CN114668844A - Application of Nr-CWS (N-methyl-phenyl) treated MSCs (mesenchymal stem cells) derived exosome in promotion of skin wound healing - Google Patents

Abstract

The invention discloses application of an exosome derived from MSCs (mesenchymal stem cells) treated by Nr-CWS (N-CWS) in promoting skin wound healing, and the invention discovers and proves that the exosome derived from MSCs treated by Nr-CWS promotes angiogenesis and promotes diabetic wound healing through circIARS1/miR-4782-5p/VEGFA (vascular endothelial growth factor) channels for the first time, and both circIASR1 and miR-4782-5p inhibitors can remarkably promote diabetic wound healing, so that the invention provides a new thought and direction for developing efficient and safe wound repair or wound healing medicaments in the field, and has a very good application prospect.

Description

Application of Nr-CWS-treated MSCs-derived exosome in promotion of skin wound healing

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of an Nr-CWS-treated MSCs-derived exosome in promotion of skin wound healing.

Background

Diabetic wounds are one of the most difficult complications of diabetes, and are characterized by insufficient chemotactic factors and vascularization, reduced migration and proliferation of fibroblasts, and abnormal inflammatory reactions. At present, the conventional treatment method for diabetic wounds comprises auxiliary material customization, surgical debridement, negative pressure treatment, antibiotic treatment, hyperbaric oxygen treatment and the like. However, nearly 50% of patients are not cured by conventional treatment methods. The factors for delaying the healing of the diabetic wound surface are various, including peripheral neuropathy, immune response defect, peripheral microangiopathy, insufficient oxygen delivery of tissues caused by glycosylation of hemoglobin, erythrocyte change, change of collagen ratio of type III and type I skin, biomechanical change of the diabetic skin, migration and amplification capacity reduction of fibroblasts and keratinocytes, apoptosis of keratinocytes and endothelial cells and the like. In addition, the delay in healing of diabetic wounds is closely related to the insufficiency of growth factors involved in tissue reconstruction, including VEGF, PDGF, FGF, NOS, KGF, and the like. The important factors causing the diabetic ulcer are poor blood circulation and wound healing disorder, so that the improvement of the microenvironment of the wound surface and the improvement of angiogenesis have important significance on the repair and healing of the diabetic wound surface.

Mesenchymal Stem Cells (MSCs) are a pluripotent stem cell that has all of the commonalities of stem cells, namely self-renewal and multipotentiality, and are considered to be one of the most promising stem cells in various tissue regeneration therapies. In recent years, a large number of experimental studies prove that mesenchymal stem cells from various tissues can promote diabetic wound healing, for example: bone marrow, fat, cord blood and skin tissue-derived mesenchymal stem cells. At present, mesenchymal stem cells are considered to promote wound healing mainly by secreting abundant "proteomes" through a paracrine pathway, including: growth factors, mirnas, proteasomes, extracellular vesicles, and the like, mesenchymal stem cell paracrine may play important roles in promoting proliferation, anti-apoptosis, inhibiting inflammation, and the like in injury models, and in addition, these components are more suitable for clinical applications than cell therapy because they circumvent safety and ethical issues associated with cell therapy. In particular, mesenchymal stem cell-derived exosomes (exosomes, Exos) are important components of mesenchymal stem cell paracrine and have been demonstrated to be a class of bioactive molecules that play an important role in wound healing and tissue repair.

Exosomes (exosomes, Exos) are extracellular vesicles formed by vesicle bodies fused with plasma membranes, contain various kinds of microRNAs, proteins, lipids and other substances with biological activity, and exosomes (MSC-Exos) derived from mesenchymal stem cells have become a promising therapeutic tool. Exosomes have numerous advantages over mesenchymal stem cells: the exosome can be directly fused with a target cell to play a biological effect, and the action efficiency is high: the exosome can be stably stored for a long time at the temperature of minus 80 ℃, the contained effective components are protected by the lipid membrane of the exosome, and the exosome is not easy to be damaged and convenient to transport: the using time is easy to master, and the using concentration, the dosage and the way are easy to control; fourthly, the potential hidden troubles of low survival rate of the mesenchymal stem cells in vivo and tumor-causing mutation in long-term application are overcome; fifth, complications such as vascular embolism and the like caused by direct application of mesenchymal stem cells are avoided. Therefore, the function and mechanism research of the exosome derived from the mesenchymal stem cells in the tissue injury repair is very important, and the exosome has potential application value.

A large amount of research evidence indicates that the bioactivity of mesenchymal stem cell-derived exosomes pretreated by physical, chemical and biological factors can be significantly improved, and in addition, the repair capacity in tissue engineering and regenerative medicine is also significantly improved. Nocardia rubra cell wall skeleton (Nr-CWS) is prepared from Nocardia rubra (Nocardia rubra) by fermentation, cell disruption, enzyme treatment, solvent extraction, etc., and is partially composed of nocardiac acid, arabinogalactan, and mucopeptide, and it has been reported that Nocardia rubra cell wall skeleton can accelerate skin wound healing by enhancing macrophage activation and angiogenesis. However, until now, no use of Nr-CWS pretreated MSCs-derived exosomes for diabetic wound repair therapy has been found. Therefore, the objective of this study was to investigate whether exosomes extracted from Nr-CWS pretreated MSCs could promote the angiogenic ability of endothelial cells in diabetic wound healing. In addition, the research further researches the effect of circRNA in promoting the Nr-CWS-Exos wound healing and a specific mechanism thereof.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide the application of the Nr-CWS-treated MSCs-derived exosome in promoting the healing of the skin wound and evaluate the function and the specific mechanism of the Nr-CWS-treated MSCs-derived exosome in promoting the healing of the diabetic wound.

The above object of the present invention is achieved by the following technical solutions:

the invention provides application of a reagent for inhibiting miR-4782-5p expression level in preparation of a medicine for promoting diabetic wound repair.

Further, the agent for inhibiting the expression level of miR-4782-5p is selected from the group consisting of: an agent for knocking out miR-4782-5p, an agent for silencing miR-4782-5p and an inhibitor of miR-4782-5 p.

Further, the reagent for inhibiting the expression level of miR-4782-5p comprises a nucleotide sequence shown in SEQ ID NO. 2;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes angiogenesis of endothelial cells by targeting VEGFA;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes migration of endothelial cells by targeting VEGFA;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes the proliferation of endothelial cells by targeting VEGFA.

The invention provides application of circular RNA circIASR1 or plasmid for over-expressing circular RNA circIASR1 in preparation of medicines for promoting diabetic wound repair.

Further, the nucleotide sequence of the circular RNA circIASR1 is shown in SEQ ID NO. 3.

Further, the plasmid for over-expressing the circular RNA circIASR1 contains a nucleotide sequence shown as SEQ ID NO. 3.

Further, the circular RNA circIASR1 or the plasmid for over-expressing circular RNA circIASR1 promotes the expression of angiogenesis-related genes VEGFA, bFGF and HGF;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes angiogenesis of endothelial cells by targeting miR-4782-5 p/VEGFA;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes migration of endothelial cells by targeting miR-4782-5 p/VEGFA;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes the proliferation of endothelial cells by targeting miR-4782-5 p/VEGFA.

Furthermore, the circular RNA circIASR1 is composed of one exon (932bp) from IASR1 gene, namely the No. 13-20 exon of IASR1 gene is cyclized and mainly located in cytoplasm, and experimental research shows that the circular RNA circIASR1 can regulate the expression of VEGFA through sponge miR-4782-5p, and the nucleotide sequence is shown as SEQ ID NO. 3.

The third aspect of the invention provides a preparation method of the exosome derived from the Nr-CWS-treated mesenchymal stem cells.

Further, the method comprises the steps of: culturing in a cell culture medium when the fusion degree of the mesenchymal stem cells reaches 70-80%, collecting supernatant, centrifuging, filtering to obtain precipitate which is exosome from the mesenchymal stem cells treated by the Nr-CWS; preferably, the mesenchymal stem cell is a human umbilical cord mesenchymal stem cell;

preferably, the cell culture medium is an exosome-free serum medium containing 10% of an exosome-free serum medium comprising 10 μ g/mL Nr-CWS and 10% exosome-free serum medium;

preferably, the time of the culture is 48 h;

preferably, the centrifugation condition is that the centrifugation is performed firstly under the condition of 300g 10min, then the centrifugation is performed under the condition of 2000g10min, and then the centrifugation is performed under the condition of 10000g 30 min;

preferably, the filtration conditions are filtration with a 0.22 μm filter and centrifugation at 100,000g for 70 min.

Further, the Nr-CWS treated mesenchymal stem cell-derived exosomes have a diameter size between 80-120nm and are capable of being internalized by endothelial cells.

A fourth aspect of the invention provides an Nr-CWS treated mesenchymal stem cell-derived exosome.

Further, the exosome is prepared by the method of the third aspect of the invention;

preferably, said exosomes express aix, TSG101, CD 9;

preferably, the exosome promotes the expression of angiogenesis-related genes VEGFA, bFGF, HGF;

preferably, the exosomes promote expression of the circular RNA circIASR1 in endothelial cells;

preferably, the exosomes promote angiogenesis of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosomes promote migration of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosomes promote proliferation of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosome promotes diabetic wound skin regeneration and thick collagen fiber deposition by targeting circIASR1/miR-4782-5 p/VEGFA;

more preferably, the nucleotide sequence of the circular RNA circIASR1 is shown in SEQ ID NO. 3.

In a specific embodiment of the invention, experimental research shows that the exosome derived from the mesenchymal stem cell treated by the Nr-CWS can inhibit the expression of miR-4782-5p by up-regulating the circular RNA circIASR1 and further the circular RNA circIASR1 through the sponginess, further up-regulating the angiogenesis factor VEGFA, remarkably promoting the angiogenesis of endothelial cells, accelerating the repair and regeneration of a diabetic wound surface, and can be used for treating the diabetic wound surface.

The fifth aspect of the invention provides a pharmaceutical composition for promoting diabetic wound repair.

Further, the pharmaceutical composition comprises an agent for inhibiting the expression level of miR-4782-5p as described in the first aspect of the invention, and/or a circular RNA circIASR1 or a plasmid overexpressing circular RNA circIASR1 as described in the second aspect of the invention, and/or an exosome as described in the fourth aspect of the invention; preferably, the agent for inhibiting the expression level of miR-4782-5p comprises a nucleotide sequence shown in SEQ ID NO. 2.

Further, the pharmaceutical composition also comprises a pharmaceutically acceptable carrier and/or an auxiliary material.

Further, said pharmaceutically acceptable carriers and/or adjuvants are well described in Remington's Pharmaceutical Sciences (19th ed.,1995) as needed to aid in the stability of the formulation or to aid in the activity or its bioavailability or to produce an acceptable mouthfeel or odor upon oral administration, and the formulations which may be used in such Pharmaceutical compositions may be in the form of their original compounds per se, or optionally in the form of their pharmaceutically acceptable salts, and the Pharmaceutical compositions so formulated may be selected as necessary for administration of the drug in any suitable manner known to those skilled in the art.

Further, the pharmaceutically acceptable carrier and/or excipient refers to those recognized in the art and includes, for example, pharmaceutically acceptable materials, compositions or excipients, such as liquid or solid fillers, diluents, solvents or encapsulating materials, involved in carrying or transporting any subject composition from one organ or portion of the body to another organ or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the subject composition and not injurious to the patient. In certain embodiments, the pharmaceutically acceptable carrier and/or adjuvant is pyrogen-free. Some examples of materials that may be used as pharmaceutically acceptable carriers and/or adjuvants include: (1) sugars such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered gum tragacanth; (5) malt; (6) gelatin; (7) talc powder; (8) cocoa butter and suppository waxes; (9) oils such as peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) ringer's solution; (19) ethanol; (20) phosphate buffer; (21) other non-toxic compatible substances used in pharmaceutical formulations.

Further, the pharmaceutical composition may be prepared according to methods known in the art. For this purpose, if necessary, the agent for inhibiting the expression level of miR-4782-5p described in the first aspect of the present invention, and/or the circular RNA circIASR1 or a plasmid overexpressing circular RNA circIASR1 described in the second aspect of the present invention, and/or the exosome described in the fourth aspect of the present invention may be combined with one or more solid or liquid carriers and/or excipients to make a suitable administration form or dosage form for human use.

Further, the agent for inhibiting the expression level of miR-4782-5p described in the first aspect of the invention, and/or the circular RNA circIASR1 described in the second aspect of the invention or a plasmid overexpressing circular RNA circIASR1, and/or the exosome described in the fourth aspect of the invention or the pharmaceutical composition containing any one or more of the foregoing, described in the present invention, may be administered in unit dosage form by a route including, but not limited to, parenteral or enteral, such as skin, subcutaneous, etc. The administration dosage forms include, but are not limited to, transdermal agents, tablets, suppositories, capsules, dropping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, buccal tablets, lyophilized powder injections and the like. Can be common preparation, sustained release preparation, controlled release preparation and various microparticle drug delivery systems.

A sixth aspect of the invention provides the use of an exosome according to the fourth aspect of the invention in the preparation of a medicament for promoting diabetic wound repair.

Compared with the prior art, the invention has the advantages and beneficial effects that:

the invention discovers and proves that exosomes (Exos) from Mesenchymal Stem Cells (MSCs) pretreated by a nocardia rubra cell wall skeleton (Nr-CWS) promote angiogenesis and promote healing of diabetic wounds for the first time through a circIARS1/miR-4782-5p/VEGFA channel, and further discovers and proves that both circIASR1 and miR-4782-5p inhibitors can obviously promote healing of diabetic wounds.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

fig. 1 is a graph of the characterization results for MSC-derived exosomes, wherein, panel a: the morphology of Exos and Nr-CWS-Exos was observed by TEM, and B is shown as follows: expression of specific surface markers (Alix, TSG101, CD81) of Exos and Nr-CWS-Exos were assessed by western blotting, panels C and D: exos and Nr-CWS-Exos diameters and particle concentrations were measured by NTA, E plot: the absorption conditions of HUVEC on Exos and Nr-CWS-Exos are verified by a laser scanning confocal microscope, and exosomes, cytoskeletons and cell nuclei are respectively dyed into red and blue;

FIG. 2 is a graph showing the results of Nr-CWS-Exos in promoting endothelial cell angiogenesis in vitro, wherein, A-C are shown as follows: graphs showing the migration and wound healing potential of HUVECs after treatment of cells with Exos or Nr-CWS-Exos, D and E: graphs of the tubule formation results of HUVEC after treatment of cells with Exos or Nr-CWS-Exos, Panel F: results of HUVEC proliferation treated with LG, HG + Exos and HG + Nr-CWS-Exos for 1, 3 and 7 days, FIG. G: ELISA assay the concentration of supernatants in different media supplemented with LG, HG + Exos and HG + Nr-CWS-Exos, H-plot: qRT-PCR assay HUVEC for VEGFA, bFGF and HGF relative expression levels, P <0.01, P < 0.001;

FIG. 3 is a graph showing the results of Nr-CWS-Exos accelerating wound healing in diabetic mice, wherein, A is a graph: experimental design of animal studies, panels B and C: STZ-treated mice received representative images of full-thickness defects and wound healing rates at multiple injections of PBS (control), Exos, and Nr-CWS-Exos on days 0, 7, and 14 post-surgery, panels D and F: h & E staining (black arrows indicate microvessels) and quantification of wound length and tubule formation on day 14. Scale bar 2mm, G panel: trichrome staining results on day 14 for Masson staining, panels H-J: IHC staining results of CD31 and VEGFA, panels K-M: plots of IF staining results for CD31 and VEGFA, P < 0.01;

FIG. 4 is a graph of the results of CirciaRS1 upregulating and enhancing tubule formation in Nr-CWS-Exos treated HUVECs, wherein panels A and B: circumcrna expression profile in HUVECs treated with Exos or Nr-CWS-Exos, panel C: expression of CirciaRS1 in HUVECs treated with Exos or Nr-CWS-Exos, Panel: reverse splice points were verified by Sanger sequencing, panel E: presence of circIARS1 was verified in HUVEC by RT-PCR, panel F: the expression of circIARS1 and IARS1mRNA in HUVECs treated with or without RNase R was examined by qRT-PCR, data are expressed as mean ± SD, n is 3,. P <0.01,. P < 0.001;

FIG. 5 is a graph of the results of CirciaRS1 upregulating and enhancing tubule formation in Nr-CWS-Exos treated HUVECs, wherein Panel A-C: results of migration and wound healing capacity of HUVECs after treatment of cells with Exos, Nr-CWS-Exos-circIARS1 or Nr-CWS-Exos-circIARS1 at high glucose are presented as mean ± SD, n is 3, × P <0.01, × P < 0.001;

FIG. 6 is a graph of the results of CirciaRS1 upregulating and enhancing tubule formation in Nr-CWS-Exos treated HUVECs, wherein panels A and B: graph of the results of the tube formation assay of HUVEC following treatment of cells with Exos, Nr-CWS-Exos-circIARS1, or Nr-CWS-Exos-circIARS1 at high glucose, C-graph: qRT-PCR assay of VEGFA, bFGF and HGF expression in treated HUVEC, panel D: ELISA assay results of VEGFA, bFGF and HGF secretion in treated HUVEC, data are expressed as mean ± SD, n ═ 3, × P <0.01, × P < 0.001;

FIG. 7 is a molecular sponge adsorption of miR-4782-5p from CirciaRS1 as miR-4782-5p, wherein, Panel A: localization of circIARS1 (red), scale bar 20 μm, panel B: relative expression of circIARS1 in the cytoplasmic (cyto) and nuclear (nuc) portions of HUVECs, panel C: circIARS1 in HUVECs lysates was enriched with a circIARS1 specific probe and detected by qRT-PCR, panel D: relative expression levels of 5 candidate mirnas in HUVECs lysates were detected by qRT-PCR, panel E: biotinylated miR-4782-5p was transfected into cells and after streptavidin capture, the expression level of circIARS1 was quantified by qRT-PCR, panel F: results plot of relative luciferase activity of circIARS1 for Wild Type (WT) and Mutant (MUT), G plot: graph of the results of performing anti-AGO 2RIP on circIARS1 in relation to AGO2, graph H: RNA FISH results plots for localization of circIARS1 and miR-4782-5p in HUVEC, scale bar 20 μm;

FIG. 8 is a molecular sponge adsorption of miR-4782-5p from CirciaRS1 as miR-4782-5p, wherein Panel A-C: results of testing migration ability and wound healing of HUVEC after co-transfection of miR-4782-5p and VEGFA vector, D and E panels: tubule formation of HUVEC after co-transfection of cells with miR-4782-5p and VEGFA vector, Panel F: western blot analysis of VEGFA protein expression in cells co-transfected with miR-4782-5P and VEGFA vector, data are in triplicate, expressed as mean ± SD, × P <0.01, × P < 0.001;

figure 9 is CircIARS1 modulating angiogenesis by targeting miR-4782-5p, wherein panel a-C: migration ability and wound healing of HUVECs were examined after co-transfection of cells with circIARS1 vector and miR-4782-5p mimic, panel D and panel E: angiogenesis capacity was tested by tubule formation experiments, panel F: VEGFA protein expression levels in cells co-transfected with miR-4782-5p and VEGFA vectors, G-panel: VEGFA protein expression levels in cells co-transfected with si-circIARS1 and miR-4782-5p inhibitors;

figure 10 is a graph of CircIARS1 modulating angiogenesis by targeting miR-4782-5p, wherein, graph a-C: migration ability and wound healing of HUVEC were examined after co-transfection of si-circIARS1 and miR-4782-5p inhibitor, D and E panels: angiogenesis capacity was tested by tubule formation experiments, data were in triplicate and expressed as mean ± SD, # P <0.05, # P <0.01, # P < 0.001;

fig. 11 is miR-4782-5p modulates angiogenesis by targeting VEGFA, wherein panel a-C: HUVEC migration ability and wound healing were examined after co-transfection of cells with miR-4782-5p inhibitor and si-VEGFA, D and E panels: angiogenesis ability was measured by tubule formation experiment, panel F: protein expression levels of VEGFA in cells co-transfected with miR-4782-5P inhibitors and si-VEGFA, data are in triplicate, expressed as mean ± SD,. P <0.01,. P < 0.001.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The experimental methods used in the following examples are all conventional methods unless otherwise specified; reagents, biomaterials, etc. used in the following examples are commercially available unless otherwise specified.

Examples

1. Cell culture and processing

Human umbilical cord mesenchymal stem cells (hUC-MSCs, MSCs) were obtained from Qilu cell therapy engineering technologies, Inc. in Shandong; nocardia rubra cell wall skeleton (Nr-CWS) was obtained from liening grunste biopharmaceutical limited; human Umbilical Vein Endothelial Cells (HUVECs) were purchased from shanghai yang biosciences ltd; MSCs and HUVECs were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% Fetal Bovine Serum (FBS). For high sugar (HG) treatment, MSCs were cultured in serum-free DMEM with high sugar (25mM) for 48h prior to the experiment. For the Nr-CWS treatment, MSCs under high sugar conditions were subjected to Nr-CWS treatment for 48h prior to the experiment.

2. Isolation and characterization of exosomes (Exos)

When the confluency of the hUC-MSCs reaches 70% -80%, the supernatant is taken out, washed 3 times with PBS, and then the culture medium is replaced by 10% Exosomes-free serum culture medium containing 10 ug/mL Nr-CWS and 10% Exosomes-free serum culture medium, and cultured for 48 h. Subsequently, two groups of supernatants were collected and centrifuged at 300g 10min and 2000g10min, respectively, to remove dead cells and large cell debris. Then, the supernatant was centrifuged at 10000g for 30min to remove cell debris. The supernatant was filtered using a 0.22 μm filter (JET BIOFIL, China) and centrifuged twice at 100,000g for 70 minutes. Subsequently, the obtained pellet was resuspended in 200 μ L PBS and the concentration of the extracted exosomes was measured using BCA kit (KeyGEN, China) and the sample was stored at-80 ℃ for further experiments.

In order to verify the prepared exosomes, the morphology of the exosomes was observed using a transmission electron microscope (Tecnai, USA), and in addition, the size particle size distribution of the exosomes was also detected by a laser particle scanning analyzer (Malvern UK). The expression level of specific surface markers (TSG101, Alix, CD9) of exosomes was examined using Western Blot experiments.

3. Internalization of exosomes

The exosomes were incubated with the red fluorescent dye PKH26(Sigma, USA) for 10min and then centrifuged again at 100,000g for 70min to obtain dye-free PKH 26-labeled exosomes. Subsequently, HUVEC and PKH 26-labeled exosomes were co-cultured for 24 hours, and then fixed with 4% paraformaldehyde for 20 minutes. The nucleic acids were then stained with DAPI (KeyGEN, China) according to the manufacturer's instructions. The internalization of exosomes was observed by laser confocal microscopy (Olympus, USA).

4. RNA interference or overexpression

miR-4782-5p inhibitors or miR-4782-5p mics, CircIASR1 and VEGFA overexpression vectors were obtained from Shanghai Jima pharmaceutical technology, Inc. and transfected by Lipofectamine step transfection reagent (ThermoFisher Scientific), wherein the sequence information of hsa-miR-4782-5p mics and hsa-miR-4782-5p inhibitors are as follows:

the hsa-miR-4782-5p mimics sequence is as follows:

UUCUGGAUAUGAAGACAAUCAAGAUUGUCUUCAUAUCCAGAAUU(SEQ ID NO:1)

the hsa-miR-4782-5p inhibitor sequence is as follows:

UUGAUUGUCUUCAUAUCCAGAA(SEQ ID NO:2)

the transfection procedure was as follows: HUVECs with good growth are inoculated into a 6-well plate, and transfection is carried out when the cells are observed to grow to 80% under a microscope. 500ng of siRNA or overexpression plasmid 0.1. mu.g is diluted in 125. mu.L of serum-free medium, 18. mu.L of Lipfectamine (TM) 2000 transfection reagent is added thereto, and incubated together at room temperature for 20min, then added to a 6-well plate containing 700. mu.L of serum-free medium, incubated at 37 ℃ for 4h, added to 1600. mu.L of complete medium, incubated at 37 ℃ for 48h, and then further subjected to corresponding cell function experiments.

5. Real-time quantitative PCR (qRT-PCR) and RNase R treatment

Total RNA was extracted from cells using TRIzol reagent (Ambion, USA), and then cDNART Master Mix Kit (TaKaRa, Tokyo, Japan) was generated using PrimeScript in the presence of oligo-dT primer. Using Power

Green PCR Master Mix (TaKaRa) performed real-time quantitative PCR assays on an Applied Biosystems 7500 sequence detection System (Applied Biosystems). Treatment with RNase R (Epicentre, Madison, Wisconsin, USA) 1. mu.g of RNA was digested with 1 unit of RNase R at 37 ℃ for 20 min.

6. Western blot analysis

Cells were lysed in pre-cooled RIPA lysis buffer (Beyotime, shanghai, china) supplemented with 1% PMSF, incubated on ice for 30min, and then centrifuged for 10min (12,000 × g, 4 ℃). Proteins separated by SDS-polyacrylamide gel were transferred onto nitrocellulose membranes and incubated with rabbit polyclonal antibodies: anti-VEGFA and actin (1:1000, Cell Signaling Technology, MA, USA). Immunoreactive protein bands were detected using the Tanon scanning system (Tanon Science & Technology co., ltd., Beijing, China).

7. Cell proliferation assay (CCK-8 cell proliferation assay)

HUVEC were trypsinized and treated at 3X 10³Individual cells were seeded at density in 96-well plates. PBS, Exos or Nr-CWS-Exos was added to the cell culture medium. Then, the proliferation of the cells was examined on days 1, 2, 3, 4 and 5 using CCK-8 kit (VICMED, China). And the absorbance of the cells was measured at 450nm with a microplate reader (Thermo Electron, USA).

8. Cell migration invasion assay (Transwell assay)

HUVEC at 3X 10³The density of individual cells/well was seeded into the upper chamber of the Transwell. Then, 600 μ L of medium containing 10% serum was added to the lower chamber. After 24 hours incubation at 37 ℃, HUVECs were fixed with paraformaldehyde for 20 minutes and then stained with crystal violet (KeyGEN, china) for 20 minutes. Finally, the cells were observed under a microscope (Olympus, Japan) and counted by ImageJ software.

9. Tubule formation experiment (Tube formation assay)

Matrigel (corning, USA) was added at 250. mu.L/well to a pre-cooled 24-well plate and incubated at 37 ℃ for 45 min. Then, HUVEC were mixed at 5X 10⁴The density of individual cells was seeded into 24-well plates and incubated for 6 hours. Finally, graphs of the results of the experiments were obtained by microscopy (Olympus, Japan) and the branching sites in one view were counted by ImageJ software.

10. Luciferase reporter gene assay

In the case of the indicated treatments using Lipofectamine stem transfection reagents, the luciferase constructs driven with the promoter or control luciferase constructs were run in 24-well plates at 1 × 10 per well⁵Cells were transfected for 24 hours overnight at the density of (g). Luciferase measurements were performed using the dual luciferase kit (Promega, Madison, Wis.) according to the manufacturer's instructionsAnd renilla luciferase activity.

11. CircRNA pull-down experiment

For the circRNA pull-down experiment, 10 was harvested and lysed⁷And (4) cells. Biotinylated circIARS1 probe (Tsingke, wuhan, china) was incubated with streptavidin magnetic beads (Invitrogen) for 2 hours at room temperature to yield probe-coated beads. The beads were washed and the bound miRNA in the pull-down material was extracted using Trizol reagent and analyzed by qRT-PCR analysis.

12. RNA-binding protein immunoprecipitation (RIP) assay

RIP assays were performed using the Magna RIP RNA binding protein immunoprecipitation kit (Millipore, Boston, MA). Cells were lysed and incubated with human anti-AGO 2 antibody (Millipore, 03-110) or anti-mouse IgG (Millipore, 03-110) conjugated magnetic beads and immunoprecipitated RNA was detected by qRT-PCR assay.

13. Fluorescence In Situ Hybridization (FISH)

The cy 3-labeled probe for detecting circIARS1 and the FAM-labeled probe for detecting miR-4782-5p were synthesized by GenePharma (china, shanghai). The signal of the probe was detected by fluorescence in situ hybridization kit (GenePharma, China, Shanghai) according to the manufacturer's instructions. Images were digitally recorded using a zeiss LSM880 microscope.

14. Diabetic wound model

The construction method of the diabetes mouse model comprises the following steps:

the mice used in the experiment are female mice (purchased from Jiangsu Hua Chuangnuo pharmaceutical science and technology Co., Ltd.) with the age of 4-6 weeks, the mice are special pathogen-free experimental animals (SPF grade), the body weight of the mice varies from 18g to 24g, and the number of the mice is totally 30;

mice were housed in SPF grade animal houses. Mice were fasted for 12-16h prior to molding and their body weight was recorded and injected with 40mg/kg of 2% STZ solution (streptozotocin solution) for 5 consecutive days. And measuring blood sugar on the 7 th day after injection, taking tail vein blood of the mouse, measuring the blood sugar concentration by a glucometer, recording, and taking the result as the success of modeling when the typical diabetes symptoms of polydipsia, polyphagia, polyuria and weight loss appear when the blood sugar concentration of the mouse is stable to be more than 16.7 mmol/L.

The grouping and treatment of diabetic mice were as follows:

the animal experiments in this study were divided into 3 groups of 10 animals each, each of which was a blank control group (PBS buffer treatment); exos treatment group; Nr-CWS-Exos treatment groups.

After the diabetic mouse model is successfully constructed, the mice are subjected to abdominal anesthesia by 6.7mg/mL pentobarbital sodium, after anesthesia, the hair of the mice is removed, wound surfaces with the diameter of 1.0cm are cut on the back of the mice, PBS, and the extracted Exos and Nr-CWS-Exos are respectively injected into the wound margin skin of each group of mice in a subcutaneous injection mode, the surfaces of the mouse wound margins are coated with sterile gauze, and the mice are continuously raised and observed. The mice were photographed and the skin healing was recorded.

15. Wound healing evaluation

Before harvesting, the size of the injured area on the back of each mouse was measured with a ruler and recorded by multi-point injection (6 points). Wound closure rate was measured as follows: wound closure index (%) ═ 1-area of non-healed wound/area of original wound x 100%.

16. Histologic eosin and Masson staining (eosin staining and Masson staining)

Animals were sacrificed 14 days after treatment and skin biopsies of wounds and surrounding tissue were taken. The collected tissues were stained by hematoxylin and eosin (H & E, Sigma) and masson trichrome (Sigma). Trichrome staining by Masson was used to measure the thickness of the newly formed dermal layer at the mouse wound and H & E staining was used to assess the rate of re-epithelialization.

17. Immunofluorescence analysis

CD31 and TNF-alpha antibodies (1:50, Cell Signaling Technology) were used in immunofluorescence assays. DAPI (Abcam inc., Cambridge, UK) was used for staining of the nuclei. Immunofluorescence images were collected using an installed cameldia Master digital camera (Olympus, Tokyo, Japan).

18. Statistical analysis

Data are presented as mean ± Standard Deviation (SD). Data were analyzed in SPSS 17.0 software (SPSS inc., Chicago, Illinois, USA) using a two-by-two comparison with control groups using the t-test, or a multiple comparison between groups using one-way analysis of variance (ANOVA). P <0.05 was considered statistically significant.

19. Results of the experiment

(1) Characterization of Mesenchymal Stem Cell (MSCs) -derived exosomes (Exos)

Conditioned media of MSCs (untreated) and Nr-CWS treated MSCs were collected and Exos and Nr-CWS-Exos were separated by ultracentrifugation, respectively. The morphology of exosomes was observed by transmission electron microscopy, and the results showed that homogeneous, spherical and membrane-bound vesicles were observed in each group, showing a typical exosome structure (see fig. 1A); NTA was used to measure the particle size, and the data showed that the size distribution of Exos and Nr-CWS-Exos both showed a single peak at about 80-120nm (see FIG. 1B); furthermore, western blot analysis was performed to identify exosome markers and the results showed that Alix, TSG101 and CD9 were expressed in isolated Exos and Nr-CWS-Exos (see fig. 1C), which were similar in particle size, morphology and protein expression, indicating that exosome secretion of MSCs was not affected by Nr-CWS, which together confirmed successful exosome extraction; in addition, this example investigated whether HUVECs could endocytose MSC-exos, and PKH 26-labeled exosomes were co-cultured with HUVECs and observed by laser scanning confocal microscopy, and showed that exosomes labeled with PKH26 (red) were found in the perinuclear region of HUVECs (see fig. 1D and fig. 1E), indicating the internalization of exosomes by HUVECs.

(2) Nr-CWS-Exos promotion of HUVECs angiogenesis

To investigate the effect of Exos on cellular angiogenesis, MSCs were treated with LG (low carbohydrate), HG (high carbohydrate), HG + Exos and HG + Nr-CWS-Exos. Transwell was used to examine the migration of cells, and the results showed that high sugar inhibited the migration of HUVECs, while Exos and Nr-CWS-Exos promoted the cell migration ability of HUVECs damaged by high sugar, and Nr-CWS-Exos showed greater promotion in cell migration (see FIG. 2A and FIG. 2B). The tubule formation experiment shows the same experimental results, and the results show that Exos and Nr-CWS-Exos promote the tubule formation ability of HUVEC damaged by hyperglycemia. More tube structures were observed in Nr-CWS-Exos treated HUVECs than in Exos and HG groups (see FIGS. 2C and 2D); the results of cell proliferation experiments showed that Nr-CWS-Exos treated HUVECs showed strong proliferation potency compared to the Exos and HG groups (see FIG. 2E); angiogenesis-related genes (VEGFA, bFGF and HGF) have been proved to promote angiogenesis, and the relative expression levels of mRNA of the genes are detected by the invention, and the result shows that Nr-CWS-Exos remarkably promotes the expression of VEGF, bFGF and HGF (see figure 2F). These results indicate that Nr-CWS-Exos promotes the angiogenesis of HUVECs.

(3) Nr-CWS-Exos accelerated vascularization of diabetic wounds

To study the pro-angiogenic effect of Nr-CWS-Exos, a diabetic mouse model was constructed by injection of STZ (streptozotocin) and two full-thickness skin wounds were created on the back of each mouse. PBS (control), Exos and Nr-CWS-Exos were injected subcutaneously at multiple points around the wound site to observe the effect of wound treatment. The wound healing process was first evaluated in diabetic mice, and digital photographs of the wounds showed the fastest wound closure rate in diabetic mice exposed to Nr-CWS-Exos, although Exos improved wound healing compared to the control group (PBS) (see fig. 3A-3B); h & E staining and massson staining were performed to assess re-epithelialization and collagen formation, and the results showed that Exos and Nr-CWS-Exos promoted skin regeneration and thick collagen fiber deposition on diabetic wounds, and that Nr-CWS-Exos group was more effective (see fig. 3C-fig. 3E); the role of Nr-CWS-Exos in angiogenesis in diabetic mice was assessed by staining dermal microvessels with CD31, and the results showed that a significant amount of vascularization was observed in Exos and Nr-CWS-Exos treated wounds compared to PBS treated wounds (see fig. 3F and 3G); Nr-CWS-Exos treated wounds showed more CD31 positive cells than Exos group ((see fig. 3H-fig. 3M).

(4) Nr-CWS-Exos increase circIASR1 expression of HUVECs

To explore the potential mechanism of Nr-CWS-Exos-mediated pro-angiogenic ability, HUVECs were treated with HG, HG + Exos, and HG + Nr-CWS-Exos and whole transcriptome sequencing was performed. A series of varied circrnas were observed, of which circIASR1 was the most upregulated circRNA (see fig. 4A and 4B); the results of the qRT-PCR detection of the expression condition of the circIASR1 also show that the expression level of the circIASR1 is high, and the Nr-CWS-Exo obviously increases the expression level of the circIASR1 in the cells which are inhibited by high sugar (see figure 4C); we confirmed the head-to-tail splicing of circIASR1 by Sanger sequencing in HUVEC (see figure 4D); CircIASR1 only amplified by different primers in cDNA, but no amplification product in gDNA (see fig. 4E); furthermore, circIASR1 was resistant to RNase R, whereas IASR1mRNA was partially degraded by RNase R (see FIG. 4F), and these results indicate that Nr-CWS-Exos increased the expression of circIASR1 in HUVECs.

The circular RNA circIASR1 consists of one exon (932bp) from IASR1 gene, and the No. 13-20 exon of IASR1 gene is formed by cyclization, and the nucleotide sequence is shown as follows:

ATCAGACACTCCTCTAATTTACAAAGCAGTGCCCAGCTGGTTTGTGCGAGTGGAGAACATGGTGGACCAGCTCCTAAGGAACAATGACCTGTGCTACTGGGTCCCAGAGTTGGTACGAGAAAAACGATTTGGAAATTGGCTGAAAGATGCACGTGACTGGACAATTTCCAGAAACAGATACTGGGGCACCCCCATCCCACTGTGGGTCAGCGATGACTTTGAGGAGGTGGTATGCATTGGGTCAGTGGCGGAACTTGAAGAACTGTCAGGAGCAAAGATCTCAGATCTCCACAGAGAGAGTGTTGACCACCTGACCATTCCTTCACGCTGTGGGAAGGGATCCTTGCACCGCATCTCTGAAGTGTTTGACTGTTGGTTTGAGAGTGGCAGCATGCCCTATGCTCAGGTTCATTACCCGTTTGAAAACAAGAGGGAGTTTGAGGATGCTTTTCCTGCAGATTTCATTGCCGAGGGCATCGACCAAACCAGAGGATGGTTTTATACCCTGCTGGTGCTGGCCACGGCCCTCTTTGGACAACCGCCTTTCAAGAACGTAATTGTGAATGGGCTTGTCCTGGCAAGTGATGGCCAAAAAATGAGCAAACGGAAAAAGAATTATCCAGATCCAGTTTCCATCATCCAGAAGTATGGTGCTGATGCCCTCAGATTATATCTGATTAACTCCCCTGTGGTGAGAGCAGAAAACCTCCGCTTTAAAGAAGAGGGTGTGCGGGACGTCCTTAAGGATGTACTGCTCCCATGGTACAATGCCTATCGCTTCTTAATCCAGAACGTTCTGAGGCTCCAGAAGGAGGAAGAAATAGAATTTCTCTACAATGAGAACACGGTTAGAGAAAGCCCCAACATTACAGACCGGTGGATCCTGTCCTTCATGCAGTCTCTCATTGGCTTCTTTGAGACTGAAATGGCAG(SEQ ID NO:3)

(5) CirciaSR1 mediates angiogenesis promoting effects of Nr-CWS-Exos on endothelial cells

The invention researches the effect of circIASR1 on the angiogenesis promotion effect of the Nr-CWS-Exos-induced endothelial cells. The results of Transwell experiments showed that once circIASR1 in Nr-CWS-Exos was decreased, the pro-cell migration effect of Nr-CWS-Exos was inhibited, and conversely, increased circIASR1 in Nr-CWS-Exos significantly promoted the migration of endothelial cells (see fig. 5A-5C); tube formation assays of HUVECs treated with MSCs sicrciasr 1-Exos on Matrigel showed a lower number of capillary-like structures compared to control, circIASR1-Exos potentiated the positive effect of Nr-CWS-Exos on tube formation, the ability of USC-Exos to induce VEGF-A, bFGF and HGF was significantly inhibited, vascular formation was significantly inhibited when the expression of circIASR1 in MSC-Exos was inhibited, increased expression of circIASR1 was significantly promoted when the expression of circIASR1 in MSC-Exos was upregulated (see fig. 6A-6D), which results indicate that circIASR1 is essential for USC-Exo-induced endothelial angiogenesis promotion, and circIASR1 was able to significantly promote healing of wounds.

(6) CircIASR1 acts as miR-4782-5p sponge in endothelial cells

In order to study the mechanism of circIASR1 in regulating angiogenesis, the present invention first examined its location, and the results showed that circIASR1 is mainly localized in the cytoplasm (cyto) (see fig. 6A and 6B), suggesting that circIASR1 may act as a molecular sponge for mirnas, the present invention further searched for potential binding mirnas and selected five candidate mirnas, and subsequently, biotin-labeled probes were applied in pull-down assays to explore whether circIASR1 could directly bind these candidate mirnas, which were validated to reduce circIASR1 in HUVEC (see fig. 7C); then, a circIASR1 probe was used to pull down candidate mirnas, and the results showed that miR-4782-5p is the only miRNA pulled down by circIASR1 (see fig. 7D). Next, the present invention applied biotin-labeled miR-4782-5p to pull down circIASR1, and the data demonstrated that biotin-miR-4782-5p captured more circIASR1 (see FIG. 7E); to confirm this prediction, the present invention constructed a dual-luciferase reporter system by inserting the sequence of circIASR1 into the 3' UTR of psiCHECK2 plasmid (wild-type, WT), and the results showed that only the miR-4782-5 p-mimetic group was able to significantly inhibit the luciferase activity (see fig. 7F); miRNA inhibited translation and degraded mRNA by binding to its target in an AGO 2-dependent manner, and AGO2 immunoprecipitation results showed that circIASR1 was specifically enriched in miR-4782-5p transfected cells (see fig. 7G); results of RNA FISH assay showed that circIASR1 and miR-301b-3p co-localized in cytoplasm (see FIG. 7H). These results indicate that circIASR1 can bind directly to miR-4782-5 p.

(7) miR-4782-5p inhibits angiogenesis of endothelial cells by targeting VEGFA

mirnas regulate their targeted mRNA post-transcriptionally through sequence-directed recognition. According to prediction of miRDB, miR-4782-5p was found to bind to the 3' -UTR region of VEGFA. The invention constructs a mutant reporter gene (MUT) at the miR-4782-5p binding site. The result shows that miR-4782-5p mimics strongly reduces the activity of a luciferase reporter gene carrying a wild-type VEGFA 3' -UTR, however, the luciferase reporter gene activity in the MUT3' -UTR reporter genome is not changed (see figure 8A and figure 8B), miR-4782-5p mimics inhibits VEGFA expression, while the miR-4782-5p inhibitor promotes the expression of VEGFA (see figure 8C and figure 8D), and the function of miR-4782-5p/VEGFA in regulating angiogenesis is studied next, and the result shows that miR-4782-5p inhibits angiogenesis and endothelial cell migration, however, up-regulation of VEGFA expression rescued cellular angiogenesis, in contrast, VEGFA down-regulation inhibited miR-4782-5p inhibitor-induced angiogenesis and endothelial cell migration (see fig. 8E-8F and 11A-11F). These results indicate that miR-4782-5p significantly inhibits endothelial cell angiogenesis by targeting VEGFA.

(8) Circia SR1 regulates endothelial cell angiogenesis via miR-4782-5p

To assess whether circIASR1 promotes angiogenesis of endothelial cells by miR-4782-5p, experiments were performed by co-transfecting circIASR1 and miR-4782-5p mimics into HUVECs, whose Transwell and tubule formation assay results showed that overexpression of circIASR1 resulted in an increase in migration and angiogenic capacity, which was partially attenuated by ectopic expression of miR-4782-5p (see fig. 9A-9D); furthermore, it was found that expression of VEGFA was significantly reduced in HUVECs co-transfected with the circIASR1 plasmid and miR-4782-5p mimics compared to cells transfected with circIASR1 alone (see fig. 9F-fig. 9G), miR-4782-5p inhibitor (miR-inhibitor) rescued the migration and angiogenic ability of HUVECs induced by circIASR1 knockdown, and expression of VEGFA showed the same changes (see fig. 10A-fig. 10D), and furthermore, it was shown that inhibition of miR-4782-5p significantly promoted migration of cells, angiogenesis and wound healing (see fig. 10A-fig. 10D), which further demonstrated that both circIASR1 and miR-4782-5p inhibitor were able to significantly promote wound healing, and that exosomes derived from circmir-s pretreated circIASR 1/cwrs 3682/gfa-4782/gfa-1/gfa-4782/MSC, Promoting the healing of diabetic wound.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Xuzhou medical university affiliated Hospital

Application of MSCs (mesenchymal stem cells) -derived exosomes treated by <120> Nr-CWS (nitric oxide synthase) in promotion of skin wound healing

<141> 2022-03-31

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 44

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

uucuggauau gaagacaauc aagauugucu ucauauccag aauu 44

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

uugauugucu ucauauccag aa 22

<210> 3

<211> 932

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atcagacact cctctaattt acaaagcagt gcccagctgg tttgtgcgag tggagaacat 60

ggtggaccag ctcctaagga acaatgacct gtgctactgg gtcccagagt tggtacgaga 120

aaaacgattt ggaaattggc tgaaagatgc acgtgactgg acaatttcca gaaacagata 180

ctggggcacc cccatcccac tgtgggtcag cgatgacttt gaggaggtgg tatgcattgg 240

gtcagtggcg gaacttgaag aactgtcagg agcaaagatc tcagatctcc acagagagag 300

tgttgaccac ctgaccattc cttcacgctg tgggaaggga tccttgcacc gcatctctga 360

agtgtttgac tgttggtttg agagtggcag catgccctat gctcaggttc attacccgtt 420

tgaaaacaag agggagtttg aggatgcttt tcctgcagat ttcattgccg agggcatcga 480

ccaaaccaga ggatggtttt ataccctgct ggtgctggcc acggccctct ttggacaacc 540

gcctttcaag aacgtaattg tgaatgggct tgtcctggca agtgatggcc aaaaaatgag 600

caaacggaaa aagaattatc cagatccagt ttccatcatc cagaagtatg gtgctgatgc 660

cctcagatta tatctgatta actcccctgt ggtgagagca gaaaacctcc gctttaaaga 720

agagggtgtg cgggacgtcc ttaaggatgt actgctccca tggtacaatg cctatcgctt 780

cttaatccag aacgttctga ggctccagaa ggaggaagaa atagaatttc tctacaatga 840

gaacacggtt agagaaagcc ccaacattac agaccggtgg atcctgtcct tcatgcagtc 900

tctcattggc ttctttgaga ctgaaatggc ag 932

Claims (10)

1. Application of a reagent for inhibiting miR-4782-5p expression level in preparation of medicines for promoting diabetic wound repair.

2. The use according to claim 1, wherein the agent that inhibits the expression level of miR-4782-5p is selected from the group consisting of: an agent for knocking out miR-4782-5p, an agent for silencing miR-4782-5p and an inhibitor of miR-4782-5 p.

3. The use according to claim 1 or 2, wherein the agent for inhibiting the expression level of miR-4782-5p comprises a nucleotide sequence shown as SEQ ID NO. 2;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes angiogenesis of endothelial cells by targeting VEGFA;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes migration of endothelial cells by targeting VEGFA;

preferably, the agent for inhibiting the expression level of miR-4782-5p promotes the proliferation of endothelial cells by targeting VEGFA.

4. The application of the circular RNA circIASR1 or the plasmid of the over-expression circular RNA circIASR1 in preparing the medicine for promoting the diabetic wound repair is characterized in that the nucleotide sequence of the circular RNA circIASR1 is shown as SEQ ID NO. 3.

5. The use according to claim 4, wherein the plasmid overexpressing circular RNA circIASR1 comprises the nucleotide sequence set forth in SEQ ID NO. 3.

6. The use of claim 4, wherein the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes the expression of angiogenesis-related genes VEGFA, bFGF, HGF;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes angiogenesis of endothelial cells by targeting miR-4782-5 p/VEGFA;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes endothelial cell migration by targeting miR-4782-5 p/VEGFA;

preferably, the circular RNA circIASR1 or the plasmid overexpressing circular RNA circIASR1 promotes the proliferation of endothelial cells by targeting miR-4782-5 p/VEGFA.

7. A method for preparing an Nr-CWS-treated mesenchymal stem cell-derived exosome, comprising the following steps: culturing in a cell culture medium when the fusion degree of the mesenchymal stem cells reaches 70-80%, collecting supernatant, centrifuging, filtering to obtain precipitate which is exosome from the mesenchymal stem cells treated by the Nr-CWS;

preferably, the mesenchymal stem cell is a human umbilical cord mesenchymal stem cell;

preferably, the cell culture medium is a serum medium containing 10% exosome-free comprising 10 μ g/mL Nr-CWS and 10% exosome-free serum medium;

preferably, the time of the culture is 48 h;

preferably, the centrifugation condition is that the centrifugation is performed firstly under the condition of 300g 10min, then the centrifugation is performed under the condition of 2000g10min, and then the centrifugation is performed under the condition of 10000g 30 min;

preferably, the filtration conditions are filtration with a 0.22 μm filter and centrifugation at 100,000g for 70 min.

8. An Nr-CWS-treated mesenchymal stem cell-derived exosome, which is prepared by the method of claim 7;

preferably, Alix, TSG101, CD9 are expressed in said exosomes;

preferably, the exosome promotes the expression of angiogenesis-related genes VEGFA, bFGF, HGF;

preferably, the exosomes promote expression of the circular RNA circIASR1 in endothelial cells;

preferably, the exosomes promote angiogenesis of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosomes promote migration of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosomes promote proliferation of endothelial cells by targeting circIASR1/miR-4782-5 p/VEGFA;

preferably, the exosomes promote diabetic wound skin regeneration and thick collagen fiber deposition by targeting circIASR1/miR-4782-5 p/VEGFA;

more preferably, the nucleotide sequence of the circular RNA circIASR1 is shown in SEQ ID NO. 3.

9. A pharmaceutical composition for promoting diabetic wound repair, which comprises an agent for inhibiting the expression level of miR-4782-5p as described in claim 1, and/or a circular RNA circIASR1 or a plasmid overexpressing circular RNA circIASR1 as described in claim 4, and/or an exosome as described in claim 8;

preferably, the agent for inhibiting the expression level of miR-4782-5p comprises a nucleotide sequence shown in SEQ ID NO. 2.

10. Use of an exosome according to claim 8 in the preparation of a medicament for promoting diabetic wound repair.

Images