CN114672544A - Method for removing DNA pollution in nucleic acid amplification - Google Patents

Abstract

The invention belongs to the field of biotechnology, and particularly relates to a method for removing DNA (deoxyribonucleic acid) pollution in nucleic acid amplification. The invention discloses a method, which comprises the following steps: comprises the following steps: a. adding DNase I enzyme into the PCR mixed reagent; b. incubating the mixture of step a; c. inactivating the DNase I enzyme activity in the mixed solution; d. PCR amplification; the PCR mixed reagent is a composition except for a template, and the composition comprises buffer solution, salt, DNA polymerase, dNTP, water for PCR and primers. The method can efficiently remove various types of DNA pollution in the PCR amplification process, does not influence the sensitivity of amplification and the base composition of subsequent products, effectively solves the problem of pollution of PCR products or genome DNA, plasmids and the like in the gene amplification process in the SSO-PCR process, and has no influence on subsequent hybridization reaction.

Description

Method for removing DNA pollution in nucleic acid amplification

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to a method for removing DNA (deoxyribonucleic acid) pollution in nucleic acid amplification.

Background

The nucleic acid detection reaction has the biggest characteristics of larger amplification capacity and extremely high sensitivity, but is easy to be polluted in the operation process, and false positive can be caused by extremely trace pollution. Therefore, decontamination of PCR laboratories becomes an important task for laboratory safety management and quality control.

At present, a PCR laboratory generally selects disinfectants containing chlorine, peroxides and the like to ensure that nucleic acid pollution of air, equipment surfaces, working tables, ground and the like in the laboratory is eliminated to a certain extent, but the effect of thorough elimination is difficult to achieve; in addition, the disinfectants have certain toxic action on human bodies and certain corrosion action on instruments and equipment in laboratories.

An anti-contamination system consisting of UNG enzyme (Uracil-N-Glycosylase) and dUTP was used: the kit was hot started using UNG and Taq enzymes and dUTP was substituted for dTTP in the kit, so that the PCR products were all DNA strands containing dU. Adding 50 ℃ of heat preservation step before PCR starts, UNG enzyme can degrade uracil base in existing U-DNA pollutants in a reaction system, and DNA chain is broken under the condition of subsequent denaturation step, so that amplification caused by polluted DNA is eliminated, and specificity and accuracy of an amplification result are guaranteed. Simultaneously, UNG enzyme is inactivated, and the newly amplified product U-DNA can not be degraded. However, UNG enzyme and dUTP can only prevent the generation of pollution of the type of PCR amplification product, and cannot solve the problem of the generation of pollution of the type of genome template; the use of UNG enzyme and dUTP anti-pollution amplification system leads the product to contain U but not T, the use of PCR product containing dUTP has great influence on the subsequent hybridization experiment, and the potential energy of the bond between A ═ T and A ═ U is different, so the hybridization process is greatly different, and the PCR product is not suitable for the subsequent hybridization reaction experiment. Therefore, a solution is needed which does not affect the amplification and prevents the generation of contamination, and which does not affect the subsequent hybridization reaction.

Disclosure of Invention

The invention aims to provide a solution which can prevent pollution from being generated without influencing amplification and has no influence on subsequent hybridization reaction.

The invention discloses a method for removing DNA pollution in nucleic acid amplification, which comprises the following steps:

a. adding DNase I enzyme into the PCR mixed reagent;

b. incubating the mixture of step a;

c. inactivating the DNase I enzyme activity in the mixed solution;

d. PCR amplification;

the PCR mixed reagent is a composition except for a template, and comprises but is not limited to buffer solution, salt, DNA polymerase, dNTP, water for PCR and primers.

The present invention uses DNase to remove DNA contamination from PCR compositions outside of the template, especially very trace amounts of DNA contamination in PCR laboratories, such as aerosol contamination, contrary to the standard practice in the art, but unexpectedly, the use of DNase eliminates detectable nucleic acid contaminants and does not affect subsequent hybridization experiments, affecting the sensitivity of detection, after heat inactivation of DNase.

In a preferred embodiment, the DNase enzyme is DNaseI, and the final concentration of the DNase enzyme is 3.1-25U/μ l, wherein the DNase enzyme is preferably 6-8U/μ l, and more preferably 5U/μ l;

in a preferred embodiment, the incubation is at 37 ℃ for 10 to 30 minutes, wherein the incubation is preferably at 37 ℃ for 15 minutes;

in a preferred embodiment, the inactivation is at least 8 minutes at 75 ℃ to 90 ℃, wherein preferably 10 minutes at 85 ℃;

in a preferred embodiment, the method further comprises treatment of the PCR with water: DNaseI is added into water for PCR, and the final use concentration of DNaseI is 1-2 multiplied by 10⁵U/μl，Mg²⁺2-10 mM, incubating for 60-120 min at 37 ℃, and then completely inactivating for 3-20 min at 99 ℃;

in a preferred embodiment, the PCR is performed using water for primer and/or probe preparation;

in a preferred embodiment, in step a, the PCR mix reagents and DNase I formulation are as follows:

PCR reaction system

DNase I formula:

the storage solution is as follows: 20mM sodium acetate (pH 6.5), 5mM CaCl₂0.1mM PMSF, 50% glycerol;

15KU of DNase I powder was weighed, and 1.5ml of the above stock solution was added thereto, followed by dilution to 1X 10⁵U/ul mother liquor;

in another preferred embodiment, the method further comprises a PCR amplification step.

a) Before amplification, all components except template DNA are prepared, the components are subpackaged into each PCR tube according to the amount of 23ul per reaction, the PCR tubes are flicked by fingers to enable the liquid to completely wet the whole PCR tube wall, the PCR tubes are placed on a PCR instrument after instantaneous centrifugation, and the temperature is set to 37 ℃ for 15min, 85 ℃ for 10min and 4 ℃ plus infinity;

b) the PCR tube was removed from the PCR machine and 20ng/ul of template (2 ul) was added to the system, and at least 3 NC controls without template were set for each PCR reaction to detect contamination, followed by amplification according to the following procedure.

The method can efficiently remove various types of DNA pollution in the PCR amplification process, does not influence the sensitivity of amplification and the base composition of subsequent products, effectively solves the problem of pollution of PCR products or genome DNA, plasmids and the like in the gene amplification process in the SSO-PCR process, and has no influence on subsequent hybridization reaction.

Drawings

FIG. 1 is a photograph of an electrophoretogram of PCR treated with DNase I at various concentrations.

FIG. 2 is an example of a different process PCR electropherogram.

FIG. 3 is a PCR system pretreatment 10min PCR electrophoresis image at 37 ℃.

FIG. 4 shows PCR electrophoretograms of 37 ℃ for 10min and 85 ℃ for different times.

FIG. 5 is a PCR electrophoresis image of the DNA after inactivation at 85 ℃ for 10min after treatment at 37 ℃.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out according to conventional conditions or according to conditions recommended by the manufacturers. Unless otherwise indicated, percentages and parts are by weight.

As used herein, "DNA" refers to various forms of deoxyribonucleic acid known in the art, such as genomic DNA, cDNA, isolated nucleic acid molecules, vector DNA, and chromosomal DNA. "nucleic acid" refers to any form of DNA or RNA. Examples of isolated nucleic acid molecules include, but are not limited to, recombinant DNA molecules contained in a vector, recombinant DNA molecules maintained in a heterologous host cell, partially or substantially purified nucleic acid molecules, and synthetic DNA molecules. Generally, an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5 'and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. In addition, an "isolated" nucleic acid molecule, such as a cDNA molecule, is typically substantially free of other cellular material or culture medium when prepared by recombinant techniques, or free of chemical precursors or other chemical reagents when chemically synthesized.

As used herein, "incubation" refers to a state in which controlled conditions, such as temperature, are maintained over a period of time.

As used herein, "enzyme that digests DNA" refers to nucleases that degrade double-and single-stranded DNA into single nucleotides or small fragments that do not produce any meaningful interference in the desired reaction. For example, deoxyribonucleases (dnases), such as DNase I, produce polynucleotides that terminate in a 5 'phosphate, having a free hydroxyl group at the 3' position, by hydrolyzing the phosphodiester bond of DNA (usually on the phosphodiester bond proximal to the pyrimidine nucleotide).

As used herein, "dnase" refers to any enzyme that degrades DNA. The DNase enzyme may be an endonuclease that cleaves within a polynucleotide strand, e.g. a restriction endonuclease, an exonuclease that uses the free ends of polynucleotides to degrade DNA molecules. The enzyme that digests DNA can be inactivated by heating at a temperature of at least 75 ℃, as used herein, ribonuclease I.

As used herein, "nuclease" refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of a nucleic acid. The term "nuclease-free" refers to a nuclease that has no activity or very low nuclease activity.

As used herein, "PCR mix reagents" are compositions other than templates, including but not limited to buffers, salts, DNA polymerase, dntps, water for PCR, primers and or probes.

As used herein, "inactivation" refers to destroying the catalytic activity of an enzyme such that the enzyme function becomes non-functional. Various methods of enzyme inactivation include, but are not limited to, denaturing techniques such as thermal, chemical or radiological methods. The inactivation of the nuclease may also comprise removing the enzyme from the reaction tube in which the enzymatic activity occurs. e.g.DNase I enzyme activity decreases by about at least 60% after 10 minutes at 75 ℃ and is essentially inactivated after 20 minutes.

As used herein, beads refer to magnetic beads or non-magnetic beads, made of various materials, on which DNase or ribonuclease proteins can be bound by physical or chemical means.

As used herein, "device" refers to test tubes, microcentrifuge tubes, pipettes, pipette tips, and materials that come into contact with nucleic acids for analysis, separation, and purification of nucleic acids.

As used herein, "polymerase chain reaction" or PCR is the amplification of nucleic acids, consisting of the following steps: an initial denaturation step which separates strands of the double-stranded nucleic acid sample and then allows specific annealing of the amplification primers to flanking positions of the target sequence by repeating (i) the annealing step; (ii) an extension step, which extends The primers in The 5 'to 3' direction thus forming an amplicon polynucleotide complementary to The target sequence, and (iii) a denaturation step, which causes The amplicon to separate from The target sequence (edited by Mullis et al, The Polymerase Chain Reaction, birk hauser, Boston, Mass. (1994). each of The above steps can be performed at different temperatures, preferably using an automated thermal cycler (Applied Biosystems LLC, Life Technologies Corporation, Foster City, a division of ca.). PCR methods can also include reverse transcriptase-PCR and other reactions following The PCR principle, if desired, by methods known to those skilled in The art.

As used herein, "amplification" refers to a broad technique of linearly or exponentially increasing polynucleotide sequences. Exemplary amplification techniques include, but are not limited to, PCR or any other method that employs a primer extension step. Other non-limiting examples of amplification include, but are not limited to, Ligase Detection Reaction (LDR) and Ligase Chain Reaction (LCR). The amplification method may include thermal cycling or may be performed isothermally. In various embodiments, the term "amplification product" includes products from any number of amplification reaction cycles.

In certain embodiments, the amplification method comprises at least one amplification cycle, such as, but not limited to, the following continuous processes: hybridizing a primer to a primer-specific portion of the target sequence or amplifying a product from any number of amplification reaction cycles; synthesizing a strand of nucleotides in a template-dependent manner using a polymerase; and denaturing the newly formed nucleic acid duplex to separate the strands. The cycle may or may not be repeated.

There are many known methods of amplifying nucleic acid sequences, including, for example, PCR. See, e.g., PCR Technology: principles and Applications for DNA Amplification (editors h.a. erlich, Freeman Press, NY, n.y., 1992); PCR Protocols: a guides to Methods and Applications (eds. Innis et al, Academic Press, San Diego, Calif., 1990); mattila et al, Nucleic Acids Res.19, 4967 (1991); eckert et al, PCR Methods and Applications 1, 17 (1991); PCR (compiled McPherson et al, IRL Press, Oxford); and U.S. patent nos. 4,683,202, 4,683,195, 4,800,1594,965,188, and 5,333,675, each of which is incorporated herein by reference in its entirety for all purposes.

Nucleic acid amplification techniques are traditionally categorized according to the temperature requirements of the amplification method. Isothermal amplification is performed at a constant temperature, as opposed to amplification that requires cycling between high and low temperatures. Examples of isothermal amplification techniques are: strand Displacement Amplification (SDA; Walker et al, 1992, Proc. Natl. Acad. Sci. USA 89: 392396; Walker et al, 1992, Nuc. acids. Res.20: 16911696; and EP 0497272, all of which are incorporated herein by reference), autonomous sequence replication (3 SR; Guatelli et al, 1990, Proc. Natl. Acad. Sci. USA 87: 18741878), Q.beta. replicase systems (Lizardi et al, 1988, Biotechnology 6: 11971202), and WO 90/10064 and WO 91/03573.

Examples of amplification techniques that require temperature cycling are: polymerase chain reaction (PCR; Saiki et al, 1985, Science 230: 13501354), ligase chain reaction (LCR; Wu et al, 1989, Genomics 4: 560569; Barringer et al, 1990, Gene 89: 117122; Barany, 1991, Proc. Natl. Acad. Sci. USA 88: 189193), transcription-based amplification (Kwoh et al, 1989, Proc. Natl. Acad. Sci. USA 86: 11731177) and restriction amplification (us patent No. 5,102,784).

Other exemplary techniques include Nucleic Acid Sequence-Based Amplification ("NASBA"; see U.S. Pat. No. 5,130,238), Q.beta.replicase system (see Lizardi et al, Biotechnology 6: 1197(1988)), and Rolling Circle Amplification (see Lizardi et al, Nat Genet 19: 225232 (1998)). The amplification primers of the present invention can be used to perform, for example, but not limited to, PCR, SDA or tSDA. Any of the amplification techniques and methods disclosed herein can be used to carry out the claimed invention, as understood by one of ordinary skill in the art.

The words "preferred" and "preferably" refer to particular embodiments of the invention that may provide certain benefits under certain circumstances. However, other embodiments may be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.

The term "comprising" and variants thereof have no limiting meaning where these terms appear in the description and claims.

Also herein, the recitation of numerical ranges by endpoints includes all numbers subsumed within that range. The term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements.

PCR reagents for isolating, purifying and analyzing target DNA nucleic acids are not free of trace amounts of contaminating nucleic acids and/or microbial cell DNA from bacteria used to prepare the reagents including, but not limited to, polymerases, nucleases, primers and probes, etc. and/or DNA from contamination in primer and probe synthesis.

None of the components is guaranteed by the supplier that the reagents they provide are free of microorganisms or nucleic acids (cell and/or nucleic acids), it is possible that each component may contain trace amounts of microbial cells or microbial nucleic acids.

In one aspect, PCR cocktail reagents containing DNA contaminants are treated with enzymes that digest DNA alone or in the presence of Mn^{2 +}、Ca²⁺And Mg²⁺At least one of the ions is treated with an enzyme that digests DNA. The selection of divalent cations and concentrations can be adjusted based on the composition of the PCR mixture and the type of DNA digesting enzyme used. Enzymes that digest DNA are known to those skilled in the art and include, but are not limited to, natural, synthetic, and chemically modified DNase enzymes (DNase enzymes).

The nuclease is a DNase enzyme or a ribonuclease. Nucleases can be isolated from most organisms and can be prepared using recombinant techniques known to those skilled in the art. DNase degrades DNA and ribonuclease degrades RNA. For each variation and choice, the method of action and the reaction conditions depend on the desired result, as known to those skilled in the art. There are two types of DNase enzymes: DNase I and DNase II. DNase enzyme I has a near neutral pH optimum and an obligatory requirement for divalent cations and produces a free 5' phosphate deoxynucleotide product. DNase II has an acidic pH optimum, can be activated by divalent cations and produces free 3' phosphate deoxynucleotides when hydrolysing DNA. Reagents for PCR will be treated with DNase I as understood by those skilled in the art.

To perform the step of DNA digestion, a solution containing DNase enzyme or DNase enzyme-coated beads is added to the sample to be treated (exemplary samples include, but are not limited to, components for a reagent mixture, a reagent mixture or a device such as a centrifuge tube) so that the solution/sample mixture contains the required reagents for digesting contaminating DNA in the final sample. DNase at concentrations of at least 0.005U, at least 0.01U, at least 0.015U, at least 0.02U, 0.025U and 0.03U/. mu.L or thereabouts is used to digest contaminating DNA at concentration levels of at least 10pg, at least 15pg, at least 20pg and at least 25 pg/. mu.L. An exemplary DNase enzyme at a final concentration of 0.02U/. mu.L digests contaminating DNA in the resulting mixture at 20 pg/. mu.L. The mixture is then incubated for a sufficient length of time. The larger the amount of nuclease added, the shorter the incubation time, and conversely, the smaller the amount of DNase enzyme added to the sample to be purified, the longer the incubation time required to completely degrade contaminating nucleases. The incubation period at a temperature between at least 35 ℃ and at least 40 ℃ may be in the range of at least 5 to at least 60 minutes. The DNA digesting enzymes may then be inactivated as known to those skilled in the art, including but not limited to, by methods of heating (e.g., at least 75 ℃ for 5 minutes) or by methods of separating DNase enzyme coated beads by column filtration, centrifugation, or magnetic separation. Thus, the person skilled in the art can conclude that: after digestion with the DNase enzyme, the DNase enzyme is inactivated or removed again, after which there is no significant residual nuclease activity, which is an important factor for the reagents or devices used for the nuclease treatment in the subsequent reactions.

In a specific embodiment, DNase enzymes such as DNase I enzyme may be inactivated with heat after treating the reagents for PCR. Optionally, the PCR cocktail of reagents may also be sonicated to lyse the microorganisms to release their nucleic acids prior to treatment with the DNase enzyme or with multiple DNase enzymes, ribonucleases or a combination of DNase and ribonucleases.

In one embodiment, the disclosed DNA decontamination method exposes the PCR master mix, sample preparation materials (e.g., nucleic acid purification beads), and device to DNaseI enzyme treatment. The DNase I enzyme is then inactivated by heat treatment of the thus DNase I enzyme treated reagents and materials after DNase I enzyme treatment or a method of separating DNase I enzyme coated beads from the decontaminated reagents. The PCR mixture may also be sonicated to lyse residual or contaminating microorganisms to release their nucleic acids prior to DNase I enzyme treatment. The PCR mixture may also be heat treated to degrade the microbial RNA.

In another embodiment, the DNase enzyme of the invention may be a DNase enzyme or a combination of DNase enzyme, ribonuclease may be added in solution or bound to an insoluble matrix or solid support such as beads selected from magnetic beads, non-magnetic beads, glass beads or cellulose beads. The immobilized nuclease can be removed by filtration, centrifugation or magnetic separation. Alternatively, the nuclease may be inactivated by heating followed by incubation. The resulting nuclease-free reagent, mixture, composition or device has insignificant residual nuclease activity and is not expected to interfere with subsequent analysis of nucleic acids by molecular biological methods.

There are several advantages to using immobilized DNase or ribonuclease enzymes in nuclease treatment methods to remove unwanted DNA and RNA, respectively. The immobilized nuclease can be easily removed from the reaction mixture, thus resulting in better control and rapid termination of the nuclease reaction with less risk of contamination by residual nuclease in the treated reagent. The immobilized enzyme can be reused and has enhanced stability compared to free nuclease in solution.

The nuclease may be attached to the solid support using immobilization chemistry known to those skilled in the art, depending on the nuclease and solid support selected. There are many exemplary supports and methods known for attaching nucleases, including but not limited to, for example, nylon and polystyrene. See, e.g., (P.Michalon, J.Roche, R.Couthorier, G.Favre-Bonvin and C.Marion, Enzyme Microb.Technol.15(1993), p.215-221), e.g., paramagnetic cellulose particles, see, e.g., B.Rittich, et al, J.Chromatogr.B (2002) 77: 25-31), such as SEPHAROSE, see for example (a.f.m.moorman, f.lamie and l.a.grivell, FEBS lett.71(1976), p.67-72.) such as porous glass, see for example (a.r.neurath and h.h.wetall, FEBS Lett. (1970), 8: 253- & lt256-), e.g., a communicative interaction medium monolithic support, see, e.g., (M Bencina, et al, (2008) Methods Mol biol.421: affinity Chromatography: methods and Protocols, second edition, M, Zachariou, Humana Press, Totowa, p257-274), for example by immobilising DNase enzymes via methacrylate-supported epoxy groups, see e.g. m.bencina et al, j.chromatography a, (2005), 1065: 83-91, and, for example, ribonuclease-immobilized polymer brushes, see, for example, s.p. cullen et al, (2008) Langmuir 24: 913-920. Each of the cited documents is incorporated herein by reference in its entirety.

A filter column containing immobilized DNase enzyme porous glass beads can be prepared according to the method described by Neurath et al (A.R. Neurath and H.H.Weetall, FEBS Lett.8(1970), p.253-256). 0.25g to 3.4g of DNase enzyme glass derivative was packed into a disposable chromatography column (Cat. No. 96010 or 96020, BioRad Laboratories, Richmond, Calif.). The temperature of the column was maintained at 37 ℃. Exemplary reagents for decontamination, such as PCR master mix, are recirculated through the DNase enzyme glass derivative at a rate between 0.1 and 1.9 mL/min to allow DNA digestion by the immobilized DNase I enzyme. The PCR master mix was recovered 60 minutes after the treatment.

Similarly, the use of ribonucleases in any form is also required in the present disclosure for the removal of contaminating RNA molecules, such as but not limited to, target nucleic acid samples, reagents and equipment for RNA isolation and PCR reaction mixtures and components thereof. In a specific embodiment, the ribonuclease is immobilized on a solid support including, but not limited to, an insoluble matrix, column, bead, tube, etc., and is separated from the purified solution after RNA digestion by filtration, centrifugation, magnetic separation, etc.

Example 1 experiment using concentration ranges for DNase I

1.1 Experimental materials

The primer sequence is as follows:

HLA-B-Exon3-F：CCGGGGCCAGGGTCTCAC

HLA-B-Exon3-R：CCATCCCCGGCGACCTATAGGAG

1.2 Experimental part

First, 20mM sodium acetate (pH 6.5), 5mM CaCl was prepared₂0.1mM PMSF, 50% glycerol DNase I stock solution.

Ii, preparing DNase I diluent: before dilution, 50ul of 1M MgCl was taken₂Then 4950ul DNase stock solution was added, shaken well and mixed to be diluted as a diluent. DNase I was then diluted as in the table below.

The enzyme activity of the DNase I enzyme mother liquor is 1 multiplied by 10⁷U/uL, firstly using DNase I diluent to perform 4 continuous 10-fold gradient dilutions on the mother liquor, respectively marking as 2, 3, 4 and 5, wherein the enzyme activities after dilution are respectively:

1：1×10⁷U/uL (mother liquor)

2：1×10⁶U/μL

3：1×10⁵U/μL

4：1×10⁴U/μL

5：1×10³U/μL

Then, 6 continuous 2-fold gradient dilutions are carried out on the mother liquor by using DNase I diluent, wherein the dilutions are respectively marked as 6, 7, 8, 9, 10 and 11, and the enzyme activities after dilution are respectively as follows:

6：5×10²U/μL

7：2.5×10²U/μL

8：1.25×10²U/μL

9：0.625×10²U/μL

10：0.3125×10²U/μL

11：0.1562×10²U/μL

12: only dilute liquid

13: by ddH₂O substitute diluent

Iii, preparing a PCR reaction system

A first system:

components	Volume (μ l)
		Genext Buffer	20.3
B-Exon2-F(10μM)	0.6
		B-Exon2-R(10μM)	0.6
ddH2O	0.1
		Thermo Taq(5U/μL)	0.4

Then adding the diluted DNase I into PCR tubes according to 1 to 12, wherein each tube has 1 ul; 1ul ddH was added to the tube numbered 13₂And O is placed on a PCR instrument, and is reacted for 10min at 37 ℃ and then for 5min at 95 ℃ for direct denaturation annealing extension.

And a second system:

components	Volume (μ l)
		Genext Buffer	20.3
B-Exon2-F(10μM)	0.6
		B-Exon2-R(10μM)	0.6
ddH2O	0.1
		Thermo Taq(5U/μL)	0.4
Template (20ng/ul, human genome DNA)	2

Then adding the diluted DNase I into a PCR tube according to 1 to 12, reacting at 37 ℃ for 10min and then at 95 ℃ for 5min, and directly performing denaturation annealing extension, wherein each tube has 1 ul.

Iv, the amplification procedure is as follows:

1.3 results: the results of electrophoresis are shown in FIG. 1 and Table 1

TABLE 1

Therefore, the amount of the DNase I added is between 5 and 8 bands, namely the DNase I is more suitable when the DNase I is added into a PCR reaction system with the enzyme activity of between 500U/L and 62.5U/L and between 1ul and 20ul, and the working concentration is equivalent to between 25U/L and 3.1U/L.

Example 2 experiment of DNase I treatment of PCR Water

2.1 materials of the experiment

Same as example 1

2.2 Experimental part

I, Water treatment

A50 ml centrifuge tube was first filled with 100ul DNase I (10000U/ml) and 100ul 1M MgCl₂Adding 9800ul of ultrapure water, and subpackaging into 1.5ml centrifuge tubes, wherein each tube is 1.7ml, and the number of each tube is 1-5; then placing the water on a metal bath at 37 ℃ for heating for 120min, then placing the water on another metal bath for reaction at 99 ℃ for 20min for complete inactivation, and then using water in 1-5 tubes to dilute the primers and serve as water for PCR;

ii, PCR reaction System

Experiment group one: (No DNase group was added to PCR System) (1-8)

The PCR reaction system is firstly split into 10 PCR tubes, the PCR tubes are inverted from top to bottom, the liquid in the PCR tubes completely wets the tube walls, a small centrifugal machine is used for instant centrifugation and then placed on a PCR instrument for reaction at 37 ℃ for 15min, and then 20ng/ul of Template 2ul is added into three PC groups;

experiment group two: (DNase group was added to PCR System) (9-16)

Firstly, the PCR reaction system is subpackaged into 10 PCR tubes, the PCR tubes are inverted from top to bottom, and the liquid in the PCR tubes completely wets the tube walls; then placed on a PCR instrument to react for 10min at 37 ℃, and then 20ng/ul of Template 2ul is added into two PC groups;

experiment group three: complete DNase removal

Firstly, the PCR reaction system is subpackaged into 8 PCR tubes, the PCR tubes are inverted from top to bottom, and the liquid in the PCR tubes completely wets the tube walls; adding 20ng/ul of Template to two of the PC groups;

the three groups of PCR reaction systems are firstly subpackaged into 8 PCR tubes, each tube has 18ul, the PCR tubes are inverted from top to bottom, liquid in the PCR tubes completely wets the tube walls, a small centrifugal machine is used for instantly centrifuging and then is placed on a PCR instrument for reaction at 37 ℃ for 15min, and then 20ng/ul of Template 2ul is added into three PCR tube groups;

iii, amplification procedure as follows:

2.3 results: the electrophoresis results are shown in FIG. 2 and Table 2

TABLE 2

I, group one and group two-to-two comparison, which proves that adding 100U/l DNase I into a PCR system can eliminate pollution without influencing PC amplification, and the group two method can be popularized for group one and group three comparison and treated by using DNase I;

ii, the amplification water can reduce pollution to a certain extent.

Example 3

3.1 Experimental materials

Same as example 1

3.2 Experimental part

When DNase I is used for treating a PCR amplification system, the phenomenon that a positive strip is not amplified and is not bright occasionally is found when pollution is completely eliminated, and the phenomenon that amplification is polluted occurs when the positive strip is completely bright, so that the DNase I digestion and inactivation steps before PCR amplification are optimized, and the conditions are as follows:

components	Volume (μ l)
		Genext Buffer	20.3
B-Exon2-F(10μM)	0.6
		B-Exon2-R(10μM)	0.6
DNase I(1000U/μL)	1.2
		ddH2O	0.1
Thermo Taq(5U/μL)	0.4

Before amplification, all components except template DNA are prepared, the components are subpackaged into each PCR tube according to the amount of 23ul of each reaction, the PCR tubes are flicked by fingers to enable the liquid to completely wet the wall of the whole PCR tube, and then the following experimental groups are respectively arranged:

experiment group one: treating at 37 deg.C for 10min, and at 85 deg.C for 3min/6min/10 min; at 4 ℃, +/-infinity;

experiment group two: treating at 37 deg.C for 5/10/15/20min, and at 85 deg.C for 10 min; at 4 ℃ + ∞;

then adding template DNA into one tube, and amplifying according to an SSO amplification program;

3.3 results

Before optimization: the PCR system is pretreated at 37 ℃ for 10min, although the contamination is completely removed, the PC amplification is not bright, and some wells cannot be amplified, as shown in FIG. 3 (in the figure, the electrophoresis channel marks NTC in the lanes other than PC) and Table 3.

TABLE 3

PC	NTC	NTC	NTC	PC	NTC	NTC	NTC	PC	NTC	NTC	NTC
													1	1	2	3	2	4	5	6	3	7	8	9
-	-	-	-	+	-	-	-	++++	-	-	-

Optimization 1: inactivation at 37 ℃ for 10min, set at 85 ℃ for 3min, 6min, after 10min, PC bands were bright, but some pore contamination was still present (fig. 4 and table 4);

TABLE 4

And (3) optimizing 2: after inactivation at 85 ℃ for 10min at 37 ℃ for 5min, 10min, 15min and 20min, the electrophoresis results are shown in FIG. 5 (in the figure, the electrophoresis channel is marked with NTC as the other lanes except PC) and tables 5 and 6, and the comparison result shows that at least 15min is needed at 37 ℃.

TABLE 5

TABLE 6

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the specific embodiments described above, and that various changes or modifications may be made by one skilled in the art within the scope of the appended claims without departing from the spirit of the invention.

Claims (10)

1. A method for removing DNA contamination in nucleic acid amplification, comprising the steps of:

a. adding DNase I enzyme into the PCR mixed reagent;

b. incubating the mixed solution of the step a;

c. inactivating the DNase I enzyme activity in the mixed solution;

d. PCR amplification;

the PCR mixed reagent is a composition except for a template, and the composition comprises buffer solution, salt, DNA polymerase, dNTP, water for PCR and primers.

2. The method of claim 1, wherein the DNase enzyme is DNase I.

3. The method of claim 2, wherein DNase I is used at a final concentration of 3.1-25U/. mu.l.

4. The method of claim 2, wherein DNase I is used at a final concentration of 6 to 8U/. mu.l.

5. The method of claim 2, wherein DNase I is used at a final concentration of 5U/. mu.l.

6. The method of claim 1, wherein the incubation is at 37 ℃ for 10 to 30 minutes.

7. The method of claim 1, wherein the inactivation is incubation for at least 8 minutes at 75 ℃ to 90 ℃.

8. The method of claim 1, wherein the inactivation is incubation at 85 ℃ for 10 minutes.

9. The method of claim 1, further comprising treating the PCR with water: adding DNase I into water for PCR, wherein the final concentration of DNase I is 1-2 multiplied by 10⁵U/μl，Mg²⁺2-10 mM, incubating for 60-120 min at 37 ℃, and then completely inactivating for 3-20 min at 99 ℃.

10. The method of claim 1, wherein water is used for PCR for primer and or probe formulation.

Images