleotides, 2' -alkyl-modified nucleotides, 2 '-substituted alkyl-modified nucleotides, 2' -amino-modified nucleotides, 2 '-substituted amino-modified nucleotides, and 2' -deoxynucleotides.

In the context of the present disclosure, a nucleotide analog refers to a group that can replace a nucleotide in a nucleic acid, but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, the nucleotide analog can be a heteronucleotide, a bridged nucleotide (BNA for short), or an acyclic nucleotide. BNA refers to a constrained or inaccessible nucleotide. BNAs may contain five-membered, six-membered, or seven-membered ring bridged structures with "fixed" C3' -endo-sugar pull-down. The bridge is typically incorporated at the 2'-, 4' -position of the ribose to provide a 2',4' -BNA nucleotide, such as LNA, ENA, cET BNA, etc., where LNA is shown as (406), ENA is shown as (407), and cET BNA is shown as (408).

Acyclic nucleotides refer to a class of "open-loop" nucleotides in which the sugar ring of the nucleotide is opened, such as Unlocked Nucleic Acids (UNA) or Glycerol Nucleic Acids (GNA), where UNA is represented by formula (409) and GNA is represented by formula (410).

In the above formula (409) and formula (410), R is selected from H, OH or alkoxy (O-alkyl).

An isonucleotide refers to a compound in which the position of a base on a ribose ring is changed in a nucleotide, for example, a compound in which a base moves from the 1' -position to the 2' -position or the 3' -position of a ribose ring, as shown in formula (411) or (412).

In the compounds of the above-mentioned formula (411) to formula (412), Base represents a Base such as A, U, G, C or T; r is selected from H, OH, F or a non-fluorine group as described above.

In some embodiments, the nucleotide analog is selected from one of a isonucleotide, LNA, ENA, cET BNA, UNA, and GNA.

In some embodiments, the nucleotide sequence consists of the nucleotide sequence I.

In some embodiments, there are a variety of ways that can be used to modify nucleotide sequences, including, in addition to the above-mentioned modifications of ribose groups, backbone modifications (e.g., phosphate group modifications), base modifications, etc. (see, e.g., Watts, J.K., G.F.Delevaey and M.J.Damha, chemical modified siRNA: tools and applications, drug discovery Today, 2008.13 (19-20): p.842-55, the entire contents of which are incorporated herein by reference).

In some embodiments, at least 1 of the phosphate groups in the phosphate-sugar backbone of the nucleotide sequence is a phosphate group having a modifying group. The phosphate group having a modifying group is a phosphorothioate group in which at least one oxygen atom in a phosphodiester bond in the phosphate group is substituted with a sulfur atom. In some embodiments, the phosphorothioate group is a phosphorothioate (phosphorothioate) structure as shown in formula (421), wherein one sulfur atom replaces a non-bridging oxygen atom in a phosphodiester linkage and a phosphorothioate diester linkage replaces a phosphodiester linkage, i.e., the linkage between two nucleotides is a phosphorothioate linkage. The modification can stabilize the structure of nucleotide sequence and maintain high specificity and high affinity of base pairing.

Modified or unmodified double-stranded oligonucleotides

In another aspect, the present disclosure also provides a double-stranded oligonucleotide comprising the aforementioned nucleotide sequence, capable of modulating gene expression. The double-stranded oligonucleotide contains a sense strand and an antisense strand, the antisense strand comprising a nucleotide sequence as described above, the sense strand being a nucleotide sequence having 16-30 nucleotides, and the sense strand being at least partially reverse-complementary to the antisense strand to form a double-stranded region.

In some embodiments, the antisense strand is substantially reverse complementary or substantially reverse complementary to the sense strand. By substantially reverse complementary is meant that there is no more than 3 base mismatches between two nucleotide sequences; by substantially reverse complementary is meant that there is no more than 1 base mismatch between two nucleotide sequences.

In some embodiments, the double-stranded oligonucleotide comprises a nucleotide sequence in which each nucleotide is a modified or unmodified nucleotide.

The double-stranded oligonucleotide also contains a sense strand, and the sense strand is a nucleotide sequence with 16-30 nucleotides. In some embodiments, the sense strand is between 16-30 nucleotides in length. In some embodiments, the sense strand is 21-27, 23-27, 21-23, or 23-25 nucleotides in length. In some embodiments, the sense strand is 21-23 nucleotides in length. In some embodiments, the sense strand is 21 nucleotides in length. The sense strand or the antisense strand may each independently be 19-23 nucleotides in length.

Thus, the ratio of the lengths of the sense and antisense strands of a double-stranded oligonucleotide provided by the present disclosure can be 19/19, 19/20, 19/21, 19/22, 20/20, 20/21, 20/22, 20/23, 21/21, 21/22, 21/23, 21/24, 22/22, 22/23, 22/24, 22/25, 23/23, 23/24, 23/25, or 23/26. In some embodiments, the double-stranded oligonucleotides provided herein have a ratio of the length of the sense strand to the length of the antisense strand of 19/21 or 21/23, when the double-stranded oligonucleotides provided herein have better target mRNA silencing activity.

In some embodiments, at least 17 nucleotides of the nucleotides at positions 2-19 of the nucleotide sequence a are complementary to the sense strand in the 5 'end to 3' end direction. In some embodiments, at least 16 nucleotides of the nucleotides at positions 2-19 of the nucleotide sequence a are complementary to the sense strand in the 5 'end to 3' end direction. In some embodiments, at least 14 nucleotides of the nucleotides at positions 2-19 of the nucleotide sequence a are complementary to the sense strand in the 5 'end to 3' end direction.

In some embodiments, the double-stranded oligonucleotide comprises a nucleotide sequence in which each nucleotide is a modified nucleotide. In some embodiments, the double-stranded oligonucleotide comprises an antisense strand in which each nucleotide is a modified nucleotide. In some embodiments, the double-stranded oligonucleotide comprises a sense strand in which each nucleotide is a modified nucleotide.

In some embodiments, the double-stranded oligonucleotides of the present disclosure are double-stranded oligonucleotides having the following modifications: in the direction from the 5 'end to the 3' end, in the sense strand, the nucleotides at the 7 th, 8 th and 9 th positions or the 5 th, 7 th, 8 th and 9 th positions of the nucleotide sequence I are fluorine-modified nucleotides, and the nucleotides at the rest positions in the sense strand are methoxy-modified nucleotides; in the antisense strand, the 2 nd, 6 th, 14 th, 16 th or the 2 nd, 6 th, 8 th, 9 th, 14 th, 16 th nucleotide of the nucleotide sequence II is a fluorine-modified nucleotide, and the rest nucleotides in the antisense strand are methoxy-modified nucleotides.

In some embodiments, the double-stranded oligonucleotides of the present disclosure are double-stranded oligonucleotides having the following modifications: according to the direction from the 5' end to the 3' end, the 5 th, 7 th, 8 th and 9 th nucleotides of the sense strand are nucleotides with fluoro-modified nucleotide at the 2' position of the ribosyl of the nucleotide, and the nucleotides at the rest positions in the sense strand are nucleotides with methoxy-modified nucleotide; the nucleotides at positions 2, 6, 8,9, 14 and 16 of the antisense strand are nucleotides with fluoro-modification at position 2' of the ribosyl group of the nucleotide, the nucleotides at the remaining positions in the antisense strand are methoxy-modified nucleotides, and the antisense strand comprises the aforementioned nucleotide sequence I, and thus, 1 or more bases in the antisense strand can be replaced by acyclic abasic groups.

In some embodiments, the double-stranded oligonucleotides of the present disclosure are double-stranded oligonucleotides having the following modifications: according to the direction from the 5' end to the 3' end, the nucleotides at the 7 th, 8 th and 9 th positions of the sense strand are nucleotides with fluoro-modified nucleotide at the 2' position of the ribosyl of the nucleotide, and the nucleotides at the rest positions in the sense strand are nucleotides with methoxy-modified nucleotide; the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the antisense chain are nucleotides with fluoro-modified nucleotide at the 2' position of the ribosyl group of the nucleotide, the nucleotides at the rest positions in the antisense chain are nucleotides with methoxy-modified nucleotide, and the antisense chain comprises the nucleotide sequence I, therefore, 1 or more bases in the antisense chain can be replaced by acyclic abasic group.

In some embodiments, the double-stranded oligonucleotides of the present disclosure are double-stranded oligonucleotides having the following modifications: according to the direction from the 5 'end to the 3' end, the nucleotides at the 7 th and the 8 th positions of the sense strand are nucleotides with fluoro-modified nucleotide at the 2 'position of the ribosyl of the nucleotide, the nucleotides at the 5 th and the 9 th positions are 2' -deoxynucleotides, and the nucleotides at the rest positions in the sense strand are methoxy-modified nucleotides; the nucleotides at the 2 nd, 6 th, 14 th and 16 th positions of the antisense chain are nucleotides with fluoro-modified nucleotide at the 2' position of the ribosyl group of the nucleotide, the nucleotides at the rest positions in the antisense chain are nucleotides with methoxy-modified nucleotide, and the antisense chain comprises the nucleotide sequence I, therefore, 1 or more bases in the antisense chain can be replaced by acyclic abasic group.

In some embodiments, the double-stranded oligonucleotides of the present disclosure also contain other modified nucleotide groups that do not result in a significant impairment or loss of the function of the double-stranded oligonucleotide to modulate target gene expression.

Currently, there are a variety of ways available in the art for modifying double-stranded oligonucleotides, including, in addition to the ribose group modifications mentioned above, backbone modifications (e.g., phosphate group modifications), base modifications, etc. (see, e.g., Watts, J.K., G.F.Delevavey and M.J.Damha, chemical modified siRNA: tools and applications. drug discovery Today, 2008.13 (19-20): p.842-55, which is incorporated herein by reference in its entirety).

In some embodiments, at least 1 of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate group having a modifying group. The phosphate group having a modification group is a phosphorothioate group formed by substituting at least one oxygen atom in a phosphodiester bond in the phosphate group with a sulfur atom, and may be a phosphorothioate (phosphorothioate) structure represented by formula (421), in which one sulfur atom is substituted for a non-bridging oxygen atom in the phosphodiester bond, and a phosphorothioate diester bond is substituted for the phosphodiester bond, that is, the linkage between two nucleotides is a phosphorothioate linkage. The modification can stabilize the structure of the double-stranded oligonucleotide, and maintain high specificity and high affinity of base pairing.

In some embodiments, in the double-stranded oligonucleotide, the phosphorothioate linkage is present in at least one of: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination of the above. In some embodiments, phosphorothioate-based linkages are present at all of the above positions except at the 5' end of the sense strand. In some embodiments, thio

Phosphate linkages were present at all of the above positions except the 3' end of the sense strand. In some embodiments, the phosphorothioate-based linkage is present in at least one of the following positions:

between the 1 st and 2 nd nucleotides at the 5' terminal end of the sense strand;

between the 2 nd and 3 rd nucleotides at the 5' terminal end of the sense strand;

between the 1 st and 2 nd nucleotides at the 3' terminal end of the sense strand;

between the 2 nd and 3 rd nucleotides at the 3' terminal end of the sense strand;

between the 1 st and 2 nd nucleotides at the 5' terminal end of the antisense strand;

between the 2 nd and 3 rd nucleotides at the 5' terminal end of the antisense strand;

between the 1 st and 2 nd nucleotides at the 3' terminal end of the antisense strand; and

the 3' terminal end of the antisense strand is between the 2 nd and 3 rd nucleotides.

In some embodiments, the 5' terminal nucleotide of the antisense strand sequence of the double-stranded oligonucleotide molecule is a 5' -phosphate nucleotide or a 5' -phosphate analog modified nucleotide.

In some embodiments, the nucleotide 5' -phosphate has the structure shown in formula (422):

meanwhile, The types of The 5' -phosphate analogue-modified nucleotides which are commonly used are well known to those skilled in The art, for example, nucleotides represented by formulae (423) to (426) disclosed in Anastasia Khvorova and Jonathan K.Watts, The chemical evaluation of oligonucleotide therapeutics of clinical utility, Nature Biotechnology,2047,35(3): 238-48:

wherein R represents a group selected from the group consisting of H, OH, F and methoxy; base represents a Base selected from A, U, C, G or T.

In some embodiments, the 5' -phosphate analog modified nucleotide is a vinyl phosphate (E-VP) -containing nucleotide represented by formula (423), or a phosphorothioate-containing nucleotide represented by formula (425).

The modification schemes disclosed herein can be applied to a variety of double-stranded oligonucleotides that mediate gene expression. In some embodiments, the double-stranded oligonucleotide is a double-stranded oligonucleotide that inhibits or downregulates gene expression. In some embodiments, the double-stranded oligonucleotide is an siRNA. In some embodiments, the double-stranded oligonucleotide is a double-stranded oligonucleotide that activates or upregulates gene expression. In some embodiments, the double-stranded oligonucleotide is a saRNA.

According to some embodiments of the disclosure, the double-stranded oligonucleotides of the disclosure are sirnas comprising sequences as shown in tables 1A-1E:

TABLE 1siRNA sequences

TABLE 1A

TABLE 1B

TABLE 1C

TABLE 1D

TABLE 1E

Wherein S represents a sense strand; AS denotes the antisense strand, the capital letter C, G, U, A denotes the base composition of the nucleotide; the lower case letter m indicates that one nucleotide adjacent to the left side of the letter m is a 2' -methoxy modified nucleotide; the lower case letter f indicates that one nucleotide adjacent to the left side of the letter f is a 2' -fluoro modified nucleotide; the lower case letter s indicates that the linkage between two nucleotides adjacent to the left and right of the letter s is a phosphorothioate-based linkage; the lower case letter d indicates that one nucleotide adjacent to the right side of the letter d is a 2' -deoxynucleotide; p1 indicates that the nucleotide adjacent to the right side of P1 is a 5' -phosphate nucleotide or a 5' -phosphate analog modified nucleotide, in some embodiments a vinyl phosphate modified nucleotide (indicated by VP in the examples below), a 5' -phosphate modified nucleotide (indicated by P in the examples below), or a phosphorothioate modified nucleotide (indicated by Ps in the examples below); (GLY) represents that two nucleotides adjacent to the left and right of (GLY) are linked by an acyclic abasic group represented by formula (A101); (GLY-Ac) represents that two nucleotides adjacent to the left and right of the (GLY-Ac) are linked by an acyclic abasic group represented by the formula (A102); (GLY-Ph) two nucleotides adjacent to the (GLY-Ph) on the left and right are linked by an acyclic abasic group represented by formula (A103); (GLY-TOS) two nucleotides adjacent to the left and right of the (GLY-TOS) are linked by an acyclic abasic group represented by formula (A104); (GLY-iBu) represents that two nucleotides adjacent to the left and right of the (GLY-iBu) are linked by an acyclic abasic group represented by formula (A105); (GLY-laev) represents that two nucleotides adjacent to the left and right of the (GLY-laev) are linked by an acyclic abasic group represented by formula (A106); (GLY-Cro) represents that two nucleotides adjacent to the left and right of (GLY-Cro) are linked by an acyclic abasic group represented by the formula (A107), and the acyclic abasic groups are all in S configuration; (GLY-S) indicates that two nucleotides adjacent to each other on the left and right are connected by an acyclic abasic group of S configuration as represented by formula (A101); (GLY-R) indicates that the two nucleotides adjacent to each other on the left and right are linked by an acyclic abasic group of R configuration as represented by formula (A101).

In some embodiments, the double-stranded oligonucleotide is selected from the group consisting of HBOO 1, siAPO, siAPOa1M1SVP, siAPOb1M1SVP, siAPOc1M1SVP, siAPOd1M1SVP, siAPOe1M1SVP, siAPOf1M1SP, siAPOg1M1 SP-Ac, siAPOg1M1 SP-Ph, siAPOg1M1 SP-TOS, siAPOg1M1 SP-iBu, siAPOg1M1 SP-laev, siAPOg1M1 SP-Cro, siAPOg1M1SVP1, siOg 1M1SVP1, siAPOg1M1SVP1, siAPOPh 1,1 APOPh 1 APOcg 1N 1,1 APOcg 1, APOGa 1-APOcg 1, APOcg 1-APGa 5 HBOsOsP, 1-APOsOsOsP, sOsOsOsOsP, 1-APGa 5, HBsOsOsOsOsOsOsOsOsOsOsP, 1-APS 1-APsP, APsOsOsOsOsP, 1-APsP, 1-APPh, APsOsP, 1-APsOsOsP, APsOsOsOsOsOsOsOsP, 1-APGa, 1-APS-1-APS-APsP, HBP, APS-1-APsP, 1-APGa, APS-1-APsP, HBP, APsP, APsOsOsOsOsOsOsOsOsP, HBP, 1-APsOsOsOsOsOsOsOsOsP, HBP, HBS, HBP, APsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsP, 1-APGa 4, HBP, APsOsOsOsOsP, APGa, APsOsOsOsOsOsOsOsP, HBP, HBsOsOsOsOsP, HBP, APsOsOsOsOsOsP, APsP, HBP, HBsOsOsP, HBP, HBS, HBP, HBS, APsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsOsGa 1-.

The inventors of the present disclosure have surprisingly found that these double-stranded oligonucleotides provided by the present disclosure have high stability in blood and high stability in lysosomes, while reducing off-target effects. Meanwhile, the target gene expression regulatory activity is not significantly reduced, showing excellent in vivo inhibitory effect.

The double-stranded oligonucleotides provided by the present disclosure can be obtained by methods of double-stranded oligonucleotide preparation conventional in the art (e.g., methods of solid phase synthesis and solution phase synthesis). Among them, solid phase synthesis has been commercially available as a custom service. Modified nucleotide groups can be introduced into the double-stranded oligonucleotides described in the present disclosure by using nucleotide monomers having corresponding modifications, methods of preparing nucleotide monomers having corresponding modifications and methods of introducing modified nucleotide groups into double-stranded oligonucleotides are also well known to those skilled in the art.

The nucleotide sequence comprising an acyclic abasic group described in the present disclosure may be prepared according to oligonucleotide preparation methods conventional in the art, except that the above preparation is performed by replacing a nucleotide monomer of a substituted position with an acyclic abasic monomer compound having a structure represented by formula (110):

the compound of formula (110) is commercially available or obtained by one skilled in the art using known methods. In some embodiments, acyclic dealkalized monomer compounds of formula (110) may be obtained by the following preparation method:

the method comprises the following steps of contacting a compound shown as a formula (111) with phosphorous imide shown as a formula (131) in an organic solvent under a condensation reaction condition and in the presence of tertiary amine organic base and pyridine compounds, and separating to obtain a compound shown as a formula (110):

wherein R is₁、R₂、R₃、R₄Respective definitions and alternative scopes As previously described, each B1 is independently C₁-C₅An alkyl group; b is₂Is selected from C₁-C₅One of an alkyl group, an ethylcyano group, a propylcyano group and a butylcyano group.

The condensation reaction conditions include a reaction temperature of 0-150 ℃ and a reaction time of 0.5-72 hours, and in one embodiment, the condensation reaction conditions include a reaction temperature of 10-70 ℃ and a reaction time of 1-10 hours.

In some embodiments, the organic solvent may be selected from one or more of an epoxy solvent, an ether solvent, an alkyl halide solvent, dimethyl sulfoxide, N-dimethylformamide, and N, N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether and the alkyl halide solvent is one or more of dichloromethane, trichloromethane and 1, 2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The organic solvent is used in an amount of1 to 50L/mol, and in some embodiments, 3 to 20L/mol, relative to the compound represented by formula (111).

In some embodiments, the mole ratio of the phosphorodiamidite to the compound of formula (111) is from 0.5:1 to 10: 1.

In some embodiments, the tertiary amine organic base may be N-methylimidazole, N-methylmorpholine, triethylamine, or N, N-diisopropylethylamine. The tertiary amine organic base is N-methylimidazole in some embodiments; the molar ratio of the tertiary amine organic base to the compound of formula (111) may be from 0.3:1 to 20:1, and in some embodiments from 0.5:1 to 10: 1.

In some embodiments, the pyridine compound may be pyridine trifluoroacetate, 2- (trifluoromethyl) nicotinic acid, 2-amino-6- (trifluoromethyl) pyridine. In some embodiments, the pyridine compound is pyridine trifluoroacetate. The molar ratio of the pyridine compound to the compound of formula (111) may be from 0.3:1 to 20:1, and in some embodiments, from 0.5:1 to 10: 1.

The compound of formula (110) may be isolated from the reaction mixture using any suitable isolation method. In some embodiments, the compound of formula (313) may be isolated by removal of the solvent by evaporation followed by chromatographic methods, e.g., using the following two sets of chromatographic conditions: (1) normal phase purification: 200-mesh 300-mesh silica gel filler, and performing gradient elution by using petroleum ether and ethyl acetate as 10:1-1:10, or performing gradient elution by using dichloromethane and ethyl acetate as 10:1-1: 10; and (2) reversed-phase purification: c₁₈、C₈Reversed phase packing, gradient elution with methanol and acetonitrile 0.1:1-1: 0.1. In some embodiments, the solvent may be removed by evaporation, followed by suction filtration under reduced pressure to provide the compound of formula (110) as a product, which may be used directly in subsequent reactions.

The compound of formula (111) is commercially available or obtained by one skilled in the art using known methods. In some embodiments, the compound represented by formula (111) may be obtained by the following preparation method: the method comprises the following steps of contacting a compound shown as a formula (112) with a halogenated compound in an organic solvent under a substitution reaction condition and in the presence of tertiary amine organic base, and separating to obtain a compound shown as a formula (111):

wherein R is₁、R₂、R₃、R₄The respective definitions and alternative ranges are as described above.

In some embodiments, the substitution reaction conditions may include a reaction temperature of 0 to 100 ℃ and a reaction time of1 to 72 hours; in some embodiments the reaction temperature is 10-40 ℃ and the reaction time is 5-30 hours.

In some embodiments, the organic solvent may be selected from one or more of pyridine, an epoxy solvent, an ether solvent, an alkyl halide solvent, dimethyl sulfoxide, N-dimethylformamide, a heterocyclic compound, and N, N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1, 2-dichloroethane. In some embodiments, the heterocyclic compound is one or more of pyridine, pyrrole, and a pyridine analog. In some embodiments, the organic solvent is pyridine. The organic solvent is used in an amount of 0.3 to 50L/mol, and in some embodiments, 1 to 20L/mol, relative to the compound represented by formula (112).

In some embodiments, the halogenated compound is 4,4' -dimethoxytriphenylchloromethane, dithiomethoxycarbonyl, dimethylisopropylsilicon. In some embodiments, the halo-substituted compound is 4,4' -dimethoxytriphenylchloromethane. The molar ratio of the halogenated compound to the compound represented by formula (112) is 0.5:1 to 10: 1.

Similarly to the above, the compound of formula (111) may be isolated from the reaction mixture using any suitable separation method. In some embodiments, the compound of formula (111) may be isolated by removal of the solvent by evaporation followed by chromatographic methods, e.g., the isolation may be performed using two sets of chromatographic conditions as follows: (1) normal phase purification: 200-mesh 300-mesh silica gel filler, and gradient elution is carried out by using methanol and dichloromethane of 0.01:1-0.5: 1; or gradient elution with ethyl acetate and petroleum ether at 0.1:1-1: 1; and (2) reversed-phase purification: c₁₈And C₈Reversed phase packing, gradient elution with methanol and acetonitrile 0.1:1-1: 0.1. In some embodiments, the solvent may be removed by evaporation, followed by suction filtration under reduced pressure to provide the compound of formula (111) as a product, which may be used directly in subsequent reactions.

In some embodiments, R₄is-CH₂OH, in which case the compound of formula (112) is a readily commercially available glycerol, and in which case the compound of formula (110) obtained has the structure shown in formula (121).

The compound of formula (112) is commercially available or obtained by one skilled in the art using known methods. In some embodiments, R₄is-CH₂NHR₂₀₂The compound represented by the formula (112) can be obtained by the following production method: the method comprises reacting a compound represented by the formula (113) with R in an organic solvent under substitution reaction conditions₂₀₂An acid represented by OH or (R)₂₀₂)₂Contacting an acid anhydride represented by O, and isolating to obtain a compound represented by formula (112):

wherein R is₁、R₂、R₃The respective definitions and alternative ranges are as described above.

In some embodiments, the substitution reaction conditions may include a reaction temperature of 0 to 100 ℃ and a reaction time of1 to 72 hours; in some embodiments the reaction temperature is 10-40 ℃ and the reaction time is 3-30 hours.

In some embodiments, the organic solvent may be selected from one or more of an alcohol solvent, an ester solvent, an epoxy solvent, an ether solvent, an alkyl halide solvent, dimethyl sulfoxide, N-dimethylformamide, a heterocyclic compound, and N, N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and/or tetrahydrofuran. In some embodiments, the ether solvent is diethyl ether and/or methyl tert-butyl ether. In some embodiments, the haloalkane solvent is one or more of dichloromethane, trichloromethane and 1, 2-dichloroethane. In some embodiments, the alcoholic solvent is one or more of methanol, ethanol, propanol, butanol. In some embodiments, the ester solvent is one or more of ethyl acetate, methyl acetate, propyl acetate, butyl acetate. The organic solvent is used in an amount of 0.3 to 50L/mol, and in some embodiments, 1 to 20L/mol, relative to the compound represented by the formula (112).

In some embodiments, the R is₂₀₂An acid represented by OH or (R)₂₀₂)₂The anhydride represented by O is one or more selected from acetic anhydride, benzoic anhydride, p-toluenesulfonic anhydride, isobutyric anhydride, levulinic acid and crotonic acid. The R is₂₀₂An acid represented by OH or (R)₂₀₂)₂The molar ratio of the acid anhydride represented by O to the compound represented by the formula (112) is from 0.5:1 to 10: 1.

Similarly to the above, the compound of formula (112) may be isolated from the reaction mixture using any suitable separation method. In some embodiments, the compound of formula (112) may be isolated by removal of the solvent by evaporation followed by chromatographic methods, e.g., the isolation may be performed using two sets of chromatographic conditions as follows: (1) normal phase purification: 200-300 mesh silica gel filler, and gradient elution is carried out by using methanol and dichloromethane, wherein the ratio of methanol to dichloromethane is 0.01:1-1: 1; or gradient elution with ethyl acetate and petroleum ether at 0.1:1-10: 1; and (2) reversed-phase purification: c₁₈And C₈Reversed phase packing, gradient elution with methanol and acetonitrile 0.1:1-1: 0.1. In some embodiments, the solvent may be removed by evaporation, followed by suction filtration under reduced pressure to provide the compound of formula (112) as a product, which may be used directly in subsequent reactions.

The compound of formula (113) is commercially available or obtained by one skilled in the art using known methods. For example, when R₁、R₂、R₃When both are H, the acyclic dealkalized monomer compound represented by the formula (113) is 3-amino-1, 2-propanediol which is readily commercially available. At this time, the obtained compound of formula (110) has one of the structures shown in formulae (122) to (127).

In some embodiments, the compound represented by formula (110) prepared by the above method has the following structure as represented by one of formula (121) to formula (127):

pharmaceutical composition

In another aspect, the present disclosure provides a pharmaceutical composition comprising the double-stranded oligonucleotide as described above as an active ingredient and a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier may be a carrier conventionally used in the art of double-stranded oligonucleotide administration, such as, but not limited to, magnetic nanoparticles (e.g., Fe-based)₃O₄Or Fe₂O₃Nanoparticles of (a), carbon nanotubes (carbon nanotubes), mesoporous silicon (mesopore silicon), calcium phosphate nanoparticles (calcium phosphate nanoparticles), Polyethyleneimine (PEI), polyamidoamine (pamam) dendrimer), polylysine (L-lysine), PLL), chitosan (chitosan), 1, 2-dioleoyl-3-trimethyolpropane (1, 2-dioleoyl-3-trimethyoronium-propane, DOTAP), poly-D or L-type lactic acid/glycolic acid copolymer (D) glycolic acid copolymer (PEI)&L-lactic/glycolic acid) copolymer, PLGA, poly (2-aminoethylene phosphate), PPEEA, and poly (N, N-dimethylaminoethyl methacrylate), PDMAEMA, and derivatives thereof.

The content of the double-stranded oligonucleotide and the pharmaceutically acceptable carrier in the pharmaceutical composition is not particularly limited, and may be a conventional content of each component. In some embodiments, the weight ratio of siRNA to pharmaceutically acceptable carrier can be 1 (1-500), and in some embodiments, the above weight ratio is 1 (1-50).

In some embodiments, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various formulations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable additional excipients may include at least one of a pH buffer, a protective agent, and an osmotic pressure regulator.

The pH buffer may be a tris hydrochloride buffer at pH 7.5-8.5 and/or a phosphate buffer at pH 5.5-8.5, for example a phosphate buffer at pH 5.5-8.5.

The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose and glucose. The content of the protective agent may be 0.01 to 30% by weight, based on the total weight of the pharmaceutical composition.

The osmotic pressure regulator may be sodium chloride and/or potassium chloride. The content of the osmotic pressure regulator is such that the osmotic pressure of the pharmaceutical composition is 200-700 milliosmol/kilogram (mOsm/kg). The content of the osmolality adjusting agent can be easily determined by the skilled person, depending on the desired osmolality.

In some embodiments, the pharmaceutical composition may be a liquid formulation, such as an injection solution; or can be lyophilized powder for injection, and can be mixed with liquid adjuvant to make into liquid preparation. The liquid preparation can be used for subcutaneous, intramuscular or intravenous injection, and can also be used for spraying administration to the lung or spraying administration to other organ tissues (such as liver). In some embodiments, the pharmaceutical composition is for intravenous administration.

In some embodiments, the pharmaceutical composition may be in the form of a liposomal formulation. In some embodiments, the pharmaceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (which may also be referred to hereinafter as an organic amine), a helper lipid, and/or a pegylated lipid. Wherein the organic amine, helper lipid, and pegylated lipid may be selected from one or more of the amine-containing transfection compounds described in CN103380113A (herein incorporated by reference in its entirety), or a pharmaceutically acceptable salt or derivative thereof, helper lipid, and pegylated lipid, respectively.

In some embodiments, the organic amine may be a compound described in CN103380113A as shown in formula (501) or a pharmaceutically acceptable salt thereof:

wherein:

each one of which is_X101And X₁₀₂Each independently O, S, N-A or C-A, wherein A is hydrogen or C₁-C₂₀A hydrocarbon chain;

each Y and Z is independently C-O, C-S, S-O, CH-OH or SO₂；

Each R₃₀₁、R₃₀₂、R₃₀₃、R₃₀₄、R₃₀₅、R₃₀₆Or R₃₀₇Each independently is hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or linear aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or linear heteroaliphatic group, a substituted or unsubstituted, branched or linear acyl group, a substituted or unsubstituted, branched or linear aryl group, a substituted or unsubstituted, branched or linear heteroaryl group;

x is an integer from 1 to 10;

n₁₀₁is an integer of1 to 3, m₁₀₁Is an integer from 0 to 20, p is 0 or 1; and wherein, when m₁₀₁And when p is 0, R₃₀₂Is hydrogen;

and, if n is₁₀₁Or m₁₀₁Is 2, then R₃₀₃And the nitrogen in formula (501) forms a structure as shown in formula (502) or formula (503):

wherein g, e, and f are each independently an integer of1 to 6, "HCC" represents a hydrocarbon chain, and each x N represents a nitrogen atom shown in formula (501).

In some embodiments, R₃₀₃Is a polyamine. In other embodiments, R₃₀₃Is a ketal. In some embodiments, R in formula (501)₃₀₁And R₃₀₂Each of which is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl group having from 3 to about 20 carbon atoms, such as from 8 to about 18 carbon atoms, and from 0 to 4 double bonds, such as from 0 to 2 double bonds.

In some embodiments, if each of n and m independently has a value of1 or 3, R₃₀₃May be any one of the following formulae (504) to (513):

wherein, in formula (504) -formula (513), g, e and f are each independently an integer of1 to 6, each "HCC" represents a hydrocarbon chain, and each indicates R₃₀₃A possible point of attachment to the nitrogen atom in formula (501), wherein each H at any x position may be replaced to achieve attachment to the nitrogen atom in formula (501).

Among them, the compound represented by formula (501) can be prepared according to the description in CN 1033113A.

In some embodiments, the organic amine is an organic amine according to formula (514) and/or an organic amine according to formula (515):

the helper lipid is cholesterol, cholesterol analogue and/or cholesterol derivative;

the pegylated lipid is 1, 2-dipalmitoyl-sn-glycerol-3-phosphatidylethanolamine-N- [ methoxy (polyethylene glycol) ] -2000.

In some embodiments, the molar ratio between the organic amine, the helper lipid, and the pegylated lipid in the pharmaceutical composition is (19.7-80): (0.3-50), and may be (50-70): (20-40): (3-20), for example.

In some embodiments, the particles of the pharmaceutical composition formed from the double-stranded oligonucleotides of the present disclosure and the amine-containing transfection reagents described above have an average diameter of about 30nm to about 200nm, typically about 40nm to about 135nm, more typically the liposome particles have an average diameter of about 50nm to about 120nm, about 50nm to about 100nm, about 60nm to about 90nm, or about 70nm to about 90nm, e.g., the liposome particles have an average diameter of about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

In some embodiments, the pharmaceutical composition formed from the double-stranded oligonucleotide of the disclosure and the amine-containing transfection reagent described above, the weight ratio (weight/weight ratio) of the double-stranded oligonucleotide to the total lipid (e.g., organic amine, helper lipid, and/or pegylated lipid) is in a range from about 1:1 to about 1:50, from about 1:1 to about 1:30, from about 1:3 to about 1:20, from about 1:4 to about 1:18, from about 1:5 to about 1:17, from about 1:5 to about 1:15, from about 1:5 to about 1:12, from about 1:6 to about 1:12, or from about 1:6 to about 1:10, e.g., the weight ratio of the double-stranded oligonucleotide to the total lipid of the disclosure is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:9, 1:10, 1:11, 1:12, 1:13, and/or 1:14, 1:15, 1:16, 1:17, or 1: 18.

In some embodiments, the pharmaceutical compositions may be sold with the components present separately and may be in the form of a liquid formulation for use. In some embodiments, the pharmaceutical composition of the double-stranded oligonucleotide provided by the present disclosure and the above pharmaceutically acceptable carrier can be prepared according to various known methods, except that the double-stranded oligonucleotide provided by the present disclosure is used to replace the existing double-stranded oligonucleotide; in some embodiments, the preparation may be as follows:

suspending organic amine, auxiliary lipid and polyethylene glycol lipid in alcohol according to the molar ratio, and uniformly mixing to obtain a lipid solution; the amount of alcohol used is such that the total mass concentration of the resulting lipid solution is 2-25mg/mL, for example, 8-18 mg/mL. The alcohol is selected from pharmaceutically acceptable alcohols such as alcohols that are liquid at about room temperature, for example, one or more of ethanol, propylene glycol, benzyl alcohol, glycerol, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400, which may be, for example, ethanol.

The double-stranded oligonucleotide provided by the present disclosure is dissolved in a buffered salt solution to obtain an aqueous solution of the double-stranded oligonucleotide. The concentration of the buffered salt solution is 0.05-0.5M, for example 0.1-0.2M, the pH of the buffered salt solution is adjusted to 4.0-5.5, for example 5.0-5.2, and the buffered salt solution is used in an amount such that the concentration of the double stranded oligonucleotide does not exceed 0.6mg/mL, for example 0.2-0.4 mg/mL. The buffer salt is selected from one or more of soluble acetate and soluble citrate, and can be sodium acetate and/or potassium acetate.

The lipid solution and the aqueous solution of the double-stranded oligonucleotide are mixed, and the resulting mixture is incubated at 40-60 ℃ for at least 2 minutes, for example, 5-30 minutes, to obtain a liposome preparation after incubation. The volume ratio of the lipid solution to the aqueous solution of double-stranded oligonucleotide is 1 (2-5), and may be, for example, 1: 4.

Concentrating or diluting the incubated liposome preparation, removing impurities and sterilizing to obtain the pharmaceutical composition provided by the disclosure, wherein the physicochemical parameters are that the pH value is 6.5-8, the encapsulation rate is not lower than 80%, the particle size is 40-200nm, the polydispersity index is not higher than 0.30, and the osmotic pressure is 250-400 mOsm/kg; for example, the physical and chemical parameters can be pH value of 7.2-7.6, entrapment rate of not less than 90%, particle size of 60-100nm, polydispersity index of not more than 0.20, and osmotic pressure of 300-400 mOsm/kg.

Wherein the concentration or dilution may be performed before, after or simultaneously with the removal of the impurities. The impurities can be removed by various methods, such as by using a cut-phase flow system, a hollow fiber column, and ultrafiltration under 100K Da conditions, wherein the ultrafiltration exchange solution is Phosphate Buffered Saline (PBS) with pH 7.4. The sterilization can be carried out by various methods, for example, by filtration sterilization on a 0.22 μm filter.

siRNA conjugates

In another aspect, the present disclosure provides an siRNA conjugate comprising the double-stranded oligonucleotide described above and a conjugate group attached to the double-stranded oligonucleotide.

In the context of the present disclosure, "conjugated," means that two or more chemical moieties, each having a particular function, are linked to each other in a covalent linkage, unless otherwise indicated; accordingly, "conjugate" refers to a compound formed by covalent linkage between the various chemical moieties. Further, "siRNA conjugates" refer to compounds formed by covalently attaching one or more chemical moieties having a specific function to a double-stranded oligonucleotide. Hereinafter, the siRNA conjugates of the present disclosure are also sometimes simply referred to as "conjugates". More specifically, in the context of the present disclosure, a "conjugate molecule" should be understood as a specific compound that can be conjugated to a double-stranded oligonucleotide by a reaction, ultimately forming an siRNA conjugate of the present disclosure. The type and manner of attachment of the ligand is well known to those skilled in the art and generally functions to bind to a specific receptor on the surface of a target cell and mediate delivery of the ligand-linked double-stranded oligonucleotide to the target cell.

Generally, the conjugate group comprises at least one targeting group that is pharmaceutically acceptable, or further comprises a linker (linker), and the double-stranded oligonucleotide, the linker and the targeting group are linked in sequence. In some embodiments, the targeting group is 1-6. In some embodiments, the targeting group is 2-4. The double-stranded oligonucleotide molecule may be non-covalently or covalently conjugated to the conjugate group, e.g. may be covalently conjugated to the conjugate group. The site of conjugation of the double-stranded oligonucleotide to the conjugate group may be at the 3' end or 5' end of the sense strand of the double-stranded oligonucleotide, at the 5' end of the antisense strand, or within the internal sequence of the double-stranded oligonucleotide. In some embodiments, the site of conjugation of the double-stranded oligonucleotide to the conjugate group is at the 3' end of the sense strand of the double-stranded oligonucleotide.

In some embodiments, the conjugate group may be attached to the phosphate group, the hydroxyl group at the 2' -position, or the base of a nucleotide. In some embodiments, the conjugate group may be attached to the hydroxyl group at the 3' -position, when 2' -5' phosphodiester linkages are used between nucleotides. When a conjugate group is attached to the end of a double-stranded oligonucleotide chain, the conjugate group is typically attached to the phosphate group of the nucleotide; when a conjugate group is attached to the internal sequence of a double-stranded oligonucleotide, the conjugate group is typically attached to a ribose sugar ring or base. Reference may be made to the following connection modes: siRNA conjugates and subsequent assembled tertiary N-acetyl amino acids in vivo in contexts ACS Chemical biology 2015,10(5):1181-7.

The targeting group may be attached to the double-stranded oligonucleotide molecule via a suitable linker, which may be selected by one skilled in the art according to the particular type of targeting group. The type of such linkers, targeting groups, and the manner of attachment to the double-stranded oligonucleotide can be found in the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety. In some embodiments, the double-stranded oligonucleotide and the conjugate group may be linked by acid-labile, or reducible chemical bonds that are degradable under the acidic environment of the cellular endosome, thereby leaving the double-stranded oligonucleotide free. For non-degradable conjugation, the conjugate group can be attached to the sense strand of the double-stranded oligonucleotide, thereby minimizing the effect of conjugation on the activity of the double-stranded oligonucleotide.

In some embodiments, the targeting group can be a ligand conventionally used in the art of siRNA administration. In some embodiments, the targeting group may be selected from one or more of the following ligands formed by targeting molecules or derivatives thereof; such as lipophilic molecules, e.g. cholesterol, bile acids, vitamins (e.g. vitamin E), lipid molecules of varying chain length; polymers, such as polyethylene glycol; sugars such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); ligands for receptors expressed by parenchymal hepatocytes, e.g., aptamers such as asialoglycoprotein, asialoglycoprotein residues, lipoproteins (e.g., high density lipoprotein, low density lipoprotein, etc.), glucagon, neurotransmitters (e.g., epinephrine), growth factors, transferrin, and the like; an antibody; quantum dots; a polypeptide, such as a membrane-penetrating peptide, or a small molecule ligand.

In some embodiments, the targeting group can be a ligand conventionally used in the art of siRNA administration, such as the various ligands described in WO2009082607a2, the entire disclosure of which is incorporated herein by reference.

In some embodiments, at least one or each of said targeting moieties is selected from a ligand capable of binding to a mammalian hepatocyte surface receptor (ASGPR). In some embodiments, each of the targeting groups is independently a ligand that has affinity for asialoglycoprotein receptors on the surface of mammalian liver cells. In some embodiments, each of the targeting groups is independently an asialoglycoprotein or a sugar. In some embodiments, each of the targeting moieties is independently an asialoglycoprotein, such as Asialoglycoprotein (ASOR) or Asialoglycoprotein (ASF). In some embodiments, each of the targeting groups is independently selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, alpha-D-mannofuranose, beta-D-mannofuranose, alpha-D-mannopyranose, beta-D-mannopyranose, alpha-D-glucopyranose, beta-D-glucopyranose, alpha-D-glucopyranose, beta-D-glucopyranose, alpha-D-fructopyranose, alpha-D-galactopyranose, beta-fructooligosaccharides, and beta-fructooligosaccharides, and beta-fructooligosaccharides, beta-fructooligosaccharides, and beta-fructooligosaccharides, alpha-D-galactofuranose, beta-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O- [ (R) -1-carboxyethyl ] -2-deoxy-beta-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4, 6-dideoxy-4-carboxamido-2, 3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, beta-galactofuranose, glucosamine, N-acetyl-galactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-N-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O- [ (R) -1-carboxyethyl ] -2-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4-dideoxy-4-carboxamido-2, 3-O-methyl-D-mannopyranose, D-glucopyranose, beta-galactopyranose, and, N-glycolyl-alpha-neuraminic acid, 5-thio-beta-D-glucopyranose, 2,3, 4-tri-O-acetyl-1-thio-6-O-trityl-alpha-D-glucopyranoside methyl ester, 4-thio-beta-D-galactopyranose, 3,4,6, 7-tetra-O-acetyl-2-deoxy-1, 5-dithio-alpha-D-glucopyranoside ethyl ester, 2, 5-anhydro-D-allositrile, ribose, D-4-thioribose, L-ribose, L-4-thioribose. In some embodiments, at least one or each of the targeting groups is galactose or N-acetylgalactosamine.

In some embodiments, the linker in the siRNA conjugates of the present disclosure has a structure as shown in formula (301):

wherein k is an integer of1 to 3;

L^Ahas a structure containing an amide bond as shown in formula (302), L^BHas a structure shown as a formula (303) and comprises N-acyl pyrrolidine, and L contains carbonyl and oxygen atoms^CIs a linker group based on hydroxymethylaminomethane, dimethylolaminomethane or trimethylaminomethane;

wherein n is₃₀₂、q₃₀₂And p₃₀₂Each independently is an integer from 2 to 6, optionally n₃₀₂、q₃₀₂And p₃₀₂Each independently is 2 or 3; n is a radical of an alkyl radical₃₀₃Is an integer from 4 to 16, optionally n₃₀₃Is an integer of 8 to 12, and is,

indicates the site at which the group is covalently attached.

In the joint, each L^AEach linked to one of said targeting groups via an ether linkage, and via L^COxygen atoms of hydroxy groups in the moiety with L^CAre linked in part by an ether linkage; l is^BBy reacting a carbonyl group of the formula (303) with L^CThe nitrogen atom of the amino group in the moiety forms an amide bond to be linked, and is linked to the siRNA through an oxygen atom in formula (303) to form a phosphate bond or a phosphorothioate bond through the oxygen atom.

In some embodiments, the siRNA conjugates provided by the present disclosure have the structure shown in formula (305):

wherein Nu represents the siRNA provided by the present disclosure.

In some embodiments, the linker in the siRNA conjugates of the present disclosure has a structure represented by formula (306):

wherein n is₃₀₆Is an integer of 0 to 3, each p₃₀₆Independently an integer from 1 to 6,

represents the site of covalent attachment of a group; the linking group forms an ether linkage with the targeting group via an oxygen atom indicated by; the linking group is linked by at least one of the oxygen atoms indicated by #, forming a phosphate bond or a phosphorothioate bond with the siRNA, and the othersThe oxygen atom indicated by #, being bound to a hydrogen atom to form a hydroxyl group, or to C₁-C₃Alkyl groups being linked to form C₁-C₃An alkoxy group;

in some embodiments, the siRNA conjugates of the present disclosure have the structure shown in formula (307):

wherein Nu represents the siRNA provided by the present disclosure.

In some embodiments, the conjugate has a structure represented by formula (308):

in the formula (308),

wherein n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4;

m1, m2 and m3 are independently integers selected from 2 to 10;

R₁₀、R₁₁、R₁₂、R₁₃、R₁₄and R₁₅Each independently is H, or is selected from the group consisting of: c₁-C₁₀Alkyl radical, C₁-C₁₀Haloalkyl and C₁-C₁₀An alkoxy group;

R₃a group of the structure shown in formula a 59:

wherein, E₁Is OH, SH or BH₂Nu is a double-stranded oligonucleotide;

R₂is a straight chain alkylene group of1 to 20 carbon atoms in length, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: c (O), NH, O, S, CH ═ N, S (O)₂、C₂-C₁₀Alkenylene radical, C₂-C10 alkynylene, C₆-C₁₀Arylene radical, C₃-C₁₈Heterocyclylene and C₅-C₁₀A heteroarylene group, and wherein R₂May optionally have a substituent of any one or more of the group consisting of: c₁-C₁₀Alkyl radical, C₆-C₁₀Aryl radical, C₅-C₁₀Heteroaryl group, C₁-C₁₀Haloalkyl, -OC₁-C₁₀Alkyl, -OC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-OH, -OC₁-C₁₀Haloalkyl, -SC₁-C₁₀Alkyl, -SC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-SH, -SC₁-C₁₀Haloalkyl, halogen substituents, -OH, -SH, -NH₂、-C₁-C₁₀alkyl-NH₂、-N(C₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -NH (C)₁-C₁₀Alkyl), cyano, nitro, -CO₂H、-C(O)O(C₁-C₁₀Alkyl), -CON (C)₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -CONH (C)₁-C₁₀Alkyl), -CONH₂，-NHC(O)(C₁-C₁₀Alkyl), -NHC (O) (phenyl), -N (C)₁-C₁₀Alkyl radical C (O) (C)₁-C₁₀Alkyl), -N (C)₁-C₁₀Alkyl group C (O) (phenyl), -C (O) C₁-C₁₀Alkyl, -C (O) C₁-C₁₀Alkylphenyl, -C (O) C1-C₁₀Haloalkyl, -OC (O) C₁-C₁₀Alkyl, -SO₂(C₁-C₁₀Alkyl), -SO₂(phenyl), -SO₂(C₁-C₁₀Haloalkyl), -SO₂NH₂、-SO₂NH(C₁-C₁₀Alkyl), -SO₂NH (phenyl), -NHSO₂(C₁-C₁₀Alkyl), -NHSO₂(phenyl) and-NHSO₂(C₁-C₁₀Haloalkyl);

each L₁Is a straight chain alkylene group of1 to 70 carbon atoms in length, wherein one or more carbon atoms are optionally replaced by one or more selected from the group consisting of: c (O), NH, O, S, CH ═ N, S (O)₂、C₂-C₁₀Alkenylene radical, C₂-C₁₀Alkynylene, C₆-C₁₀Arylene radical, C₃-C₁₈Heterocyclylene and C₅-C₁₀A heteroarylene group, and wherein L₁May optionally have a substituent of any one or more of the group consisting of: c₁-C₁₀Alkyl radical, C₆-C₁₀Aryl radical, C₅-C₁₀Heteroaryl group, C₁-C₁₀Haloalkyl, -OC₁-C₁₀Alkyl, -OC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-OH, -OC₁-C₁₀Haloalkyl, -SC₁-C₁₀Alkyl, -SC₁-C₁₀Alkylphenyl, -C₁-C₁₀alkyl-SH, -SC₁-C₁₀Haloalkyl, halogen substituents, -OH, -SH, -NH₂、-C₁-C₁₀alkyl-NH₂、-N(C₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -NH (C)₁-C₁₀Alkyl), cyano, nitro, -CO₂H、-C(O)O(C₁-C₁₀Alkyl), -CON (C)₁-C₁₀Alkyl) (C₁-C₁₀Alkyl), -CONH (C)₁-C₁₀Alkyl), -CONH₂，-NHC(O)(C₁-C₁₀Alkyl), -NHC (O) (phenyl), -N (C)₁-C₁₀Alkyl radical C (O) (C)₁-C₁₀Alkyl), -N (C)₁-C₁₀Alkyl group C (O) (phenyl), -C (O) C₁-C₁₀Alkyl, -C (O) C₁-C₁₀Alkylphenyl, -C (O) C1-C₁₀Haloalkyl, -OC (O) C₁-C₁₀Alkyl, -SO₂(C₁-C₁₀Alkyl), -SO₂(phenyl), -SO₂(C₁-C₁₀Haloalkyl), -SO₂NH₂、-SO₂NH(C₁-C₁₀Alkyl), -SO₂NH (phenyl), -NHSO₂(C₁-C₁₀Alkyl), -NHSO₂(phenyl) and-NHSO₂(C₁-C₁₀Haloalkyl). M1 represents a targeting group.

Represents the site of covalent attachment of a group;

M₁denotes a targeting group, the definition and alternatives of which are the same as above. In some embodiments, each M is₁Independently selected from one of the ligands having affinity for asialoglycoprotein receptors on the surface of mammalian liver cells.

The skilled person will understand that although for convenience L will be used although₁Is defined as a linear alkylene group, but it may not be a linear group or differ in name, for example, by an amine or an alkenyl group resulting from the above substitution and/or displacement. For purposes of this disclosure, L₁Is the number of atoms in the chain connecting the two attachment points. For this purpose, the ring (e.g., heterocyclylene or heteroarylene) resulting from replacement of a carbon atom of the linear alkylene group is counted as one atom.

When M is₁In the case of ligands having affinity for asialoglycoprotein receptors on the surface of mammalian liver cells, n1 can be an integer from 1 to 3 and n3 can be an integer from 0 to 4 in some embodiments, providing that M is an integer from 0 to 4 in the conjugate₁The number of ligands is at least 2; in some embodiments, n1+ n3 ≧ 2, which can result in M₁The number of ligands is at least 3, such that M₁The ligand binds more readily to the liver surface asialoglycoprotein receptor, thereby facilitating entry of the conjugate into cells by endocytosis. Experiments show that when M is used₁When the number of ligands is more than 3, M₁The increased ease of ligand binding to the liver surface asialoglycoprotein receptor is not significant, and thus, in some embodiments, n1 is1-2, n3 is an integer from 0-1, and n1+ n3 is 2-3.

In some embodiments, when M1, M2, and M3 are independently selected from integers of 2 to 10, a plurality of M may be used₁Spatial position between ligands is adapted to M₁Binding of ligands to the liver surface asialoglycoprotein receptor in order to make the conjugates provided by the present disclosure simpler, easier to synthesize, and/or lower cost, in some embodiments m1, m2, and m3 are each independently integers from 2 to 5, and in some embodiments m 1-m 2-m 3.

It will be understood by those skilled in the art that when R is present₁₀、R₁₁、R₁₂、R₁₃、R₁₄And R₁₅Each independently selected from H, C₁-C₁₀Alkyl radical, C₁-C₁₀Haloalkyl, and C₁-C₁₀One of the alkoxy groups, without altering the properties of the conjugates disclosed herein, can achieve the objectives of the present disclosure. In some embodiments, R₁₀、R₁₁、R₁₂、R₁₃、R₁₄And R₁₅Each independently selected from H, methyl and ethyl. In some embodiments, R₁₀、R₁₁、R₁₂、R₁₃、R₁₄And R₁₅Are all H.

siRNA conjugates provided according to the present disclosure, R₃A group of the structure shown as formula A59, wherein E₁Is OH, SH or BH₂In some embodiments, E is based on considerations of ready availability of starting materials for preparation₁Is OH or SH.

In some embodiments, R₂Is selected to effect attachment to the N atom of the nitrogen-containing backbone to a 59. In the context of the present disclosure, "nitrogen-containing backbone" means a linkage with R₁₀、R₁₁、R₁₂、R₁₃、R₁₄And R₁₅A chain structure in which carbon atoms and N atoms are linked to each other. Thus, R₂May be any linking group capable of linking the a59 group to the N atom on the nitrogen-containing backbone in a suitable manner. In some embodiments, the compositions of the present disclosure are prepared in a process by solid phase synthesisIn the case of siRNA conjugates, R₂The group is required to contain both a linking site to the N atom of the nitrogen-containing backbone and a linking site to R₃The P atom in (a) to which the linking site is attached. In some embodiments, R₂Wherein the site attached to the N atom of the nitrogen-containing backbone forms an amide bond with the N atom, and said site is attached to R₃The site of attachment of the P atom forms a phosphoester bond with the P atom. In some embodiments, R₂Is B5, B6, B5 'or B6':

wherein the content of the first and second substances,

indicating the site of covalent attachment of the group.

q₂Can be an integer from 1 to 10, and in some embodiments, q is₂Is an integer of1 to 5.

L₁Has the effect of mixing M₁Ligands are linked to the N on the nitrogen-containing backbone to provide targeting functions for the siRNA conjugates of the disclosure. In some embodiments, L₁One or more connecting combinations selected from the group of the formulas A1-A26. In some embodiments, L₁A linked combination of one or more selected from a1, a4, a5, a6, A8, a10, a11 and a 13; in some embodiments, L₁A linkage combination of at least 2 selected from a1, a4, A8, a10 and a 11; in some embodiments, L₁At least 2 connecting combinations selected from A1, A8 and A10.

In some embodiments, L₁Can be 3-25 atoms, 3-20 atoms, 4-15 atoms, or 5-12 atoms in length. In some embodiments, L₁The length of (a) is 3,4, 5,6,7,8,9,10, 11, 12, 13, 14, 15,16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms.

In some embodiments j1 is an integer from 2 to 10, and in some embodiments j1 is an integer from 3 to 5. In some embodiments j2 is an integer from 2 to 10, and in some embodiments j2 is an integer from 3 to 5. R' is C₁-C₄In some embodiments, R' is one of methyl, ethyl, and isopropyl. R_aIs one of A27, A28, A29, A30 and A31, and in some embodiments, R_aIs A27 or A28. Rb is C₁-C₅In some embodiments, R_bIs one of methyl, ethyl, isopropyl and butyl. In some embodiments, in formulas A1-A26, the pairs j1, j2, R', R, respectively_a、R_bIs selected to achieve M₁Ligands are attached to N on nitrogen-containing backbones and M is₁The spatial position between the ligands is more suitable for M₁The ligand binds to the hepatic surface asialoglycoprotein receptor.

In some embodiments, the siRNA conjugates of the present disclosure have a structure represented by formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421), or (422):

in some embodiments, the P atom in formula a59 can be attached to any possible position in the siRNA sequence, for example, the P atom in formula a59 can be attached to any one nucleotide of the sense or antisense strand of the siRNA; in some embodiments, the P atom in formula a59 is attached to any one nucleotide of the sense strand of the siRNA. In some embodiments, the P atom in formula a59 is attached to the end of the sense or antisense strand of the siRNA; in some embodiments, the P atom in formula a59 is attached to the end of the sense strand of the siRNA. The end refers to the first 4 nucleotides of the sense strand or the antisense strand from one end thereof. In some embodiments, the P atom in formula a59 is attached to the end of the sense or antisense strand of the siRNA; in some embodiments, the P atom in formula a59 is attached to the 3' end of the sense strand of the siRNA. In the case of the above position of the sense strand linked to the siRNA, upon entry of the conjugate provided by the present disclosure into a cell, upon unwinding, the individual siRNA antisense strand can be released to inhibit target gene expression via the RNAi machinery.

The P atom in formula A59 can be attached to any possible position on a nucleotide in the siRNA, for example, the 5' position of the nucleotide, the 2' position of the nucleotide, the 3' position of the nucleotide, or the base of the nucleotide. In some embodiments, the P atom in formula a59 can be attached to the nucleotide in the siRNA at the 2' position, 3' position, or 5' position by forming a phosphodiester bond. In some embodiments, the P atom in formula a59 is attached to an oxygen atom formed after dehydrogenation of the 3' hydroxyl group at the 3' terminal nucleotide of the siRNA sense strand, or the P atom in formula a59 is attached to a nucleotide by substitution of a hydrogen in the 2' -hydroxyl group of one nucleotide in the siRNA sense strand, or the P atom in formula a59 is attached to a nucleotide by substitution of a hydrogen in the 5' hydroxyl group at the 5' terminal nucleotide of the siRNA sense strand.

In the siRNA or siRNA conjugate, each adjacent nucleotide is connected by phosphodiester bond or phosphorothioate diester bond, non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate diester bond has negative charge, and the non-bridging oxygen atom or sulfur atom in the phosphodiester bond or phosphorothioate diester bond can exist in the form of hydroxyl or sulfhydryl, and hydrogen ions in the hydroxyl or sulfhydryl can be partially or completely replaced by cations. The cation may be any cation, such as a metal cation, ammonium ion NH4⁺One of organic ammonium cations. For solubility enhancement, in some embodiments, the cation is selected from one or more of alkali metal ions, tertiary amine forming ammonium cations, and quaternary ammonium cations. The alkali metal ion may be K⁺And/or Na⁺The cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and/or an ammonium ion formed by N, N-diisopropylethylamine. Thus, the siRNA or siRNA conjugate of the present disclosure may be at least partially present in the form of a salt. In one mode, the non-bridging oxygen or sulfur atoms in the phosphodiester or phosphorothioate linkages are at least partially bound to sodium ions and the sirnas or siRNA conjugates of the present disclosure are present as sodium salts or partial sodium salts.

Preparation of siRNA conjugates of the disclosure

The above-mentioned siRNA conjugates can be synthesized by methods that have been described in detail in the prior art. For example, methods for the preparation of various siRNA conjugates are described in detail in WO2015006740a 2. The siRNA conjugates of the present disclosure are obtained by means well known to those skilled in the art. As a method for preparing the structure of formula (305) is described in WO2014025805A1, Rajeev et al in ChemBiochem 2015,16,903-908 describe the structure of formula (307). Chinese patent application CN110959011A also discloses a method for preparing the siRNA conjugate shown in formula (308) in detail. The contents of the above documents are incorporated herein by reference in their entirety.

The siRNA conjugates of the present disclosure may also be combined with other pharmaceutically acceptable excipients, which may be one or more of a variety of formulations or compounds conventionally employed in the art, the details of which may be found in the description above for the pharmaceutical compositions of the present disclosure.

Nucleotide sequences, double-stranded oligonucleotides, pharmaceutical compositions and uses of siRNA conjugates of the present disclosure

In some embodiments, the present disclosure provides the use of a nucleotide sequence, double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate provided by the present disclosure in the manufacture of a medicament for treating and/or preventing a pathological condition or disease caused by the expression of a specific gene in a cell.

The modified double-stranded oligonucleotides, pharmaceutical compositions and oligonucleotide conjugates provided by the present disclosure can be used to modulate the abnormal expression of various genes, and treat various pathological conditions or diseases caused by the abnormal expression of genes. These genes may be various endogenous genes in the human or animal body, or genes of pathogens which propagate in the human or animal body. Double-stranded oligonucleotides having specific nucleotide sequences and the modification schemes can be designed and prepared based on the mRNA expressed from the target gene. In some embodiments, the mRNA expressed by the target gene is selected from one of the mrnas transcribed from the following genes: ACE2, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO, HAO1 and the like. In some embodiments, the specific gene is selected from the group consisting of HBV gene, ANGPTL3, APOC3 gene, or mRNA expressed by recombinant human hydroxy acid oxidase 1 gene. Accordingly, the disease or condition is selected from diseases or conditions resulting from abnormal gene expression. The disease is selected from chronic liver disease, hepatitis, liver fibrosis disease, liver proliferative disease and dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis.

In some embodiments, the present disclosure provides a method of treating a pathological condition or disease caused by abnormal expression of a specific gene, the method comprising administering to a subject in need thereof an effective amount of a double stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate provided by the present disclosure. In some embodiments, the specific gene is selected from one of the following genes: ACE2, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO, HAO 1. In some embodiments, the specific gene is selected from the group consisting of HBV gene, ANGPTL3, APOC3 gene, or mRNA expressed by recombinant human hydroxy acid oxidase 1 gene. Accordingly, the disease or condition is selected from diseases or conditions resulting from abnormal gene expression. The disease is selected from chronic liver disease, hepatitis, liver fibrosis disease, liver proliferative disease and dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia or atherosclerosis. In some embodiments, the conjugates provided by the present disclosure may also be used to treat other liver diseases, including diseases characterized by unwanted cellular proliferation, hematologic diseases, metabolic diseases, and diseases characterized by inflammation. The proliferative disease of the liver may be a benign or malignant disease, such as cancer, hepatocellular carcinoma (HCC), liver metastasis or hepatoblastoma. The hematologic or inflammatory disease of the liver may be a disease involving coagulation factors, complement-mediated inflammation, or fibrosis. Metabolic disorders of the liver include dyslipidemia and irregularities in glucose regulation. In one embodiment, the disease is treated by administering one or more double-stranded oligonucleotides having high homology to the gene sequences involved in the disease.

In some embodiments, the present disclosure provides a method of inhibiting the expression of a particular gene in a cell, the method comprising contacting the cell with an effective amount of a double-stranded oligonucleotide, a pharmaceutical composition, and/or an siRNA conjugate provided by the present disclosure.

By administering the double-stranded oligonucleotides, pharmaceutical compositions and/or siRNA conjugates of the present disclosure to a subject in need thereof, the prevention and/or treatment of a pathological condition or disease caused by the expression of a particular gene in a cell can be achieved through a mechanism that regulates gene expression. Thus, the double-stranded oligonucleotides, pharmaceutical compositions and/or siRNA conjugates of the present disclosure may be used for the prevention and/or treatment of said pathological conditions or diseases, or for the manufacture of a medicament for the prevention and/or treatment of the pathological conditions or diseases described herein.

The term "administering" as used herein refers to placing a double-stranded oligonucleotide, pharmaceutical composition, and/or siRNA conjugate into a subject by a method or route that results in at least partially positioning the double-stranded oligonucleotide, pharmaceutical composition, and/or siRNA conjugate at a desired site to produce a desired effect. Routes of administration suitable for the methods of the present disclosure include local administration and systemic administration. In general, topical administration results in delivery of more double-stranded oligonucleotide, pharmaceutical composition, and/or siRNA conjugate to a specific site as compared to the subject's entire body; whereas systemic administration results in delivery of the double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate to substantially the entire body of the subject. In view of the present disclosure aimed at providing a means of preventing and/or treating pathological conditions or diseases caused by the expression of specific genes in hepatocytes, in some embodiments, an administration mode capable of delivering drugs to the liver.

Administration to a subject can be by any suitable route known in the art, including but not limited to: oral or parenteral routes, such as intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal and topical (including buccal and sublingual) administration. The frequency of administration may be 1 or more times per day, week, month, quarter, year, or year.

The dosage of the double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate described in the present disclosure may be a dosage that is conventional in the art, and the dosage may be determined according to various parameters, particularly age, weight and sex of the subject. Toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining LD50 (the dose lethal to 50% of the population) and ED50 (the dose that gives rise to 50% of the maximal response intensity in the quantitative response and the dose that gives rise to a positive response in 50% of the subjects in the qualitative response). The range of human doses can be derived based on data obtained from cell culture assays and animal studies.

In administering the double-stranded oligonucleotides, pharmaceutical compositions and/or siRNA conjugates of the present disclosure, for example, for male or female, 6-12 weeks old, 18-25g C57BL/6J or C3H/HeNCrlVr mice, based on the amount of double-stranded oligonucleotide in the double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate: for siRNA conjugates of a double-stranded oligonucleotide and a pharmaceutically acceptable conjugate molecule, the amount of double-stranded oligonucleotide may be from 0.001 to 100mg/kg body weight, in some embodiments from 0.01 to 50mg/kg body weight, in further embodiments from 0.05 to 20mg/kg body weight, in further embodiments from 0.1 to 15mg/kg body weight, and in still further embodiments from 0.1 to 10mg/kg body weight. Such amounts may be preferred when administering the double-stranded oligonucleotides, pharmaceutical compositions and/or siRNA conjugates described in the present disclosure.

In addition, by introducing the double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate of the present disclosure into a cell, it is also possible to achieve the purpose of suppressing the expression of the specific gene in a hepatocyte through an RNAi mechanism. In one embodiment, the hepatocyte is a hepatitis cell, in some embodiments a HEK293A cell or a hepg2.2.15 cell. In some embodiments, the liver cells may be selected from liver cancer cell lines such as Hep3B, HepG2, Huh7, or isolated liver primary cells, in some embodiments, Huh7 liver cancer cells.

The amount of double-stranded oligonucleotide in the double-stranded oligonucleotide, pharmaceutical composition and/or siRNA conjugate provided is readily determined by one skilled in the art based on the desired effect to be obtained by inhibiting the expression of a particular gene in hepatocytes using the methods provided by the present disclosure. For example, in some embodiments, the double-stranded oligonucleotide, pharmaceutical composition, and/or siRNA conjugate is an siRNA conjugate, and the amount of siRNA in the siRNA conjugate provided is an amount such that: it is sufficient to reduce the expression of the target gene and result in an extracellular concentration at the surface of the target cell of 1pM to 1 μ M, or 0.01nM to 100nM, or 0.05nM to 50nM or to about 5 nM. The amount required to achieve this local concentration will vary depending on a variety of factors including the method of delivery, the site of delivery, the number of cell layers between the delivery site and the target cell or tissue, whether the delivery is local or systemic, and the like. The concentration at the delivery site may be significantly higher than the concentration at the surface of the target cell or tissue.

Reagent kit

The present disclosure provides a kit comprising an effective amount of at least one siRNA of the present disclosure, a pharmaceutical composition, and an siRNA conjugate.

In some embodiments, the kits described herein can provide the siRNA, pharmaceutical composition, and/or siRNA conjugate in one container. In some embodiments, a kit described herein may comprise one container providing a pharmaceutically acceptable excipient. In some embodiments, the kit may further comprise other ingredients, such as stabilizers or preservatives and the like. In some embodiments, a kit described herein can comprise at least one additional therapeutic agent in a container other than the container providing the siRNA described herein. In some embodiments, the kit may comprise instructions for mixing the siRNA with a pharmaceutically acceptable carrier and/or adjuvant or other ingredients (if any).

In the kits of the present disclosure, the siRNA and pharmaceutically acceptable carrier and/or adjuvant and the siRNA, pharmaceutical composition and/or siRNA conjugate, and/or pharmaceutically acceptable adjuvant may be provided in any form, such as a liquid form, a dried form, or a lyophilized form. In some embodiments, the siRNA and pharmaceutically acceptable carrier and/or adjuvant and the pharmaceutical composition and/or siRNA conjugate and optional pharmaceutically acceptable adjuvant are substantially pure and/or sterile. In some embodiments, sterile water may be provided in the kits of the present disclosure.

The present disclosure is further illustrated by the following examples, but is not to be construed as being limited thereby.

Examples

Unless otherwise specified, reagents and media used in the following examples are commercially available, and the procedures for nucleic acid electrophoresis, real-time PCR and the like used are carried out by the method described in Molecular Cloning (Cold Spring Harbor LBlaboratory Press (1989)).

HEK293A cells were supplied from the institute of molecular medicine, university of Beijing, nucleic acid technology laboratory, and cultured in DMEM complete medium (Hyclone) containing 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of Streptomycin diabody (Penicillin-Streptomycin, Gibco, Invitrogen) at 37 ℃ in an incubator containing 5% CO 2/95% air.

Unless otherwise indicated, when cells were transfected with each siRNA or siRNA conjugate synthesized below, Lipofectamine TM2000(Invitrogen) was used as a transfection reagent, and the specific procedures were performed according to the instructions provided by the manufacturer.

Unless otherwise stated, the reagent ratios provided below are calculated as volume ratios (v/v).

The animal models used were as follows:

c57BL/6N mice: 6-8 weeks old, purchased from Beijing Wittingle laboratory animal technology, Inc., hereinafter referred to as C57 mouse;

SD rat: provided by Beijing Wittiulihua laboratory animal technology Co., Ltd;

HBV transgenic mice C57 BL/6-HBV: strain name: B6-Tg HBV/Vst (1.28copy, genotype A), available from Wintoda Biotechnology Ltd, Beijing. Selection of COI before experiment>10⁴The mouse of (1.28 copy) hereinafter;

HBV transgenic mice C57BL/6J-Tg (Alb1HBV)44 Bri/J: purchased from the institute of laboratory animals, department of medicine, Beijing university;

HBV transgenic mice: named M-TgHBV and purchased from the animal department of public health centers in Shanghai city, and the preparation method of the transgenic mice is described in Ren J. et al, J.medical virology.2006,78: 551-;

AAV-HBV transgenic mice: AAV-HBV model, rAAV8-1.3HBV, type D (ayw), purchased from Acanthopanax beijing and molecular medicine research institute, Inc., 1X 10, was prepared according to literature methods (Dong Xiao rock et al, Chin J Biotech2010, May 25; 26(5):679-¹²viral genome (v.g.)/mL, lot number 2016123011. Diluted to 5X 10 with sterile PBS before the experiment¹¹v.g./mL. Each mouse is injected with 200. mu.L, i.e. each mouse is injected with 1X 10¹¹v.g. On day 28 post virus injection, all mice were tested for HBsAg and HBV DNA by orbital bleeding (approximately 100 μ L) for serum collection;

low concentration AAV-HBV transgenic mice: essentially the same molding procedure as described above was used except that the virus was diluted to 1X 10 in sterile PBS prior to the experiment¹¹v.g./mL, 100. mu.L virus per mouse, i.e. 1X 10 per mouse¹⁰v.g.；

BALB/c mice: 6-8 weeks old, purchased from Beijing Wittiulihua laboratory animal technology Co., Ltd;

ob/ob mice: 6-8 weeks old, purchased from Calvens laboratory animals, Inc., Changzhou;

human APOC3 transgenic mice: b6; CBA-Tg (APOC3)3707Bres/J, available from Jackson laboratories, USA;

ˉ

Unless otherwise indicated, the following in vivo/in vitro efficacy data are presented as X + -SEM and the data are analyzed using Graphpad prism6.0 statistical analysis software.

Preparation examples 1-48 Synthesis of siRNA conjugates provided by the present disclosure

Following the preparation method described in preparation example 1 of CN110959011A, conjugates 1 to 48 in the following table 2 were prepared, except that the sense strand and the antisense strand of siRNA contained in the siRNA conjugate were respectively as shown in table 2. The sense and antisense strands of the siRNA were synthesized according to the nucleic acid sequences of the siRNA numbered conjugate 1 to conjugate 48 in table 2 below, respectively. The siRNA conjugate was diluted to a concentration of 0.2mg/mL (as siRNA) using ultrapure water (Milli-Q ultrapure water meter, resistivity 18.2 M.OMEGA.. multidot.cm (25 ℃ C.)), and then subjected to molecular weight measurement using a Liquid chromatograph (LC-MS, Liquid Chromatography-Mass. SP1 photometry, available from Waters, Inc., model: LCT Premier). The observed values are consistent with the theoretical values, indicating that the synthesized conjugates 1-48 are double-stranded nucleic acid sequences of the target design. Conjugate 1-48 has the structure shown in formula (403), and conjugate 1-48 contains siRNA having the siRNA sequence corresponding to conjugate 1-48 in table 2.

TABLE 2siRNA sequences in siRNA conjugates

TABLE 3 siRNA sequences in reference siRNA conjugates

Wherein, the capital letters C, G, U, A indicate the base composition of the nucleotide; the lower case letter m indicates that one nucleotide adjacent to the left side of the letter m is a 2' -methoxy modified nucleotide; the lower case letter f indicates that one nucleotide adjacent to the left side of the letter f is a 2' -fluoro modified nucleotide; the lower case letter s indicates that the linkage between two nucleotides adjacent to the left and right of the letter s is a phosphorothioate linkage; the lower case letter d indicates that one nucleotide adjacent to the right side of the letter d is a 2' -deoxynucleotide; the letter combination VP represents one nucleotide vinyl phosphate modified nucleotide adjacent to the right side of the VP; the capital letter P indicates that the adjacent nucleotide on the right side of P is a 5' -phosphate modified nucleotide; (GLY) represents that two nucleotides adjacent to the left and right of (GLY) are linked by an acyclic abasic group represented by formula (A101); (GLY-Ac) represents that two nucleotides adjacent to the left and right of the (GLY-Ac) are linked by an acyclic abasic group represented by formula (A102); (GLY-Ph) two nucleotides adjacent to the (GLY-Ph) on the left and right are linked by an acyclic abasic group represented by formula (A103); (GLY-iBu) represents that two nucleotides adjacent to the left and right of the (GLY-iBu) are linked by an acyclic abasic group represented by formula (A105); (GLY-Cro) represents that two nucleotides adjacent to the left and right of the (GLY-Cro) are linked by an acyclic abasic group represented by formula (A107), and the acyclic abasic group is of S configuration; (GLY-S) represents that two nucleotides adjacent to the left and right of the (GLY-S) are linked by an acyclic abasic group represented by formula (101) in the S configuration; (GLY-R) represents that two nucleotides adjacent to the left and right of the (GLY-R) are linked by an acyclic abasic group represented by formula (101) in the R configuration (GNA) represents a monomer in which a ribose in a nucleotide adjacent to the left side of the GNA is replaced by GNA; (UNA) represents a monomer containing a nucleotide adjacent to the left side of UNA in which ribose has been substituted with UNA.

Comparative preparation examples 1-23 Synthesis of reference siRNA conjugates

Reference siRNA conjugates, which were numbered as negative reference conjugates and reference conjugates 1 to 23 in the above table 3, were prepared according to the preparation method described in preparation example 1 of CN110959011A, except that the sense strand and the antisense strand of siRNA contained in the reference siRNA conjugate are as shown in table 3, and the siRNA sequence in the reference siRNA conjugate NC is a negative control sequence having no significant correlation with a known gene; the siRNA sequences contained in reference conjugates 1-23 are sequences that have the same base sequence as the siRNA sequences in conjugates 1-47 described above, but do not contain acyclic abasic groups. The sense and antisense strands of the siRNA were synthesized according to the siRNA nucleic acid sequences numbered as negative reference conjugates and reference conjugates 1-23, respectively, in table 3. The siRNA conjugate was diluted to a concentration of 0.2mg/mL (as siRNA) using ultrapure water (Milli-Q ultrapure water meter, resistivity 18.2 M.OMEGA.. multidot.cm (25 ℃ C.)), and then subjected to molecular weight measurement using a Liquid chromatograph (LC-MS, Liquid Chromatography-Mass. SP1 photometry, available from Waters, Inc., model: LCT Premier). The observed values are consistent with the theoretical values, indicating that the synthesized negative and reference conjugates 1-23 are double-stranded nucleic acid sequences of the target design. The conjugate siRNA conjugates have the structure shown in formula (403), and the siRNA contained in each reference siRNA conjugate has the siRNA sequences corresponding to the negative reference conjugate or reference conjugates 1 to 23 in table 3, respectively.

Experimental example 1

Inhibitory Activity of the conjugates of the disclosure on off-target sequences of interest in an in vitro psi-CHECK System

In this experimental example, conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 5, conjugate 6, conjugate 7 and conjugate 8 were tested for inhibitory activity against the target sequence in the in vitro psi-CHECK system.

A detection plasmid is constructed according to the method described by Kumico Ui-Tei et al, Functional diagnosis of siRNA sequence by systematic DNA stabilization, modified siRNA with a DNA segment is a power full tool for a large gene sizing with a signaling reduced off-target effect, nucleic Acids Research,2008.36(7),2136-2151, and is co-transfected with a conjugate to be detected into HEK293A cells to reflect the target sequence inhibition activity of siRNA by the expression level of the dual luciferase reporter gene. The method comprises the following specific steps:

[1] construction of detection plasmids

Using psiCHECK^TM-2(Promega^TM) The plasmid constructs a detection plasmid, the plasmid contains a target sequence 1, the target sequence 1 contains a sequence which is complementary with the siRNA antisense strand part in the conjugate to be detected, and the sequence is repeated for 5 times in the target sequence 1, so that the inhibition effect of the conjugate to be detected on the target sequence 1 can reflect the off-target effect degree. That is, the higher the inhibitory effect, the more likely off-target of the conjugate to be tested. Cloning the target sequence 1 and its complementary sequence into psiCHECK^TM-Xho I/Not I site of plasmid 2.

For the siRNA conjugates to be tested, target sequence 1 is shown below:

5'-CTCGAGAAACCGCCCTAGGGACAAGAATTGGAAACCGCCC TAGGGACAAGAATTGGAAACCGCCCTAGGGACAAGAATTGGAAAC CGCCCTAGGGACAAGAATTGGAAACCGCCCTAGGGACAAGAA-3'(SEQ ID NO:131)

[2] transfection

In a complete medium of H-DMEM (HyClone) supplemented with 10% fetal bovine serum (FBS, RMBIO) and 0.2% by volume of Streptomycin diabody (Penicillin-Streptomycin, HyClone), 5% CO was added at 37 deg.C₂HEK293A cells (purchased from Beijing Biotechnology Ltd., Nanjing) were cultured in a 95% air incubator.

HEK293A cells at 8X 10³Inoculating the cells/well into 96-well plate, sucking out the complete culture medium from the culture well when the cell growth density reaches 70% after 16 hr, adding 80 μ L of opti-MEM (GIBCO Co.) into each well, and continuing culturingAnd culturing for 1.5 hours.

Diluting the detection plasmid into 20 mu M stock solution by using PBS; each siRNA conjugate to be tested was formulated separately in PBS into 11 different concentrations of siRNA conjugate working solutions of 4. mu.M, 1. mu.M, 0.25. mu.M, 0.0625. mu.M, 0.015625. mu.M, 0.003906. mu.M, 0.0009765. mu.M, 0.0002441. mu.M, 0.00006104. mu.M, 0.00001526. mu.M and 0.000003815. mu.M (based on the amount of siRNA in the siRNA conjugate). The siRNA conjugates used were conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 5, conjugate 6, conjugate 7 or conjugate 8, respectively, obtained as prepared above.

For each siRNA conjugate, 1A1-1A11 solution was prepared, and each 1A1-1A11 solution contained 1. mu.L of siRNA working solution, 0.05. mu.L of plasmid working solution (containing 10ng of plasmid to be detected) and 8.95. mu.L of Opti-MEM medium at the above 11 concentrations, respectively, in that order.

A solution 1B was prepared containing 0.2. mu.L of Lipofectamine TM2000 and 9.8. mu.L of Opti-MEM medium per 1B solution.

1C solutions were prepared, each 1C solution containing 0.05. mu.L of working solution containing the test plasmid (10 ng) and 9.95. mu.L of Opti-MEM medium.

One part of the 1B solution was mixed with one part of the obtained 1a1-1a11 solution of each siRNA conjugate, respectively, and incubated at room temperature for 20min, respectively, to obtain transfection complexes 1X1-1X11 of each siRNA conjugate.

One 1B solution was mixed with one 1C solution and incubated for 20min at room temperature to give a blank transfection complex 1X 12.

In the culture wells, transfection complexes 1X1-1X11 of each siRNA conjugate were added separately and mixed uniformly in an amount of 20. mu.L/well to give transfection complexes of about 40nM, 10nM, 2.5nM, 0.625nM, 0.15625nM, 0.03906nM, 0.009765nM, 0.002441nM, 0.0006103nM, 0.0001526nM, 0.00003815nM (based on the amount of siRNA in the siRNA conjugates), and transfection complexes 1X1-1X11 of each siRNA conjugate were transfected into 3 culture wells to give cotransfection mixtures containing siRNA conjugates, which were designated as test groups.

In another 3 culture wells, blank transfection complex 1X12 was added in an amount of 20. mu.L/well to obtain a transfection mixture without siRNA conjugate, which was designated as a blank control.

After transfection of the co-transfection mixture with siRNA conjugate and the transfection mixture without siRNA conjugate for 4 hours in culture wells, respectively, each well was supplemented with 100 μ L of H-DMEM complete medium containing 20% FBS. Place 96-well plate in CO₂The incubator continues to incubate for 24 hours.

[3] Detection of

The culture medium in the culture wells was aspirated, and 150. mu.L of Dual-

Mixing the Luciferase reagent and H-DMEM mixed solution (volume ratio is 1:1), fully and uniformly mixing, incubating for 10min at room temperature, transferring 120 mu L of mixed solution to a 96-hole enzyme label plate, and reading the chemiluminescence value (fire) of Firefly in each culture hole on the 96-hole enzyme label plate by using a Synergy II multifunctional enzyme label instrument (BioTek company); then 60 mu.L of Dual-

Stop&

And (3) fully and uniformly mixing the reagents, incubating at room temperature for 10min, and reading chemiluminescence values (Ren) of Renilla in each culture hole on a 96-hole enzyme label plate by using an enzyme label instrument according to the arrangement mode of reading Fin.

Calculating the light-emitting Ratio Ren/Fin of each hole on the 96-hole enzyme label plate, wherein the light-emitting Ratio (test) or Ratio (control) of each test group or control group is the average value of the ratios of the three culture holes; the luminescence Ratio of each test group is normalized by taking the luminescence Ratio of the control group as a reference to obtain Ratio R of Ratio (test)/Ratio (control), so as to represent the relative expression level, namely the residual activity, of the Renilla reporter gene. The inhibition rate of siRNA against the target sequence was (1-R) × 100%.

Log (inhibitor) vs. pressure-Variable slope (four parameters) dose-response curves were functionally fitted using nonlinear regression analysis of Graphpad 5.0 software based on the relative residual activity of Renilla in HEK293A cells after transfection with different concentrations of siRNA to be tested.

Calculating the IC of the target sequence of the siRNA to be detected according to the corresponding function of the fitted dose-effect curve₂₅The value of the function, as follows,

in the formula:

y is the ratio R, the relative residual activity of Renilla,

x is the logarithm value of the concentration of the transfection siRNA,

bot is the Y value at the bottom of the steady state period,

top is the value of Y at the Top of the steady state period,

x 'is the corresponding X value when Y is halfway between the bottom to the top, and HillSlope is the slope of the curve at X'.

From the dose-response curves and the corresponding functions, the corresponding X was determined when Y was 75% (i.e. 75% remaining activity, 25% inhibition)₂₅Value, IC of each siRNA was calculated₂₅ Value 10^ X₂₅(nM) and, correspondingly, IC₂₅The larger the size, the lower the probability of off-target of the conjugate to be tested. The results show that the dose-response curves for conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 5, conjugate 6, conjugate 7 and conjugate 8 show that none of the conjugates 1-8 has an inhibitory activity of more than 25% over the entire range of concentrations tested against the target sequence 1, i.e., none of the disclosed conjugates comprising acyclic abasic groups at various positions in the sequence show a significant off-target effect.

Comparative Experimental example 1

Inhibitory Activity of siRNA conjugates against off-target sequences of interest in an in vitro psi-CHECK System

The off-target sequence inhibitory activity of reference conjugate 1 in the psi-CHECK system in vitro, the IC measured, was tested according to the method of Experimental example 1₂₅The value was 1.145 nM.

Reference conjugate 1 is a conjugate in which the siRNA sequence is identical to conjugates 1-8, but does not contain an acyclic abasic group. As can be seen from the results of experimental example 1 and comparative experimental example 1, reference conjugate 1 showed a certain off-target condition for the off-target sequence; none of the conjugates of the present disclosure containing acyclic abasic groups at different positions in the siRNA antisense strand exhibited any off-target effect. It is demonstrated that the double-stranded oligonucleotides of the present disclosure each have significantly reduced off-target effects by placing an acyclic abasic group in the antisense strand.

Experimental example 2

Inhibitory activity of the siRNA conjugates of the present disclosure on APOC3mRNA in Huh7 cells in vitro.

[1] Cell culture

Huh7 cells (purchased from Beijing Biotech Ltd.) were cultured in DMEM complete medium (Hyclone) containing 10% fetal bovine serum (FBS, Hyclone) at 37 ℃ in the presence of 5% CO₂Culture in 95% air incubator.

[2] Transfection

Huh7 cells were cultured at 1.5X 10⁵The cells/well were plated on 12-well plates, and when the cell growth density reached 40% after 16 hours, the culture wells were completely filled with the medium by aspiration, and 1mL of opti-MEM medium (GIBCO Co.) was added to each well for further culture for 1.5 hours.

Each siRNA conjugate to be tested was formulated individually into siRNA conjugate working solutions at a concentration of 20. mu.M (based on the amount of siRNA in the siRNA conjugate) using PBS. The siRNA conjugates used were conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 5, conjugate 6, conjugate 7 or conjugate 8, respectively, obtained as prepared above.

For each siRNA conjugate, a 2A solution was prepared, each 2A solution containing 3. mu.L of the above siRNA working solution and 97. mu.L of Opti-MEM medium in that order.

2B solutions were prepared containing 2. mu.L of Lipofectamine per 2B solution ^TM2000 and 98. mu.L of Opti-MEM medium.

A2C solution was prepared, each 2C solution containing 100. mu.L of Opti-MEM medium.

One part of the 2B solution was mixed with one part of the obtained 2A solution of each siRNA conjugate, respectively, and incubated at room temperature for 20min, respectively, to obtain transfection complexes 2X1-2X8 of each siRNA conjugate.

One 2B solution was mixed with one 2C solution and incubated for 20min at room temperature to give blank transfection complex 2X 9.

In the culture wells, transfection complexes 2X1-2X8 of each siRNA conjugate were added separately and mixed uniformly in an amount of 200. mu.L/well to obtain transfection complexes with a final concentration of about 50nM each siRNA conjugate (based on the amount of siRNA in the siRNA conjugates), and transfection complexes 2X1-2X8 of each siRNA conjugate were transfected into 2 culture wells to obtain co-transfection mixtures containing siRNA conjugates, which were designated as test groups.

In another 2 culture wells, transfection complex 2X9 was added in an amount of 200. mu.L/well to give a transfection mixture without siRNA conjugate, which was designated as a blank control.

After transfection of the co-transfection mixture with and without siRNA conjugates for 4 hours in culture wells, respectively, each well was supplemented with 1mL of H-DMEM complete medium containing 20% FBS. Place 12 well plate in CO₂The incubator continues to incubate for 24 hours.

[3] Detection of

Subsequently, total RNA in each well cell was extracted using RNAVzol (purchased from wiggles biotechnology (beijing) limited, product number N002) according to the method described in the specification.

For each well, 1. mu.g of total RNA was collected and used as a reverse transcription kit, golden star^TMRT6 cDNA Synthesis Kit (available from New Biotechnology Ltd of Beijing Ongjingkong, cat # TSK301M) provided reagent, wherein Goldnstar was selected^TM Oligo(dT)₁₇As a primer, 20. mu.l of a reverse transcription reaction system was prepared according to the reverse transcription procedure in the kit instructions, and the total RNA of each well cell was subjected to reverse transcription. The reverse transcription conditions were: for each reverse transcription reaction system, the reverse transcription reaction system was incubated at 50 ℃ for 50min, then at 85 ℃ for 5min, and finally at 4 ℃ for 30s, and after the reaction was completed, 80. mu.l of DEPC water was added to the reverse transcription reaction system to obtain a cDNA-containing solution.

For each reverse transcription reaction system, 5. mu.l of the above cDNA-containing solution was used as a template

A qPCR reaction system (20. mu.l) was prepared using the reagents provided by SYBR qPCR Supermix Plus kit (available from near shore protein science and technology Co., Ltd., product No. E096-01B), wherein the PCR primer sequences for amplifying the target gene APOC3 and the reference gene GAPDH are shown in Table 9, and the final concentration of each primer was 0.25. mu.M. And (3) placing each qPCR reaction system on an ABI StepOnePlus Real-Time PCR instrument, amplifying by using a three-step method, wherein the amplification procedure is pre-denaturation at 95 ℃ for 10min, then denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s, and repeating the denaturation, annealing and extension processes for 40 times to obtain a product W containing the amplified target gene APOC3 and the reference gene GAPDH. And (3) incubating the product W at 95 ℃ for 15s, 60 ℃ for 1min and 95 ℃ for 15s in sequence, and respectively collecting the dissolution curves of the target gene APOC3 and the internal reference gene GAPDH in the product W by using a real-time fluorescent quantitative PCR instrument to obtain the Ct values of the target gene APOC3 and the internal reference gene GAPDH.

TABLE 4 primer information

The comparative Ct (delta. Ct) method is adopted to carry out relative quantitative calculation on the target gene APOC3 in each test group, and the calculation method is as follows:

Δ Ct (test group) ═ Ct (test group target gene) -Ct (test group reference gene)

Δ Ct (control group) ═ Ct (control group target gene) -Ct (control group reference gene)

Δ Δ Ct (test group) ═ Δ Ct (test group) — Δ Ct (control group average)

Δ Δ Ct (control group) ═ Δ Ct (control group) - Δ Ct (control group average)

Where Δ Ct (control mean) is the arithmetic mean of Δ Ct (control) for each of the three culture wells of the control. Thus, one Δ Δ Ct value was assigned to each culture well for the test and control groups.

Normalizing the expression level of APOC3mRNA in the test group based on the control group to define the expression level of APOC3mRNA in the blank control group as 100%,

test group APOC3mRNA relative expression level 2^{Δ Δ Ct (test group)}×100％

Test group APOC3mRNA inhibition rate (1-test group APOC3mRNA relative expression level) × 100%

FIG. 1 is a bar graph of the relative expression levels of APOC3mRNA in Huh7 cells after transfection with conjugates 1-8, respectively, of the present disclosure.

Comparative experiment example 2

The inhibitory activity of reference conjugate 1 was tested according to the method of experimental example 2, and the results are shown in fig. 1.

The results in fig. 1 show that the siRNA conjugates of the present disclosure all exhibit no less than 50% APOC3mRNA inhibitory activity at a concentration of 50 nM. In general, the siRNA conjugates of the present disclosure have comparable APOC3mRNA inhibitory activity to the reference conjugate. Of these, reference conjugate 1 showed 67.62% inhibitory activity. Conjugate 1, conjugate 4, conjugate 5, conjugate 7, conjugate 8 showed 55.24%, 59.05%, 53.33%, 60% and 59.05% inhibition of APOC3mRNA, respectively, all with a slightly reduced activity compared to reference conjugate 1. Conjugate 6 showed 65.71% inhibitory activity, i.e. comparable to reference conjugate 1. Whereas conjugate 2 and conjugate 3 showed 71.43% and 77.14% inhibitory activity, respectively, i.e. higher inhibitory activity than reference conjugate 1, especially the inhibitory activity of conjugate 3 was the highest.

From the results of experimental examples 1-2 and comparative experimental examples 1-2, it can be concluded that the antisense strand of siRNA containing different numbers and different positions of acyclic abasic groups not only has significantly reduced off-target effect, but also can maintain high inhibitory activity, and even shows higher target mRNA inhibitory activity than the siRNA conjugate without acyclic abasic groups.

Experimental example 3

Inhibitory Activity of the siRNA conjugates of the present disclosure on off-target sequences of interest in an in vitro psi-CHECK System

The inhibitory activity of the prepared conjugates 6,9 and 10 in the psi-CHECK system in vitro was tested according to the method of experimental example 1, respectively, except that the test was performed using the conjugates 6,9 and 10 instead of the siRNA conjugates tested. Among them, the sirnas in conjugate 6, conjugate 9 and conjugate 10 are sirnas having the same base sequence but different nucleic acid modification schemes. The results are shown in Table 5. The results show that the inhibitory activity of conjugate 6 and conjugate 9 on sequence 1 of interest was above 25% over the entire range of concentrations tested, i.e., conjugate 6 and conjugate 9 showed no significant off-target effect. IC of conjugate 10₂₅The value was 4.409 nM.

Comparative experiment example 3

The prepared reference conjugates 1,2 and 3 were each tested for inhibitory activity in the psi-CHECK system in vitro, as per the method of Experimental example 3. The results are shown in Table 5. Wherein the sirnas in reference conjugates 1 and 2 are sirnas having the same modified base sequence as the sirnas in conjugates 6 and 9, respectively, but do not contain acyclic abasic groups; the bases in the sirnas in reference conjugate 3 and conjugate 10 are both unmodified bases and the base sequences are the same, but the siRNA in reference conjugate 3 does not contain siRNA with acyclic abasic groups.

TABLE 5 IC of conjugates₂₅

Conjugate numbering	IC₂₅(nM)	Conjugate numbering	IC₂₅(nM)
				Conjugate 6	Is free of	Reference conjugate 1	1.145
Conjugate 9	Is composed of	Reference conjugate 2	5.235
				Conjugate 10	4.409	Reference conjugate 3	0.269

As can be seen from the results in table 5, for comparison between conjugates in which the double-stranded oligonucleotide was identical in base arrangement and the remaining modification methods were identical, both reference conjugates 1 and 2, which did not contain an acyclic abasic group, showed significant off-target effect, whereas both conjugates 6 and 9 of the present disclosure did not experience off-target at all concentrations tested; similarly, conjugate 10 of the present disclosure showed significantly lower off-target effects than reference conjugate 3, which did not contain an acyclic abasic group. It can be seen that for double-stranded oligonucleotides with different modification schemes, by providing acyclic abasic groups, the resulting double-stranded oligonucleotides of the present disclosure all have significantly reduced off-target effects.

Experimental example 4

The prepared conjugates 6 and 11 were tested for activity against off-target sequences of interest in an in vitro psi-CHECK system, respectively, as described in Experimental example 1. The results show that the inhibitory activity of both conjugate 6 and conjugate 11 on target sequence 1 is not high enough to calculate the IC₂₅A value of (i), i.e.Neither conjugate 6 nor conjugate 11 showed significant off-target effects.

Comparative experiment example 4

Reference conjugate 1 and reference conjugate 4 were each tested for activity against off-target sequences of interest in an in vitro psi-CHECK system, following the procedure of experimental example 4. The results show that the IC25 values for reference conjugate 1 and reference conjugate 4 were 1.145nM and 2.878nM, respectively, both showing significant off-target effects.

Wherein, the siRNA in the conjugate 6 and the conjugate 11 is siRNA targeting the same segment of target mRNA, but the length of the sense strand is 19 and 21 nucleotides, respectively, and the length of the antisense strand is 21 and 23 nucleotides, respectively. The sirnas in reference conjugates 1 and 4 are sirnas having the same base sequence as conjugate 6 and conjugate 11, respectively. As can be seen from the results of experimental example 5 and comparative experimental example 5, the conjugates of the present disclosure, having acyclic abasic groups, with different sequence lengths, both exhibited significantly reduced off-target effects than the reference conjugate, which did not contain acyclic abasic groups.

Experimental example 5

The prepared conjugates 9,10 and 11 were each tested for inhibitory activity against APOC3mRNA in Huh7 cells in vitro, according to the method of experimental example 2. The results are shown in FIG. 2.

Comparative experiment example 5

The prepared reference conjugates 2,3 and 4 were each tested for inhibitory activity against APOC3mRNA in Huh7 cells in vitro, as per the method of experimental example 2. The results are shown in FIG. 2.

The results in fig. 2 show that at a concentration of 50nM, conjugates 9,10 and 11 of the present disclosure inhibited APOC3mRNA by as much as 65.72%, 67.14% and 73.33%. All showed higher inhibitory activity than reference conjugate 2, reference conjugate 3 and reference conjugate 4. As can be seen from the results of experimental examples 3 to 5 and comparative experimental examples 3 to 5, the siRNA conjugates containing acyclic abasic groups of the present disclosure showed not only significantly lower off-target effects than those of the conjugates not containing acyclic abasic groups, but also further, higher inhibitory activity compared to the reference conjugate.

Experimental example 6

The inhibitory activity of the prepared conjugates 12 to 19 on off-target sequences in the psi-CHECK system in vitro was tested according to the method of Experimental example 1, except that the target sequence 1 was replaced by the target sequence 2, and the target sequence 2 contains a sequence complementary to the siRNA antisense strand portion of the conjugate to be tested, so that the inhibitory effect of the conjugate to be tested on the target sequence 2 reflects the degree of off-target effect. That is, the higher the inhibitory effect, the more likely off-target of the conjugate to be tested.

Target sequence 2:

5'-AAACCGCCCTAGGGACAAGAA-3'(SEQ ID NO:136)

in the detection step, from the dose-effect curve and the corresponding function, the corresponding X is determined when Y is 50%₅₀Value, IC of each siRNA was calculated₅₀ Value 10^ X₅₀(nM), accordingly, IC₅₀The larger the size, the lower the probability of off-target of the conjugate to be tested.

The experimental results show that the inhibitory activity of the conjugates 12-19 of the present disclosure on the target sequence 2 is not high enough to calculate the IC₅₀None of the values of (a) showed a significant off-target effect.

Wherein conjugates 12-19 comprise the same base sequence. The difference is that the siRNAs in conjugates 12, 14, 16 and 18 are siRNAs with acyclic abasic groups having R-configuration at the 6 th, 7 th, 8 th or 6 th and 7 th nucleotides according to the 5 'end to 3' end direction. The sirnas in conjugates 13, 15, 17, and 19 are sirnas having acyclic abasic groups with S-steric configuration at the corresponding positions.

Comparative experiment example 6

The reference conjugate 12 prepared was tested for its inhibitory activity against off-target sequences of interest in an in vitro psi-CHECK system, following the procedure of Experimental example 6. The results show the IC of reference conjugate 12₅₀It was 0.29 nM. Reference conjugate 12 is a conjugate having the same base sequence as conjugates 12-19, but does not contain an acyclic abasic group.

As can be seen from the results of experimental example 6 and comparative experimental example 6, the conjugates of the present disclosure having different numbers of acyclic abasic groups of different steric configurations at different positions all showed significantly reduced off-target effects compared to the conjugates not having acyclic abasic groups. By providing acyclic abasic groups of different configurations, it is further illustrated that various double-stranded oligonucleotides and oligonucleotide conjugates of the present disclosure exhibit similar reduced off-target effects.

Experimental example 7

Conjugates 12-19 of the present disclosure were tested for inhibitory activity against target sequences of interest in Huh7 cells in vitro, as per the method of experimental example 6. The only difference is that target sequence 3 is used instead of target sequence 2:

target sequence 3: 5'-CCCAAUAAAGCUGGACAAGAA-3' (SEQ ID NO: 137);

the target sequence 1 is homologous to a portion of the target mRNA and is completely complementary to the antisense strand of the siRNA conjugate under test, so that the inhibitory effect of each siRNA conjugate on the target sequence 3 is responsive to the inhibitory ability of the APOC3mRNA expressed by the target gene of the siRNA conjugate under test.

IC of conjugates 12-19 determined₅₀The values are shown in Table 6.

Comparative experiment example 7

The inhibitory activity of reference conjugates 12-19 on the target sequence of interest in the psi-CHECK system in vitro was tested as described in Experimental example 7, and the results are shown in Table 6.

TABLE 6 IC of siRNA conjugates₅₀

Preparation example No.	IC₅₀(nM)
		Conjugate 12	0.015nM
Conjugate 13	0.013nM
		Conjugate 14	0.0078nM
Conjugate 15	0.0044nM
		Conjugate 16	0.021nM
Conjugate 17	0.024nM
		Conjugate 18	0.023nM
Conjugate 19	0.022nM
		Reference conjugate 12	0.011

From the results in Table 6 above, it can be seen that conjugates 12-19 all exhibited high APOC3mRNA inhibitory activity, IC₅₀Between 0.0044-0.024 nM.

None of the siRNA conjugates containing an acyclic abasic group of the present disclosure showed a significant decrease in activity compared to siRNA conjugates not containing an acyclic abasic group. Of these, conjugate 12 and conjugate 13 exhibited APOC3mRNA inhibitory activity that was substantially comparable to that of reference conjugate 12. Further, conjugate 14 and conjugate 15 even showed higher inhibitory activity of APOC3mRNA than reference conjugate 12. The results of experimental examples 6-7 and comparative experimental examples 6-7 demonstrate that the double-stranded oligonucleotide conjugates comprising acyclic abasic groups of the present disclosure can substantially maintain inhibitory activity against target mRNA while having significantly reduced off-target effects, and even show further improved inhibitory activity against target mRNA.

Experimental example 8

Conjugates of the present disclosure were tested for inhibitory activity against target sequences in the psi-CHECK system in vitro following the procedure of Experimental example 7, except that for

conjugates

20, 21, 22, 23, 24 and 25, the target sequences used were target sequences 4,5, 6,7,8 and 9:

target sequence 4:

5'-CCCTGAAAGACTACTGGAGCA-3'(SEQ ID NO:138)；

target sequence 5:

5'-GCTTAAAAGGGACAGTATTCT-3'(SEQ ID NO:139)；

target sequence 6:

5'-GGACAGTATTCTCAGTGCTCT-3'(SEQ ID NO:140)；

target sequence 7:

5'-AGTATTCTCAGTGCTCTCCTA -3'(SEQ ID NO:141)；

the target sequence 8:

5'-ACAGTATTCTCAGTGCTCTCC-3'(SEQ ID NO:142)

target sequence 9:

5'-AGGGACAGTATTCTCAGTGCT-3'(SEQ ID NO:143)；

the target sequences 4 to 9 are each homologous to a portion of the target mRNA and are fully complementary to the sequence of the antisense strand of the siRNA conjugate being tested, so that the inhibitory effect of each siRNA conjugate on the corresponding target sequence is responsive to the ability of the siRNA conjugate being tested to inhibit the mRNA expressed by the target gene.

The results of the experiment are shown in Table 7.

Comparative experiment example 8

The inhibitory activity of reference conjugates 6-11 on target sequences of interest in the psi-CHECK system in vitro was determined according to the method of Experimental example 9. For reference conjugates 6,7,8,9,10 and 11, the target sequences used were target sequences 3,4, 5,6,7 and 8, respectively. The results of the experiment are shown in Table 7.

Table 7 IC of siRNA conjugates₅₀

Conjugate numbering	IC₅₀(nM)	Conjugate numbering	IC₅₀(nM)
				Conjugate 20	0.29	Reference conjugate 6	0.27
Conjugate 21	0.032	Reference conjugate 7	0.032
				Conjugate 22	0.29	Reference conjugate 8	0.12
Conjugate 23	0.019	Reference conjugate 9	0.032
				Conjugate 24	0.017	Reference conjugate 10	0.029
Conjugate 25	0.038	Reference conjugate 11	0.089

As can be seen from the results in table 7, the inhibitory activity of the conjugates containing acyclic abasic groups of the present disclosure was not significantly reduced compared to the conjugates having the same sequence and differing only in that they do not contain acyclic abasic groups. Further, conjugate 23, conjugate 24 and conjugate 25, among others, also showed higher inhibitory activity than the reference conjugate. It is demonstrated that the double-stranded oligonucleotides comprising acyclic abasic groups of the present disclosure can substantially maintain the inhibitory activity against the target mRNA while having significantly reduced off-target effects for different base sequences, and can even further enhance the inhibitory activity against the target mRNA.

Experimental example 9

The inhibition rate of the siRNA conjugates of the present disclosure on APOC3mRNA in mouse liver primary cells was determined.

The assay examined the determination of the inhibition rate of the prepared conjugates 21, 23 and 25 on APOC3mRNA in mouse liver primary cells. The method comprises the following specific steps.

Mouse liver primary cells were obtained by extracting fresh liver tissue of APOC3 transgenic mice, inoculating the mouse liver primary cells in a tissue culture dish coated with type I collagen, and culturing in RPMI 1460 medium containing 1 Xdouble antibody and 10% FBS at 37 ℃ in 5% CO₂Incubate in 95% air incubator for 30 min.

The medium was discarded and the density of mouse liver primary cells was adjusted to 2X 10 with opti-MEM⁵cell/mL to obtain a mouse liver primary cell suspension. Subsequent differentiation in 6-well platesAnd respectively adding the obtained mouse liver primary cell suspensions into the culture holes, and inoculating the mouse liver primary cells into the culture holes. The volume of the added mouse liver primary cell suspension is 2 mL/hole, and the number of the mouse liver primary cells is 4 multiplied by 10⁵Cells/well.

Each of the following siRNA conjugates was formulated separately in PBS into 20 μ M siRNA conjugate working solutions, using siRNA conjugates 21, 23 and 25, respectively.

In the culture wells, 5. mu.L of each siRNA conjugate was added separately and mixed uniformly to obtain a test group having a final concentration of siRNA conjugate in each cell well of about 50 nM.

In another 3 culture wells, 5 μ L of PBS solution without siRNA conjugate was added, and the control group was marked as blank.

After transfection mixtures containing siRNA conjugates and transfection mixtures without siRNA conjugates were transfected for 4H in culture wells, each well was supplemented with 1ml of H-DMEM complete medium containing 20% FBS. Place 6 well plate in CO₂The incubator was incubated at 37 ℃ for 24 h.

For each well, 1. mu.g of total RNA was collected and used as a reverse transcription kit, golden star^TMRT6 cDNA Synthesis Kit (available from New Biotechnology Ltd of Beijing Ongjingkong, cat # TSK301M) provided reagent, wherein Goldnstar was selected^TM Oligo(dT)₁₇As a primer, 20. mu.l of a reverse transcription reaction system is configured according to the reverse transcription operation steps in the kit specification, and the total RNA of each well cell is subjected to reverse transcription. The reverse transcription conditions were: for each reverse transcription reaction system, the reverse transcription reaction system is incubated at 50 ℃ for 50min, then at 85 ℃ for 5min, and finally at 4 ℃ for 30s, and after the reaction is finished, 80 μ l of DEPC water is added into the reverse transcription reaction system to obtain a solution containing cDNA.

A qPCR reaction system of 20. mu.l was prepared using reagents supplied by SYBR qPCR Supermix Plus kit (purchased from nearshore protein science and technology Co., Ltd., product No. E096-01B), in which PCR primer sequences for amplifying the target gene APOC3 and the reference gene GAPDH are shown in Table 8, and the final concentration of each primer was 0.25. mu.M. And (3) placing each qPCR reaction system on an ABI StepOnePlus Real-Time PCR instrument, amplifying by using a three-step method, wherein the amplification procedure is pre-denaturation at 95 ℃ for 10min, then denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s, and repeating the denaturation, annealing and extension processes for 40 times to obtain a product W containing the amplified target gene APOC3 and the reference gene GAPDH. And (3) incubating the product W at 95 ℃ for 15s, 60 ℃ for 1min and 95 ℃ for 15s in sequence, and respectively collecting the dissolution curves of the target gene APOC3 and the internal reference gene GAPDH in the product W by using a real-time fluorescent quantitative PCR instrument to obtain the Ct values of the target gene APOC3 and the internal reference gene GAPDH.

TABLE 8 primer information

Δ Δ Ct (test group) ═ Δ Ct (test group) — Δ Ct (control group average)

The expression level of APOC3mRNA in the test group was normalized to the control group, defining 100% of the expression level of APOC3mRNA in the blank control group.

Test group APOC3mRNA inhibition rate (1-test group APOC3mRNA relative expression level) × 100%. The inhibition rate of APOC3mRNA by each siRNA conjugate is summarized in table 9.

Comparative Experimental example 9

The inhibition rates of APOC3mRNA in mouse liver primary cells by the prepared reference conjugates 7, 9 and 11 were examined according to the method of experimental example 9, except that the conjugate working solutions prepared using the reference conjugates 7, 9 and 11, respectively, instead of the siRNA conjugates used were prepared to perform the test.

The inhibition rate of APOC3mRNA by each siRNA conjugate is summarized in table 9. For the same test group siRNA conjugates, the APOC3mRNA inhibition rate is the arithmetic mean of the test group APOC3mRNA inhibition rates determined for three culture wells.

TABLE 9 inhibition of APOC3mRNA in mouse liver primary cells

Conjugate numbering	Inhibition of APOC3 mRNA%
		Conjugate
21	92.08
		Conjugate 23	91.54
Conjugate 25	92.03
		Reference conjugate 7	88.77
Reference conjugate 9	84.34
		Reference conjugate 11	89.77

As can be seen from the results in table 9 and fig. 2, the siRNA conjugates provided by the present disclosure exhibit higher APOC3mRNA inhibitory activity in mouse liver primary cells, and at a siRNA conjugate concentration of 50nM, the inhibition rates of conjugate 21, conjugate 23 and conjugate 25 on APOC3mRNA all reach more than 91.5%, which are all higher than the inhibition rate of the reference conjugate on APOC3 mRNA. Further illustrates that the siRNA conjugate provided by the disclosure can effectively inhibit the expression of APOC3mRNA, thus showing excellent application prospects in treating APOC3 target-related diseases, particularly diseases caused by dyslipidemia.

Experimental example 10

Effect of siRNA conjugates on blood lipid in CBA-Tg (APOC3)3707Bres/J mice this experiment investigated the effect of conjugates 26-30 of the present disclosure on blood lipid levels in mice, with the specific steps as follows:

6-8 week-old CBA-Tg (APOC3)3707Bres/J mice were randomly grouped into 6 mice each, and siRNA conjugates (preparations 27-32) and comparative preparation 1 were administered to each group of mice, respectively, as controls. All animals were dosed by weight and given a single subcutaneous injection, with a siRNA conjugate dose (based on the amount of siRNA) of 3mg/kg and a dosing volume of 5 mL/kg. Each siRNA conjugate was provided in a physiological saline solution, and the drug concentration to be formulated for each siRNA conjugate was calculated based on the administration dose and the administration volume. Mice were bled from the orbital venous plexus on days 8, 15, 22, 29, and 36 before (day 0) and after dosing, and serum blood lipid levels were measured at each time point.

Blood is collected from orbital veins, about 0.1mL each time, serum is obtained by centrifugation, and the serum is obtained after centrifugation. 20ul of serum was diluted 5-fold with PBS/0.9% saline and serum samples were sent to Beijing Dian center for serum Triglyceride (TG) determination.

Normalized blood lipid level ═ (blood lipid content of test group after administration/blood lipid content of test group before administration) × 100%.

The inhibition ratio of blood lipid level is (1-blood lipid content in test group after administration/blood lipid content in test group before administration) × 100%. The results are shown in FIG. 3.

Comparative Experimental example 10

The effects of reference conjugate 5 and negative reference conjugate on blood lipid levels in mice were examined in the same manner as in experimental example 10, respectively, except that the test was performed using reference conjugate 5 or negative reference conjugate, respectively, instead of each siRNA conjugate. The results are shown in FIG. 3.

As can be seen from fig. 3, at the administration dose of 3mg/kg, the inhibition rate of siRNA conjugates 26-30 on triglyceride was consistently maintained above 78% for serum triglyceride levels compared to the negative reference conjugate for up to 36 days after a single administration, which was similar to the inhibition rate of reference conjugate 5 on serum triglyceride at various time points after administration; the maximum inhibition occurred at day 7 post-dose, with conjugate 26 having a triglyceride inhibition of up to 84.63%.

Thus, it is demonstrated that the siRNA conjugates of the present disclosure containing different acyclic abasic groups are all capable of significantly reducing serum triglyceride levels and exhibit substantially the same effect of reducing serum triglyceride levels as compared to conjugates that do not contain acyclic abasic groups.

Experimental example 11

The inhibitory effect of the prepared conjugate 31 on HBV mRNA in the psi-CHECK system in vitro was examined in the same manner as in experimental example 8, except that the conjugate 31 was used instead of the siRNA conjugate used in experimental example 8 for the test.

HEK293A cells used in this example were purchased from Beijing Kogyo Biotech Co., Ltd, and were completely cultured in DMEM containing 10% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of Streptomycin diabody (Penicillin-Streptomycin, Gibco, Invitrogen)Cells were cultured in medium (Hyclone Co.) at 37 ℃ in 5% CO₂Culture in 95% air incubator.

The difference is that the target sequence used is target sequence 10:

target sequence 10: 5'-GACCTTGAGGCATACTTCAAA-3' (SEQ ID NO:148)

The target sequence 10 is homologous to a part of HBV mRNA and is completely complementary to the antisense strand sequence in the detected siRNA, so that the inhibiting effect of the conjugate 31 on the target sequence 10 can reflect the inhibiting ability of the target sequence on HBV mRNA.

The results of final concentrations of siRNA conjugates of 10nM, 3.33nM, 1.11nM, 0.370nM, 0.122nM, 0.0407nM, 0.0136nM, 0.0045nM, 0.00150nM (in terms of amount of siRNA) are summarized in Table 10.

Comparative experiment example 11

The inhibitory effect of reference conjugate 14 on HBV mRNA in psi-CHECK system in vitro was examined in the same manner as in Experimental example 11. The results are summarized in table 10.

TABLE 10 IC of siRNA conjugates₅₀

Where conjugate 31 is a conjugate of the present disclosure containing an acyclic abasic group, reference conjugate 14 is a conjugate having the same nucleotide sequence as conjugate 31, but containing an additional acyclic abasic group.

As can be seen from the results of table 10, conjugate 31 showed significantly higher activity compared to reference conjugate 14, indicating that the double-stranded oligonucleotides comprising acyclic abasic groups of the present disclosure had significantly higher inhibitory activity than other acyclic abasic groups. Therefore, the compound has excellent application prospect in treating HBV related diseases, particularly hepatitis B.

Experimental example 12

The inhibition rate of HAO1mRNA in rat liver primary cells by the prepared conjugate 32 and conjugate 33 was determined in the same manner as in Experimental example 9. The only difference was that the hepatic primary cells used in the assay were taken from SD rats; the sequences of PCR primers for amplifying the target gene HAO1 and the reference gene β -actin are shown in Table 11.

TABLE 11 primer information

The comparative Ct (delta Ct) method is adopted to carry out relative quantitative calculation on the target gene HAO1 in each test group, and the calculation method is as follows:

Δ Δ Ct (test group) ═ Δ Ct (test group) — Δ Ct (control group average)

Where Δ Ct (control mean) is the arithmetic mean of Δ Ct (control) for each of the three control culture wells. Thus, one Δ Δ Ct value was assigned to each culture well for the test and control groups.

Normalizing the expression level of HAO1mRNA in the test group based on the control group to define the expression level of HAO1mRNA in the blank control group as 100%,

test group relative expression level of HAO1mRNA 2^{Δ Δ Ct (test group)}×100％

Test group HAO1mRNA inhibition rate (1-test group HAO1mRNA relative expression level) × 100%.

The results are summarized in table 12.

Comparative Experimental example 12

The inhibition rate of HAO1mRNA in rat liver primary cells was determined for reference conjugate 15 and negative reference conjugate in the same manner as in Experimental example 13. The results are summarized in table 12. For the same test group siRNA conjugates, the HAO1mRNA inhibition rate is the arithmetic mean of the test group HAO1mRNA inhibition rates determined for three culture wells.

TABLE 12 inhibition of HAO1mRNA in rat liver primary cells

Conjugate numbering	Inhibition of HAO1 mRNA%
		Conjugate 32	92.77
Conjugate 33	91.66
		Reference conjugate 15	91.75
Negative reference conjugates	23.28

As can be seen from the results in table 12, the conjugates 32 and 33 of the present disclosure showed higher HAO1mRNA inhibitory activity in rat liver primary cells, and both conjugates 32 and 33 reached over 91.5% inhibition of HAO1mRNA at a siRNA conjugate concentration of 20 nM. Shows comparable or even higher inhibition rates compared to reference conjugate 15. Therefore, the conjugate provided by the disclosure can effectively inhibit expression of HAO1mRNA, and thus shows excellent application prospects in treatment of HAO1 target-related diseases.

Experimental example 13

The determination of the inhibition rate of conjugate 32 against HAO1mRNA in rat liver primary cells was first determined in the same manner as in experimental example 12, except that the concentration of conjugate 32 was 10nM (in terms of amount of siRNA), and RNAseq difference gene statistics were performed, as follows:

RNAseq sequencing analysis is carried out, HAO1mRNA expression data are statistically analyzed, and genes with significantly different expression levels of samples under different states are screened, wherein the experimental steps are as follows:

[1] normalization of the raw readcount (normalization) is mainly done to correct the sequencing depth

[2] Statistical model for calculating hypothesis testing probability

[3] Performing multiple hypothesis test correction to obtain FDR value

And (i) taking (i.e. | log2FC | ≧ 0Q value ≦ 0.05) as a screening standard of the differential gene, and screening the threshold standard.

The measured inhibition rates are summarized in table 13 and the results of RNAseq differential gene statistics are summarized in figure 4.

Comparative Experimental example 13

The inhibition rate of HAO1mRNA and RNA seq difference gene statistics in rat liver primary cells were determined for negative reference conjugate, reference conjugate 15, reference conjugate 16 and reference conjugate 17, respectively, in the same manner as in Experimental example 13. The results are summarized in table 13 and fig. 4, respectively.

TABLE 13 inhibition of HAO1mRNA in rat liver primary cells

Wherein reference conjugates 16 and 17 are conjugates comprising the same nucleotide sequence as conjugate 32, but GNA and UNA, respectively. The results in table 15 show that conjugate 32 and reference conjugates 15-17 exhibit substantially equivalent inhibitory activity at a concentration of 10 nM.

Figure 4 is a bar graph showing the results of RNAseq differential gene analysis of conjugate 32, reference conjugates 15-17 and negative reference conjugates compared to a blank control. As shown in fig. 4, the gene association of conjugate 32 with HAO1mRNA was the highest, and the number of genes affecting non-target gene expression to be significantly up-or down-regulated was significantly reduced compared to the reference conjugates 15-17, and it can be seen that the conjugates containing acyclic dealkalized groups of the present disclosure exhibited significantly reduced off-target effects while having substantially equivalent inhibitory activity, further, compared to conjugates with other acyclic dealkalized groups, or conjugates not containing acyclic dealkalized groups. Thus, it is demonstrated that the siRNA conjugates of the present disclosure comprising acyclic abasic groups have significantly reduced off-target effects while being able to maintain the inhibitory activity of double-stranded oligonucleotides on HAO1 mRNA.

Experimental example 14

The conjugates 34-42 of the present disclosure were tested for their inhibitory activity against off-target sequences of interest in an in vitro psi-CHECK system in the same manner as in Experimental example 1. The difference is that target sequence 11 is used instead of target sequence 1:

target sequence 11:

5'-CTCGAGCTAACCTCTACACAAGAACTATTGGCTAACCTCTACACAAGAACTATTGGCTAACCTCTACACAAGAACTAGCGGCCGC-3'(SEQ ID NO:153)

the target sequence 11 contains a sequence complementary to the antisense strand portion of the siRNA in the conjugate to be tested, and the sequence is repeated 3 times in the target sequence 11, so that the inhibitory effect of the conjugate to be tested on the target sequence 11 reflects the degree of off-target effect. That is, the higher the inhibitory effect, the more likely off-target of the conjugate to be tested.

The results of the experiments show that none of the conjugates 34-42 of the present disclosure have an inhibitory activity against the target sequence 10, i.e., off-target sequence, high enough to allow calculation of the IC₅₀The value is obtained. That is, none of the conjugates 34-42 of the present disclosure exhibited significant off-target effects.

Comparative experiment example 14

The reference conjugate 18 was tested for its inhibitory activity against off-target sequences in the psi-CHECK system in vitro in the same manner as in Experimental example 14, and the IC was determined₅₀The value was 1.76 nM.

Wherein the conjugates 34-42 are conjugates having the same nucleotide base sequence and different numbers and positions of acyclic abasic groups in the antisense strand of the siRNA. And reference conjugate 18 is a conjugate having the same nucleotide base sequence as conjugates 34-42, but containing no acyclic abasic group. As can be seen from the results of experimental example 15 and comparative experimental example 15, the conjugates of the present disclosure containing acyclic abasic groups exhibited significantly reduced off-target effects compared to conjugates not containing acyclic abasic groups. Also, the conjugates of the present disclosure containing different numbers and different positions of acyclic abasic groups all exhibit significantly reduced off-target effects.

Experimental example 15

The inhibitory activity of conjugate 35-42 on ANGPTL3mRNA in Huh7 cells was determined in the same manner as in Experimental example 2, and the results are summarized in Table 14.

Comparative Experimental example 15

The inhibitory activity of reference conjugate 18 on ANGPTL3mRNA in Huh7 cells was determined in the same manner as in experimental example 15, and the results are summarized in table 14.

TABLE 14 ANGPTL3mRNA inhibition Rate of siRNA conjugates

As can be seen from the results in table 14, at a concentration of 50nM, the conjugates 35-42 of the present disclosure all exhibited substantially equivalent inhibition rates of ANGPTL3mRNA as compared to the reference conjugate 18. Still further, conjugates 36, 37, 38, 39 and 42 even showed higher inhibitory activity than reference conjugate 18, especially conjugate 38, showing up to 82.5% inhibitory activity, 28% higher than the reference conjugate. The results of experimental examples 14-15 and comparative experimental examples 14-15 demonstrate that the double-stranded oligonucleotides comprising acyclic abasic groups of the present disclosure not only have significantly reduced off-target effects, but also have inhibitory activity comparable to the corresponding double-stranded oligonucleotides that do not comprise acyclic abasic groups. Even more inhibitory activity against ANGPTL3mRNA was shown.

Experimental example 16

In the same manner as in Experimental example 14, the inhibitory activity of conjugate 39 and conjugates 43 to 45 against off-target sequences in the psi-CHECK system in vitro was determined. The experimental results show that none of the conjugates 43-45 of the present disclosure have an inhibitory activity against target sequence 10 high enough to allow calculation of IC₅₀None of the values of (a) or (b) showed a significant off-target effect.

Comparative Experimental example 16

The inhibitory activity of reference conjugate 18, reference conjugate 19, reference conjugate 20 and reference conjugate 21 on off-target sequences of interest in the psi-CHECK system in vitro was determined in the same manner as in Experimental example 17. The results of the experiment are summarized in table 15.

Table 15 IC of siRNA conjugates₅₀

Conjugate numbering	IC₅₀
		Reference conjugate 18	1.76
Reference conjugate 19	1.04
		Reference conjugate 20	2.67
Reference conjugate 21	0.32

Among them, the sirnas in conjugate 39 and conjugates 43 to 45 are sirnas having the same base sequence but different base sequence modification schemes, and these sirnas contain acyclic abasic groups at the same position in the antisense strand. The sirnas in reference conjugates 18-21 were sirnas having the same base modification scheme as the sirnas in conjugate 39 and conjugates 43-45, respectively, but not containing acyclic abasic groups. The results of table 15 indicate that siRNA conjugates comprising acyclic abasic groups of the present disclosure exhibit significantly reduced off-target effects compared to siRNA conjugates that do not comprise acyclic abasic groups. Further, it is demonstrated that by providing acyclic abasic groups, the disclosed double-stranded oligonucleotides with different base modification schemes all show significantly reduced off-target effects.

Experimental example 17

The inhibitory activity of conjugate 39 and conjugate 46 against off-target sequences of interest in the psi-CHECK system in vitro was determined in the same manner as in Experimental example 16, and the results of the experiment showed that the inhibitory activity of both conjugate 39 and conjugate 46 against target sequence 10 was not so high as to allow calculation of IC₅₀None of the values of (a) showed a significant off-target effect.

Comparative Experimental example 17

The inhibitory activity of reference conjugate 18 and reference conjugate 22 against off-target sequences of interest in psi-CHECK system in vitro, and the IC measured were determined in the same manner as in Experimental example 16₅₀Values were 1.76nM and 1.347nM, respectively.

Wherein the sirnas in conjugate 39 and conjugate 46 are sirnas targeting the same segment of the target mRNA in ANGPTL3mRNA, but with sense strand lengths of 19 and 21, respectively, and antisense strand lengths of 21 and 23, respectively. Reference conjugates 18 and 22 are conjugates having the same nucleotide sequence as conjugate 39 and conjugate 46, respectively, but not containing an acyclic abasic group. The results of Experimental example 18 and comparative Experimental example 18 show that. Double-stranded oligonucleotides comprising acyclic abasic groups of the present disclosure all show significantly reduced off-target effects for oligonucleotide sequences of varying lengths.

Experimental example 18

The inhibitory activity of conjugate 43-46 against ANGTL3 target mRNA in Huh7 cells in vitro was determined in the same manner as in Experimental example 15. The results of the experiment are summarized in table 16.

Comparative Experimental example 18

The inhibitory activity of reference conjugates 19-22 on ANGPTL3 target mRNA in vitro in Huh7 cells was determined in the same manner as in experimental example 18. The results of the experiment are summarized in table 16.

TABLE 16 ANGPTL3mRNA inhibition rates of siRNA conjugates

Conjugate numbering	Inhibition ratio%	Conjugate numbering	Inhibition ratio%
				Conjugate 43	61.5％	Reference conjugate 19	65.5％
Conjugate 44	79.0％	Reference conjugate	20					72.5％
				Conjugate 45	62.5％	Reference conjugate	21		75.5％
Conjugate 46	66％	Reference conjugate 22	74.5％

As can be seen from the results in table 16, the conjugates of the present disclosure all exhibited no less than 60% inhibition of ANGPTL3mRNA at a concentration of 50 nM. No significant reduction in activity occurred compared to the inhibitory activity of the reference conjugates 19-21. Especially conjugate 44, with an inhibition rate as high as 79.0%, showed higher ANGPTL3mRNA activity than the reference conjugates 19-21. As can be seen, the siRNA conjugates comprising acyclic abasic groups of the present disclosure have not reduced inhibitory activity against target mrnas while having significantly reduced off-target effects, and even unexpectedly show higher inhibitory activity against target mrnas.

Experimental example 19

The inhibition rate of ANGPTL3mRNA by conjugate 47 and conjugate 48 of the present disclosure was determined in mouse liver primary cells according to the method of experimental example 9. The only difference was that the concentration of the conjugate tested was 20nM (calculated as siRNA).

The only difference is that mouse liver primary cells were extracted from fresh liver tissue of normal C57BL/6N mice, inoculated with appropriate density of cells in type I collagen-coated glass or plastic coverslips or tissue culture dishes, cultured with RPMI 1460 medium containing 1 Xdouble antibody and 10% FBS at 37 ℃ in 5% CO₂Culturing cells in an incubator with 95% air for 30 min; the sequences of the PCR primers used for amplifying the target gene ANGPTL3 and the reference gene GAPDH are shown in Table 17.

TABLE 17 primer information

The comparative Ct (delta Ct) method is adopted to carry out relative quantitative calculation on the target gene ANGPTL3 in each test group, and the calculation method is as follows:

delta Ct (test group) ═ Ct (test group target gene) -Ct (test group reference gene)

Δ Δ Ct (test group) ═ Δ Ct (test group) — Δ Ct (control group average)

Normalizing the expression level of the ANGPTL3mRNA in the test group based on the control group to define the expression level of the ANGPTL3mRNA in the blank control group as 100%,

test group ANGPTL3mRNA relative expression level 2^{Δ Δ Ct (test group)}×100％

Test group ANGPTL3mRNA inhibition rate (1-test group ANGPTL3mRNA relative expression level) × 100%

The inhibition rate of ANGPTL3mRNA by each siRNA conjugate is summarized in table 18. For the same test group siRNA conjugates, ANGPTL3mRNA inhibition was the arithmetic mean of the test group ANGPTL3mRNA inhibition determined for three culture wells.

Comparative Experimental example 19

The inhibition rate of ANGPTL3mRNA by reference conjugate 23 and negative reference conjugate in mouse liver primary cells was determined in the same manner as in experimental example 19, and the results are shown in table 18.

TABLE 18 inhibition of ANGPTL3mRNA in mouse liver primary cells

Of these, conjugates 47 and 48 are conjugates of the present disclosure containing different acyclic abasic groups, while reference conjugate 23 is a conjugate containing other acyclic abasic groups.

As can be seen from the results in table 18, the siRNA conjugates provided by the present disclosure showed higher ANGPTL3mRNA inhibitory activity in mouse liver primary cells, and at the siRNA conjugate concentration of 20nM, the inhibition rates of conjugate 47 and conjugate 48 on ANGPTL3mRNA were both as high as more than 92%, and were 64.33% and 65.14% higher than that of reference conjugate 23 on ANGPTL3 mRNA. It can be seen that the conjugates of the present disclosure containing acyclic abasic groups have significantly higher inhibitory activity against target mRNA than conjugates containing other acyclic abasic groups.

Therefore, the siRNA conjugate provided by the disclosure can effectively inhibit the expression of ANGPTL3mRNA, so that the siRNA conjugate has an excellent application prospect in treating ANGPTL3 target-related diseases, particularly diseases caused by dyslipidemia.

Experimental example 20

Stability of conjugates 12-19 in vitro lysosomal lysates

Preparation of test samples treated with lysosomal lysis solution: conjugates 12-19 were each provided as a 0.9% aqueous solution of sodium chloride with siRNA concentration of 20. mu.M, 6. mu.l each) and mixed with 27.2. mu.L of an aqueous solution of sodium citrate (pH5.0), 4.08. mu.L of deionized water, and 2.72. mu.L of Tritosomes (commercially available from Xenotech, Inc., Cat. No. R0610LT, Lot. 1610069). Incubation was performed at constant temperature of 37 ℃. Mu.l of each sample was taken at 0h, 1h, 3h and 6h, denatured by adding 15. mu.l of 9M urea, followed by 4. mu.l of 6 Xloading buffer (Solebao, cat. 20160830), and immediately frozen at-80 ℃ in a refrigerator to terminate the reaction. 0 hour represents the time when the sample to be tested is immediately taken out after being mixed with the lysosome lysis solution.

Preparation of reference samples not treated with lysosomal lysate: equimolar amounts of the siRNA conjugates (20. mu.M) 1.5. mu.l each were mixed with 7.5. mu.L of an aqueous sodium citrate solution (pH5.0) and 1. mu.L of deionized water, denatured by adding 30. mu.L of a 9M urea solution, mixed with 8. mu.L of a6 Xloading buffer, and immediately frozen in a freezer at-80 ℃ to terminate the reaction. Each siRNA conjugate reference sample is labeled Con in the electropherogram.

Preparing 16 wt% non-denatured polyacrylamide gel, loading 20 μ l of each of the test sample and the reference sample to the gel, performing electrophoresis under a constant current of 20mA for 10min, and performing electrophoresis under a constant current of 40mA for 30 min. After the electrophoresis was completed, the gel was placed on a shaker and stained with Gelred dye (BioTium Co., Ltd., cat. No. 13G1203) for 10 min. The gel was observed by imaging and photographed, and the results are shown in fig. 5.

Comparative Experimental example 20

The stability of reference conjugate 12 in lysosomal lysates was determined in the same manner as in experimental example 20, and the results are shown in fig. 5.

Figure 5 shows the results of a semi-quantitative determination of the stability of the tested conjugates 12-19 of the present disclosure in vitro lysosomal lysates. The results show that the conjugates of the present disclosure exhibit comparable stability in vitro dissolution compared to the reference conjugate that does not contain the acyclic abasic group. Can be maintained for a long time without degradation.

While the present disclosure has been described in detail with reference to the specific embodiments, the present disclosure is not limited to the details of the embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical spirit of the present disclosure, and the simple modifications are within the scope of the present disclosure.

It should be noted that, in the foregoing embodiments, various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various combinations that are possible in the present disclosure are not described again.

In addition, any combination of various embodiments of the present disclosure may be made, and the same should be considered as the disclosure of the present disclosure, as long as it does not depart from the spirit of the present disclosure.

Sequence listing

<110> Sa Ruibo Biotechnology Ltd

<120> nucleotide sequence, double-stranded oligonucleotide, pharmaceutical composition and conjugate, preparation method and application

<130> CP1211372/CB

<150> CN202011635152.0

<151> 2020-12-31

<160> 155

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 1

cugaaagacu acuggagca 19

<210> 2

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 2

ugcuccguag ucuuucaguu 20

<210> 3

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 3

uuaaaaggga caguauuca 19

<210> 4

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 4

ugaauauguc ccuuuuaagc 20

<210> 5

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 5

acaguauucu cagugcuca 19

<210> 6

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 6

ugagcaugag aauacugucc 20

<210> 7

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 7

uauucucagu gcucuccua 19

<210> 8

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 8

uaggaggcac ugagaauacu 20

<210> 9

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 9

aguauucuca gugcucuca 19

<210> 10

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 10

ugagagacug agaauacugu 20

<210> 11

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 11

ggacaguauu cucagugca 19

<210> 12

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 12

ugcacuagaa uacugucccu 20

<210> 13

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 13

ugcacuagaa uacugucccu 20

<210> 14

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 14

caauaaagcu ggacaagaa 19

<210> 15

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 15

uucuugccag cuuuauuggg 20

<210> 16

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 16

uucuugccag cuuuauuggg 20

<210> 17

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 17

uucuugccag cuuuauuggg 20

<210> 18

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 18

uucuugccag cuuuauuggg 20

<210> 19

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 19

uucuugccag cuuuauuggg 20

<210> 20

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 20

uucuugccag cuuuauuggg 20

<210> 21

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 21

uucuugccag cuuuauuggg 20

<210> 22

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 22

uucuuuccag cuuuauuggg 20

<210> 23

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 23

uucuuuccag cuuuauuggg 20

<210> 24

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 24

uucuugccag cuuuauuggg 20

<210> 25

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 25

uucuugccag cuuuauuggg 20

<210> 26

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 26

uucuugucag cuuuauuggg 20

<210> 27

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 27

uucuugucag cuuuauuggg 20

<210> 28

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 28

uucuuccagc uuuauuggg 19

<210> 29

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 29

uucuuccagc uuuauuggg 19

<210> 32

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 32

ucuuguccag cuuuauuggg 20

<210> 33

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 33

uuuuguccag cuuuauuggg 20

<210> 34

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 34

uucuguccag cuuuauuggg 20

<210> 35

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 35

uucuguccag cuuuauuggg 20

<210> 36

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 36

uucuuuccag cuuuauuggg 20

<210> 37

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 37

uucuugccag cuuuauuggg 20

<210> 38

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 38

uucuugucag cuuuauuggg 20

<210> 39

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 39

uucugccagc uuuauuggg 19

<210> 40

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 40

uucugccagc uuuauuggg 19

<210> 41

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 41

caauaaagcu ggacaagaa 19

<210> 42

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 42

caauaaagcu ggacaagaa 19

<210> 43

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 43

uucuugccag cuuuauuggg 20

<210> 44

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 44

cccaauaaag cuggacaaga a 21

<210> 45

<211> 22

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 45

uucuugccag cuuuauuggg uu 22

<210> 46

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 46

caauaaagcu ggacaagaa 19

<210> 47

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 47

uucuugccag cuuuauuggg 20

<210> 48

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 48

ccuugaggca uacuucaaa 19

<210> 49

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 49

uuugaauaug ccucaagguu 20

<210> 50

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 50

uuugaauaug ccucaagguu 20

<210> 51

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 51

ggacaguauu cucagugca 19

<210> 52

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 52

ugcacuagaa uacugucccu 20

<210> 53

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 53

uuugaguaug ccucaagguu 20

<210> 54

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 54

uuugaauaug ccucaagguu 20

<210> 55

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 55

uuugaagaug ccucaagguu 20

<210> 56

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 56

ugacaaaaua acucacuaua a 21

<210> 57

<211> 22

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 57

uuauaggagu uauuuuguca au 22

<210> 58

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 58

acaaaauaac ucacuauaa 19

<210> 59

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 59

uuauaggagu uauuuuguca 20

<210> 60

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 60

gaaugugaaa gucaucgaca a 21

<210> 61

<211> 22

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 61

uugucgugac uuucacauuc ug 22

<210> 62

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 62

augugaaagu caucgacaa 19

<210> 63

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 63

uugucgugac uuucacauuc 20

<210> 64

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 64

ccaagagcac caagaacua 19

<210> 65

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 65

uguucuuggu gcucuuggcu 20

<210> 66

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 66

uauucuuggu gcucuuggcu 20

<210> 67

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 67

uagucuuggu gcucuuggcu 20

<210> 68

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 68

uagucuuggu gcucuuggcu 20

<210> 69

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 69

uaguuuuggu gcucuuggcu 20

<210> 70

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 70

uaguucuggu gcucuuggcu 20

<210> 71

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 71

uaguucuggu gcucuuggcu 20

<210> 72

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 72

uagucuggug cucuuggcu 19

<210> 73

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 73

uagucuggug cucuuggcu 19

<210> 74

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 74

ccaagagcac caagaacua 19

<210> 75

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 75

ccaagagcac caagaacua 19

<210> 76

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 76

uaguucuggu gcucuuggcu 20

<210> 77

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 77

agccaagagc accaagaacu a 21

<210> 78

<211> 22

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 78

uaguucuggu gcucuuggcu uu 22

<210> 79

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 79

ccaagagcac caagaacua 19

<210> 80

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 80

uaguucuggu gcucuuggcu 20

<210> 81

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 81

uaguucuggu gcucuuggcu 20

<210> 82

<211> 20

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 82

uaguucuggu gcucuuggcu 20

<210> 83

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 83

caauaaagcu ggacaagaa 19

<210> 84

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 84

uucuugucca gcuuuauugg g 21

<210> 85

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 85

caauaaagcu ggacaagaa 19

<210> 86

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 86

uucuugucca gcuuuauugg g 21

<210> 87

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 87

caauaaagcu ggacaagaa 19

<210> 88

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 88

uucuugucca gcuuuauugg g 21

<210> 89

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 89

cccaauaaag cuggacaaga a 21

<210> 90

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 90

uucuugucca gcuuuauugg guu 23

<210> 91

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 91

caauaaagcu ggacaagaa 19

<210> 92

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 92

uucuugucca gcuuuauugg g 21

<210> 93

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 93

cugaaagacu acuggagca 19

<210> 94

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 94

ugcuccagua gucuuucagu u 21

<210> 95

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 95

uuaaaaggga caguauuca 19

<210> 96

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 96

ugaauacugu cccuuuuaag c 21

<210> 97

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 97

acaguauucu cagugcuca 19

<210> 98

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 98

ugagcacuga gaauacuguc c 21

<210> 99

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 99

uauucucagu gcucuccua 19

<210> 100

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 100

uaggagagca cugagaauac u 21

<210> 101

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 101

aguauucuca gugcucuca 19

<210> 102

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 102

ugagagcacu gagaauacug u 21

<210> 103

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 103

ggacaguauu cucagugca 19

<210> 104

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 104

ugcacugaga auacuguccc u 21

<210> 105

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 105

caauaaagcu ggacaagaa 19

<210> 106

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 106

uucuugucca gcuuuauugg g 21

<210> 107

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 107

ggacaguauu cucagugca 19

<210> 108

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 108

ugcacugaga auacuguccc u 21

<210> 109

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 109

ccuugaggca uacuucaaa 19

<210> 110

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 110

uuugaaguau gccucaaggu u 21

<210> 111

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 111

augugaaagu caucgacaa 19

<210> 112

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 112

uugucgauga cuuucacauu c 21

<210> 113

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 113

augugaaagu caucgacaa 19

<210> 114

<211> 24

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<220>

<221> misc_feature

<222> (9)..(9)

<223> n is a, c, g, or u

<400> 114

uugucgagna ugacuuucac auuc 24

<210> 115

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 115

augugaaagu caucgacaa 19

<210> 116

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 116

uugucgauga cuuucacauu c 21

<210> 117

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 117

ccaagagcac caagaacua 19

<210> 118

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 118

uaguucuugg ugcucuuggc u 21

<210> 119

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 119

ccaagagcac caagaacua 19

<210> 120

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 120

uaguucuugg ugcucuuggc u 21

<210> 121

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 121

ccaagagcac caagaacua 19

<210> 122

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 122

uaguucuugg ugcucuuggc u 21

<210> 123

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 123

ccaagagcac caagaacua 19

<210> 124

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 124

uaguucuugg ugcucuuggc u 21

<210> 125

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 125

agccaagagc accaagaacu a 21

<210> 126

<211> 23

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 126

uaguucuugg ugcucuuggc uuu 23

<210> 127

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 127

ccaagagcac caagaacua 19

<210> 128

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 128

uaguucuugg ugcucuuggc u 21

<210> 129

<211> 19

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 129

uucuccgaac gugucacgu 19

<210> 130

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> siRNA

<400> 130

acgugacacg uucggagaac u 21

<210> 131

<211> 127

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 131

ctcgagaaac cgccctaggg acaagaattg gaaaccgccc tagggacaag aattggaaac 60

cgccctaggg acaagaattg gaaaccgccc tagggacaag aattggaaac cgccctaggg 120

acaagaa 127

<210> 132

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 132

gtgaccgatg gcttcagttc 20

<210> 133

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 133

atggataggc aggtggactt 20

<210> 134

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 134

ggtcggagtc aacggattt 19

<210> 135

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 135

ccagcatcgc cccacttga 19

<210> 136

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 136

aaaccgccct agggacaaga a 21

<210> 137

<211> 21

<212> RNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 137

cccaauaaag cuggacaaga a 21

<210> 138

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 138

ccctgaaaga ctactggagc a 21

<210> 139

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 139

gcttaaaagg gacagtattc t 21

<210> 140

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 140

ggacagtatt ctcagtgctc t 21

<210> 141

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 141

agtattctca gtgctctcct a 21

<210> 142

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 142

acagtattct cagtgctctc c 21

<210> 143

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 143

agggacagta ttctcagtgc t 21

<210> 144

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 144

gtgaccgatg gcttcagttc 20

<210> 145

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 145

atggataggc aggtggactt 20

<210> 146

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 146

tgcaccacca actgcttag 19

<210> 147

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 147

ggatgcaggg atgatgttc 19

<210> 148

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 148

gaccttgagg catacttcaa a 21

<210> 149

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 149

cctcactgcc cattgttg 18

<210> 150

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 150

gtgcctttcc tgactccc 18

<210> 151

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 151

ccgtgaaaag atgacccaga t 21

<210> 152

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 152

gccaggtcca gacgcagg 18

<210> 153

<211> 85

<212> DNA

<213> Artificial sequence

<220>

<223> target sequence

<400> 153

ctcgagctaa cctctacaca agaactattg gctaacctct acacaagaac tattggctaa 60

cctctacaca agaactagcg gccgc 85

<210> 154

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 154

gaggagcagc taaccaactt aat 23

<210> 155

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 155

tctgcatgtg ctgttgactt aat 23

<210> 156

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 156

tgcaccacca actgcttag 19

<210> 157

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 157

ggatgcaggg atgatgttc 19

Claims

1. A nucleotide sequence, each nucleotide in the nucleotide sequence being a modified or unmodified nucleotide, wherein the nucleotide sequence comprises a nucleotide sequence I, the nucleotide sequence I is a nucleotide sequence formed by replacing at least one of nucleotides 2 to 8 in the 5 '-end-3' -end direction in a nucleotide sequence a with an acyclic abasic group, the nucleotide sequence a has 16 to 30 nucleotides, and the nucleotide sequence a is reverse complementary to a nucleotide sequence in a target mRNA by at least 14 nucleotides, and the acyclic abasic group has a structure shown in formula (101):

R₄has a structure as shown in formula (202):

Each R₁₀₁Independently selected from H, C₁-C₅Straight chain alkyl, C₁-C₅Alkoxy radical, C₁-C₁₀Acyl radical, C₁-C₅Alkylsulfonyl and C₆-C₁₀Arylsulfonyl group;

R₂₀₁selected from OH or NHR₂₀₂Wherein R is₂₀₂Is selected from the group consisting of H,C₁-C₅Straight chain alkyl, C₁-C₁₀Acyl radical, C₁-C₅Alkylsulfonyl and C₆-C₁₀Aryl sulfonyl group.

2. The nucleotide sequence of claim 1, wherein each R₁₀₁Independently selected from the group consisting of H, methyl, ethyl and methoxy; r₂₀₂Selected from the group consisting of H, C₁-C₅Aliphatic acyl group, C₇-C₁₀Aromatic acyl group, C₁-C₅Alkylsulfonyl and C₆-C₁₀Aryl sulfonyl group.

3. The nucleotide sequence of claim 2, wherein R₂₀₂Selected from the group consisting of acetyl, isobutyryl, benzoyl, p-toluenesulfonyl, levulinyl and crotonyl.

4. The nucleotide sequence of claim 1, wherein the nucleotide sequence a has 19-25 nucleotides.

5. The nucleotide sequence of claim 1, wherein the nucleotide sequence a is reverse complementary to a nucleotide sequence in a target mRNA of at least 16 nucleotides.

6. The nucleotide sequence of claim 1, wherein each n is independently selected from 0 or 1 and m is selected from 1 or 2.

7. The nucleotide sequence according to claim 1, wherein the nucleotide sequence I is a nucleotide sequence in which at least one of nucleotides 3 to 8 in the 5 '-to 3' -terminal direction in the nucleotide sequence a is replaced with an acyclic abasic group.

8. The nucleotide sequence according to claim 7, wherein the nucleotide sequence I is a nucleotide sequence in which at least one of the 6 th, 7 th and 8 th nucleotides in the 5 'to 3' direction in the nucleotide sequence A is replaced with an acyclic abasic group.

9. The nucleotide sequence according to claim 8, wherein the nucleotide sequence I is a nucleotide sequence in which one of the nucleotides at the 6 th, 7 th or 8 th positions in the 5 'to 3' direction in the nucleotide a is replaced with an acyclic abasic group.

10. The nucleotide sequence according to claim 7, wherein the nucleotide sequence I is a nucleotide sequence in which any 2 nucleotides of 4 th, 5 th, 6 th and 7 th nucleotides in the 5 'end-3' end direction in the nucleotide sequence A are replaced by an acyclic abasic group.

11. The nucleotide sequence according to claim 10, wherein the nucleotide sequence I is a nucleotide sequence in which any 1 nucleotide at the 4 th, 5 th or 6 th nucleotide and the 7 th nucleotide in the 5 'end-3' end direction in the nucleotide sequence a are replaced by an acyclic abasic group.

12. The nucleotide sequence of any one of claims 1 to 11, wherein each acyclic abasic group is independently selected from the group consisting of groups a101-a 107:

13. The nucleotide sequence according to any one of claims 1 to 12, wherein each nucleotide in the nucleotide sequence a is a modified nucleotide.

14. The nucleotide sequence of claim 13, wherein the 2 nd, 6 th, 14 th, 16 th or at least two of the 2 nd, 6 th, 8 th, 9 th, 14 th, 16 th nucleotides in the nucleotide sequence a are nucleotides having a fluoro modification at the 2' position of the ribosyl group of the nucleotide in the 5' end-3 ' direction, and the nucleotide sequence I is a nucleotide sequence in which at least one of the 2 nd, 3 th, 4 th, 5 th, 6 th, 7 th or 8 th nucleotides in the 5' end-3 ' direction in the nucleotide sequence a is replaced by an acyclic abasic group.

15. The nucleotide sequence of any one of claims 1-14, wherein each non-fluorinated modified nucleotide is independently selected from one of a nucleotide analog or a nucleotide in which the hydroxyl group at the 2' -position of the ribosyl group of the nucleotide is substituted with a non-fluorine group.

16. The nucleotide sequence of claim 15, wherein the nucleotide in which the hydroxyl group at the 2 '-position of the ribosyl group of the nucleotide is substituted with a non-fluorine group is selected from one of 2' -alkoxy-modified nucleotide, 2 '-substituted alkoxy-modified nucleotide, 2' -alkyl-modified nucleotide, 2 '-substituted alkyl-modified nucleotide, 2' -amino-modified nucleotide, 2 '-substituted amino-modified nucleotide, 2' -deoxynucleotide; the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA and GNA.

17. The nucleotide sequence according to claim 1, wherein the nucleotide sequence consists of the nucleotide sequence I.

18. The nucleotide sequence according to any one of claims 1-17, wherein at least 1 of the phosphate groups in the phosphate-sugar backbone of at least one single strand of the nucleotide sequence is a phosphate group having a modifying group; the phosphate group having a modifying group is a phosphorothioate group in which at least one oxygen atom in a phosphodiester bond in the phosphate group is substituted with a sulfur atom.

19. A double-stranded oligonucleotide comprising a sense strand and an antisense strand, said antisense strand having the nucleotide sequence of any one of claims 1-18; the sense strand is a nucleotide sequence of 16-30 nucleotides that is at least partially reverse complementary to the antisense strand to form a double-stranded region.

20. The double stranded oligonucleotide of claim 19, wherein the antisense strand is substantially reverse complementary or substantially reverse complementary to the sense strand.

21. The double stranded oligonucleotide of claim 20, wherein at least 16 nucleotides of nucleotides 2 to 19 of the nucleotide sequence a are complementary to the sense strand in the 5 'end to 3' end direction.

22. The double stranded oligonucleotide of claim 21, wherein the 7 th, 8 th, or 5 th, 7 th, 8 th, 9 th, or 9 th, 10 th, 11 th nucleotide of the sense strand is a nucleotide having a fluoro modification at the 2' position of the ribosyl group of the nucleotide, and each nucleotide at other positions of the sense strand is independently one of the non-fluoro modified nucleotides.

23. The double stranded oligonucleotide of any one of claims 19-22, wherein at least 1 of the phosphate groups in the phosphate-sugar backbone of at least one of the sense and antisense strands is a phosphate group with a modifying group; the phosphate group having a modifying group is a phosphorothioate group in which at least one oxygen atom in a phosphodiester bond in the phosphate group is substituted with a sulfur atom.

24. The double stranded oligonucleotide of any one of claims 19-23, wherein the double stranded oligonucleotide is a saRNA or siRNA.

25. The double stranded oligonucleotide of claim 24, wherein the target mRNA is selected from one of the mrnas expressed by: ACE2, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO, HAO 1.

26. The double stranded oligonucleotide of claim 25, wherein the target mRNA is selected from one of the mrnas expressed by: HBV, ANGPTL3, APOC, C5 or HAO 1.

27. The double-stranded oligonucleotide of claim 25, wherein the double-stranded oligonucleotide is selected from the group consisting of HBOO 1, siAPO, siAPOa1M1SVP, siAPOb1M1SVP, siAPOc1M1SVP, siAPOd1M1SVP, siAPOe1M1SVP, siAPOf1M1SP, siAPOg1M1 SP-Ac, siAPOg1M1 SP-Ph, siAPOg1M1 SP-TOS, siAPOg1M1 SP-iBu, siAPOg1M1 SP-Las, siAPOg1M1 SP-Cro, siOg 1M1SVP1, siAPOg1M1SVP1, siAPAPOp 1, siAPOg1M1SVP1, siAPOg1M1SVP1, 1 APOcg 1-APOcg 1,1 APOcg 1 APGa 1 APOcg 1,1 APGa 1-APGa, 1-SVP, 1-H, 1-APs-1-APs-1-Ga, 1-APs-1-Ga 1-H, 1-APs-1-H, HBS-1-APs-Ga, HBS, APs, HBS 1-Ga 1-APs-1-APs, APs-1-APs, APs-1-Ga 1-H, APs-1-APs-1-P, APs-1-P, APs-1-P, APs-1-P, APs-1-APs, APs-P1-P, APga, HBP 1-P1-P, APs, APga, APs 1-P, APga, APs-1-P1-APGa 1-APGa 1-APga, HBP, APGa 1-APsP 1-APs, APsP 1-APGa 1-APsAPsP 1-APs-1-P, HBP 1-P1-APs-APsP, HBP 1-APs-P1-P1-APs, APsP 1-P1-APGa 1-P, APs-P1-P, APGa 1-P1-APs-P1, HBP 1-P1-APs-P1-P, APs-P1-P1-APGa 1-P1-APs-P1-APGa 1, APGa 1-P1, HBP 1-P1, APs-P1, HBP 1-P1, APs 1-P.

28. A pharmaceutical composition comprising the nucleotide sequence of any one of claims 1 to 18 and the double stranded oligonucleotide of any one of claims 19 to 27 and a pharmaceutically acceptable carrier.

29. An siRNA conjugate comprising a double stranded oligonucleotide of any one of claims 19 to 27 and a conjugate group conjugated to the double stranded oligonucleotide.

30. The siRNA conjugate of claim 29, wherein said conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and wherein said double-stranded oligonucleotide, said linker and said targeting group are covalently or non-covalently linked in that order.

31. The siRNA conjugate of claim 29 or 30, wherein each of said targeting groups is independently a ligand that has affinity for asialoglycoprotein receptors on the surface of mammalian hepatocytes.

32. The siRNA conjugate of claim 31, wherein each targeting group is independently an asialoglycoprotein or a saccharide.

33. The siRNA conjugate of claim 32, wherein at least one or each of said targeting groups is galactose or N-acetylgalactosamine.

34. Use of the nucleotide sequence of any one of claims 1-18, the double stranded oligonucleotide of any one of claims 19-27, the pharmaceutical composition of claim 28, and/or the siRNA conjugate of any one of claims 29-33 for the manufacture of a medicament for the treatment and/or prevention of a disease or condition resulting from abnormal gene expression.

35. A method of treating and/or preventing a disease or condition caused by abnormal gene expression, wherein the method comprises administering an effective amount of the double stranded oligonucleotide of any one of claims 19-27, the pharmaceutical composition of claim 28, and/or the siRNA conjugate of any one of claims 29-33 to a subject having a disease or condition caused by abnormal gene expression.

36. A method of inhibiting gene expression in a cell, the method comprising contacting the cell with an effective amount of the double stranded oligonucleotide of any one of claims 19-27, the pharmaceutical composition of claim 28, and/or the siRNA conjugate of any one of claims 29-33.

37. A kit comprising a double stranded oligonucleotide according to any one of claims 19 to 27, a pharmaceutical composition according to claim 28 and/or an siRNA conjugate according to any one of claims 29 to 33.