CN114657646A - Method for constructing prokaryotic RNA sequencing library - Google Patents

Abstract

The invention provides a method for constructing a prokaryotic RNA sequencing library. The method can add an extension sequence to the prokaryotic mRNA, and the prokaryotic RNA can be efficiently called and reversely transcribed by utilizing the extension sequence; meanwhile, the method can mark a molecular label for each prokaryotic organism original mRNA molecule to avoid the influence of PCR preference on detection accuracy, thereby obtaining a prokaryotic organism mRNA sequencing library with low preference and high accuracy. Compared with the traditional prokaryotic RNA sequencing library construction method, the method has the advantages that the constructed library has low preference, the method is simple and convenient to operate, the success rate is high, and the method is also suitable for detecting an extremely low initial sample (less than 2ng of total RNA).

Description

Method for constructing prokaryotic organism RNA sequencing library

Technical Field

The invention relates to a method for constructing a prokaryotic RNA sequencing library, belonging to the technical field of gene sequencing.

Background

With the improvement of the technical level of gene sequencing and the successive development of important items such as human genome project, cancer genome project, Meta-Hit project and the like, genome research and RNA sequencing are increasingly becoming powerful tools for biological and medical research. New outcomes of a large number of biological and medical studies have been discovered or verified by RNA sequencing. However, most of the current RNA researches are eukaryotic organisms, which has a certain relation with the accuracy and stability of the eukaryotic organism RNA sequencing and database building method superior to those of the prokaryotic organism RNA sequencing and database building method, so that the RNA researches of the prokaryotic organisms need better RNA sequencing and database building method support.

Messenger RNA (mRNA) of both eukaryotes and prokaryotes accounts for 5-10% of the total RNA, while ribosomal RNA (rRNA) accounts for more than 80% of the total RNA. mRNA carries genetic information and can direct protein synthesis, and is the main research object of RNA sequencing. rRNA, however, does not carry genetic information, and therefore, removal of rRNA is required to reduce useless sequencing when constructing RNA sequencing libraries. Traditional sequencing of prokaryotic RNA requires reverse transcription of RNA by random primers, obtaining cDNA and pooling. Because random primers are used, multiple primers are bound to each RNA for reverse transcription, which can lead to unpredictable amplification preference and affect the accuracy of detection. Meanwhile, the random primers have different binding capacities, so that the method is not suitable for samples with extremely low initial quantity (0.02-20 ng). In 2020, Chatarin wangsauwat et al invented EMBR-seq, using blocking primers in conjunction with rRNA, by reverse transcription obtaining cDNA reverse transcribed from mRNA and constructing a sequencing library. This method has two disadvantages, one is that the efficiency and specificity of the reverse transcription primer is not high, and it shows that the number of genes to be transcribed is low in a sample having a low initial amount. Secondly, the rRNA closed primer is complex to operate, and an RNA sample is extremely easy to degrade, so that a severe RNA degradation phenomenon is easily caused before a reverse transcription step, and the library building capacity of the method is lower than that of the traditional method.

Disclosure of Invention

In view of the above-mentioned shortcomings in the prior art, the present invention aims to provide a method for constructing a prokaryotic RNA sequencing library, which is efficient, has high success rate, low preference and is convenient for experimental operation.

The present invention has been made in an intensive study to solve the above problems, and as a result, it has been found that: by adding a special extension sequence containing a molecular tag to RNA of prokaryotes, the RNA treated in the way can be directly reverse transcribed by using a primer of which a part of sequence is reverse complementary to the special extension sequence, and simultaneously, the reverse transcribed cDNA can contain the molecular tag in the extension sequence, and the problem of PCR preference can be solved by the molecular tag. Therefore, the RNA is captured efficiently, the preference of sequencing data is reduced, and the accuracy of a sequencing result is improved. In addition, a step of rRNA removal is performed after cDNA amplification, so that the RNA is treated with only an extension sequence before reverse transcription, thereby reducing the risk of RNA degradation by minimizing the manipulation before reverse transcription. By adopting the RNA library construction method, the prokaryotic RNA sequencing library with low preference can be obtained with high success rate, high efficiency and simplicity.

That is, the present invention includes,

1. a method of constructing a prokaryotic RNA sequencing library, the method comprising the steps of:

obtaining RNA: extracting an RNA sequence of a prokaryote;

adding an extension sequence: adding a nucleotide sequence shown as SEQ ID No.1 at the 3' end of the RNA sequence to obtain an extended RNA sequence;

reverse transcription: carrying out reverse transcription on the extended RNA sequence by adopting a nucleotide sequence shown as SEQ ID No.2 to obtain a cDNA sequence;

building a library: the cDNA sequence was used to construct a library for sequencing.

2. The method of item 1, wherein the reverse transcription step is followed by a step of removing rRNA.

3. The method according to item 1, wherein the extracted prokaryotic RNA has a mass of 10^-5–10²⁰ng, preferably of mass 10^-3–10⁶ng, more preferably 10^-2–10²⁰ng。

4. The method of item 1, wherein SEQ ID NO: 1, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, even more preferably the proportion of ribonucleotides is 0 to 25%, even more preferably the proportion of ribonucleotides is 0 to 10%, most preferably the proportion of ribonucleotides is 0, i.e. when the nucleotide sequence shown in SEQ ID NO: 1 are each composed of deoxyribonucleotides.

5. The method of item 1, wherein SEQ ID NO: 2, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, further preferably the proportion of ribonucleotides is 0 to 25%, further preferably the proportion of ribonucleotides is 0 to 10%, most preferably the proportion of ribonucleotides is 0, when the nucleotide sequence shown in SEQ ID NO: 2 are each composed of deoxyribonucleotides.

6. The method of item 1, wherein the amplified cDNA sequence is obtained by PCR of the cDNA sequence after the reverse transcription step.

7. A prokaryotic RNA sequencing library obtained by the method of any one of claims 1-6, comprising at least an RNA sequence or its reverse complement, and a molecular tag or its reverse complement.

8. A method of sequencing a prokaryotic RNA sequencing library by sequencing the library constructed by the method of any one of claims 1-6.

According to one aspect of the present invention, there is provided a method for constructing a prokaryotic RNA sequencing library, comprising: obtaining RNA: extracting a prokaryotic RNA sequence; adding an extension sequence: adding a nucleotide sequence shown as SEQ ID No.1 at the 3' end of the RNA sequence to obtain an extended RNA sequence; reverse transcription: carrying out reverse transcription on the extended RNA sequence by adopting a nucleotide sequence shown as SEQ ID No.2 to obtain a cDNA sequence; and building a library: the amplified cDNA sequences were used to construct a sequencing library.

In the context of the present invention, "prokaryotes" refer to a class of primitive organisms whose nuclei are not enveloped by a nuclear membrane, and only naked DNA, called the nuclear region, is present. Sample types for prokaryotes include, but are not limited to: gram-negative bacteria, gram-positive bacteria, cyanobacteria, actinomycetes, mycoplasma, chlamydia, rickettsia; these cell sources include, but are not limited to: primary culture, cell line culture, tissue, organism, environmental source.

In the above method for constructing a prokaryotic RNA sequencing library, the specific nucleotide sequence added to the 3' end of the RNA sequence is represented by SEQ ID NO: 1.

SEQ ID NO: 1, sequence: 5' - (M)_k(N)_a-3'，

Wherein, (M)_kIs a molecular label, and M is any one of A, T, C, G, U five bases; preferably M is selected from A, T, C, G, any of the four bases. (M)_kThe combination of the medium bases can be completely random, or the preset limited number can be 10-10²⁰A preferred number of combinations is 10²-10¹⁰More preferably, the number of combinations is 10³-10⁷. Can be random base combinations. k is a natural number of 6 or more; preferably k is 6 to 50; more preferably k is 8 to 30; further preferably k is 10-20. N is any one of A, T, C, G, U five bases; preferably N is selected from A, T, C, G, any of the four bases. a is a natural number of more than 6; preferably a is 6-1000; more preferably a is 6 to 100; further preferably a is 10 to 30. Preferred SEQ ID NO: 1 will not have more than 10 consecutive bases reverse complementary to the rest of the sequence to avoid the sequence itself forming a hairpin structure.

In the above method for constructing a prokaryotic RNA sequencing library, SEQ ID NO: 1, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, even more preferably the proportion of ribonucleotides is 0 to 25%, even more preferably the proportion of ribonucleotides is 0 to 10%, most preferably the proportion of ribonucleotides is 0, i.e. when the nucleotide sequence shown in SEQ ID NO: 1 are each composed of deoxyribonucleotides.

In the present invention, the nucleotide sequence shown as SEQ ID No.1 is a specially designed extended sequence that can be used for ligation with RNA.

In the above method for constructing a prokaryotic RNA sequencing library, the agent for adding an extension sequence may be an enzyme selected from the group consisting of linking, modifying, polymerizing, or extending deoxyribonucleic acid or ribonucleic acid. Specifically, the enzyme may be one or a combination of two or more selected from phosphorylase, DNA ligase, RNA ligase, DNA polymerase, RNA polymerase and reverse transcriptase. Preferably one of DNA ligase and RNA ligase. More preferably an RNA ligase.

In the above method for constructing a prokaryotic RNA sequencing library, the nucleotide sequence for reverse transcription of the extended RNA sequence is the nucleotide sequence shown in SEQ ID No. 2.

SEQ ID NO: 2, sequence: 5'- (N)'_b-3'，

Wherein b is a natural number of 6 or more; preferably b is 6 to 100; more preferably b is 10 to 50; further preferably b is 12-30. N is any one of A, T, C, G, U five bases; preferably N is selected from A, T, C, G, any one of four bases. (N)'_bAnd (N)_aThe nucleotide sequence is partially or fully reverse complementary. Preferably (N)'_bAnd (N)_aMore than 6 bases are reversely complementary; more preferably (N)'_bAnd (N)_aHas 6 to 50 bases reverse complement, more preferably (N)'_bAnd (N)_aHas 7 to 40 base reverse complements, more preferably (N)'_bAnd (N)_aThere are 8-30 bases reverse complementary.

In the above method for constructing a prokaryotic RNA sequencing library, SEQ ID NO: 2, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, even more preferably the proportion of ribonucleotides is 0 to 25%, even more preferably the proportion of ribonucleotides is 0 to 10%, most preferably the proportion of ribonucleotides is 0, i.e. when the nucleotide sequence shown in SEQ ID NO: 2 consists entirely of deoxyribonucleotides.

In the present invention, the nucleotide sequence shown as SEQ ID No.2 is a primer sequence, and is also a sequence having reverse complementarity to all or part of the extension sequence, which is a primer sequence having a molecular tag capable of specifically recognizing, calling and reverse-transcribing an RNA sequence having a specifically designed extension sequence. In the method for constructing a prokaryotic RNA sequencing library, the reagent for tagging sequences may be one or a combination of two or more selected from the group consisting of reverse transcriptase, DNA ligase, RNA ligase, DNA polymerase, RNA polymerase, Template Switching RT Enzyme Mix. The most preferred choice is reverse transcriptase or Template Switching RT Enzyme Mix.

In the above method for constructing a prokaryotic RNA sequencing library, the apparatus used in the reverse transcription step may be one or more selected from the group consisting of a PCR apparatus, a water bath, a constant temperature shaker, an incubator, a thermostat, and an air conditioner, and most preferably, a PCR apparatus.

Alternatively, in the above method for constructing a prokaryotic RNA sequencing library, PCR may be performed on the cDNA sequence after the reverse transcription step to obtain an amplified cDNA sequence. Then, the amplified cDNA sequence is subjected to library construction.

Preferably, in the method for constructing a prokaryotic RNA sequencing library described above, the step of removing rRNA is performed after the step of reverse transcription. The rRNA removal step may be performed using a commercial kit, such as Illumina Ribo-Zero gram-negative bacteria rRNA removal kit.

In the above-described method for constructing a prokaryotic RNA sequencing library, the amount of prokaryotic RNA extracted is generally selected from conventional sample amounts, and the amount of prokaryotic RNA may be, for example, 0.1 to 2000ng, preferably 0.2 to 1000ng, and more preferably 0.5 to 500 ng.

In the method for constructing a prokaryotic RNA sequencing library, the library construction step can be a second generation sequencing library construction step. Such as breaking, end repairing, adding A, adding joint and library amplifying. The library construction step may also be carried out using a commercial kit, e.g.

Ultra^TM II FS DNA Library Prep Kit、Chromium Next GEM Single Cell 3′Library Kit、Chromium Next GEM Single Cell 5′Library Kit、ThruPLEX DNA-Seq Kit、Regene^TM DNA Library Prep Kit、HIFF^TM DNA Library Preparation Kit、

DNA PCR-Free Prep、

DNA Prep, etc.

In the present invention, the reagent used in the amplification step may be one or more selected from the group consisting of MNase, endonuclease, exonuclease, phosphorylase, DNA polymerase, RNA polymerase, DNA ligase, RNA ligase, primer and buffer system.

According to another aspect of the present application, there is provided a prokaryotic RNA sequencing library, the fragment sequences of which are characterized by comprising at least an RNA sequence or its reverse complement, an elongation sequence or its complement, and a molecular tag or its reverse complement.

According to another aspect of the present application, a method for sequencing a prokaryotic RNA sequencing library is provided, which sequences the library obtained by the method for constructing a prokaryotic RNA sequencing library described above.

Compared with the prior art, the invention realizes a construction method of the low-preference prokaryotic RNA sequencing library. The RNA of prokaryotes is prolonged by adding a specially designed extension sequence with a molecular label to the extracted RNA sequence of prokaryotes. The RNA thus treated can be reverse transcribed directly using a primer reverse complementary to the part of the extended sequence added. Since non-random primers are used, only one cDNA is generated per mRNA molecule during reverse transcription. The molecular tag sequence is added in the extension sequence to mark mRNA sequence, and each mRNA molecule is provided with different molecular tags to further reduce the preference of sequencing result. This allows the construction of low preference prokaryotic RNA libraries. Theoretically, the earlier the molecular tag is labeled, the more accurate the result is. Other methods of library construction using molecular tagged RNA sequencing libraries are to tag mRNA molecules during reverse transcription by tagging with a molecular tagged reverse transcription primer, whereas mRNA molecules are tagged with a molecular tag by extending the sequence prior to reverse transcription. In addition, rRNA does not need to be removed before the reverse transcription step, so that the degradation of the mRNA in the rRNA removal step is avoided, the efficient and stable experimental process is realized, and the method is suitable for application and popularization in various scenes such as scientific research experiments, clinical research and the like.

Drawings

FIG. 1 is a flow chart of an example of a method for constructing a prokaryotic RNA sequencing library,

1-a prokaryotic sample; 2-total RNA extracted; 3-total RNA plus extended sequence; 4-total RNA reverse transcribed; 5-reverse transcribed mRNA; 6-prokaryotic RNA sequencing library.

FIG. 2 is a schematic representation of the mRNA ratios of the library of example 2.

FIG. 3 is a schematic representation of the number of captured genes of example 2.

Detailed description of the invention

Examples

The present invention will be described in further detail with reference to the following drawings and examples. It should be understood that the specific embodiments described herein are for the purpose of illustration and are not to be construed as limitations of the invention.

EXAMPLE 1 construction of sequencing library by culturing E.coli RNA

1. And (4) extracting total RNA.

The cells were collected by centrifugation. Total bacterial RNA was extracted using a Tiangen cultured cell/bacterial total RNA extraction kit (DP 430).

2. The 3' -end of the bacterial RNA was ligated with a specific base sequence (i.e., an extended sequence of this example, a nucleotide sequence shown in SEQ ID No. 3)

2.1 the ligation reaction solution contains: 1 XT 4 RNA Ligase Buffer, 0.5. mu.M 3' end RNA extension sequence (SEQ ID No. 3: 5' -/5rApp/NNNNNNNNNNNNNNNNCTGTCTCTTATACACATCTGACGCTGCCGA/3ddC/-3', 5rApp denotes the 5' end phosphorylated ribonucleotide base A, 3ddC denotes the 3' end blocked deoxyribonucleotide base C, N denotes random base), 15% PEG8000, 1U/. mu.LRNA enzyme inhibitor, 10U/. mu.LT 4 RNA Ligase.

Incubate at 2.24 ℃ for 16 hours. RNA was purified using an RNA purification kit.

3. Reverse transcription and cDNA amplification:

3.1 to the purified RNA of step 2.2 were added: 1 × Template Switching RT Buffer, 5U/. mu.L Template Switching RT Enzyme Mix, 1mM dNTPs, 1mM reverse transcription primer (i.e.reverse transcription primer sequence of this example, SEQ ID No. 4: TCGGCAGCGTCAGATGTGTATAAGAGACAG, which is reverse complementary to part sequence-CTGTCTCTTATACACATCTGACGCTGCCGA of SEQ ID No. 3)，1mM Template switch Oligo (sequence: 5 '-AGGCAGTCTATCAACGCAGTACATRGRGRGRGRGRGRGRGRGRGRGRGRGRG-3', wherein the tail 3 bases are ribonucleic acid G for realizing a Template switching reaction), 1U/. mu.LRNA enzyme inhibitor.

3.2 the reaction mixture was placed in a PCR instrument and the reverse transcription program was run: 1 hour at 53 ℃ and 5 minutes at 85 ℃. The reverse transcribed cDNA was purified using Ampure XP magnetic beads.

3.3 addition of cDNA amplification solution: 500nM amplimer 1 (sequence: 5'- [ phosphorylated ] TCGTCGGCAGCGTCAGATGT-3'), 500nM amplimer 2 (sequence: 5'-AGGCAGTCTATCAACGCAGTAC-3'), 1 XKAPA HiFi HotStart ReadyMix. Mixing, and placing into a PCR instrument.

3.4 run PCR program:

steps 2-4 were performed for 10 cycles.

3.5 purification of the amplified cDNA using Ampure XP magnetic beads.

4. Removing rRNA:

4.1 digesting the cDNA amplified in the previous step with lambda exonuclease to obtain single-stranded cDNA.

4.2 removal of single-stranded cDNA reverse-transcribed from rRNA using Illumina Ribo-Zero gram-negative rRNA removal kit. Most of the product remained after removing the single-stranded cDNA generated by reverse transcription of rRNA is the single-stranded cDNA generated by reverse transcription of mRNA.

4.3 amplification primer 3 sequence: 5'-TCGTCGGCAGCGTCAGATGT-3') and Bst DNA polymerase to restore the single-stranded cDNA to double-stranded cDNA.

5. Adding a sequencing adaptor and amplifying a library:

5.1cDNA interruption, end repair and addition of A. mu.L of amplified cDNA was taken, 2. mu.L of EBNext Ultra II FS Enzyme Mix and 7. mu.L of NEBNext Ultra II FS Reaction Buffer were added, mixed and placed in a PCR instrument. 5 minutes at 37 ℃ and 30 minutes at 65 ℃.

5.2 connecting head: to the reaction product of the previous step was added 30. mu.L of NEBNext Ultra II Ligation Master Mix, 1. mu.L of NEBNext Ligation Enhancer, 2.5. mu.L of read2 adaptor (final concentration: 1. mu.M. generated by gradient annealing of the upper oligonucleotide (SEQ ID: 5'- - [ phosphorylated ] GATCGGAAGAGCACACGTCTGAACTCCAGTC-3') and the lower oligonucleotide (SEQ ID: 5'-CTTCCGATCT-3')), and incubated at 20 ℃ for 15 minutes. Purification was performed using Ampure XP magnetic beads.

6.3 library amplification: to the reaction product of the previous step was added library primer 1, library primer 2, 1 XKAPA HiFi HotStart ReadyMix. Mixing, and placing into a PCR instrument.

(library primer 1 final concentration 500nM, sequence: 5'-AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAG-3',

library primer 2 final concentration 500nM, sequence: 5'-CAAGCAGAAGACGGCATACGAGAT (i7 index) GTGACTGGAGTTCAGACG-3'. i7 index is 2-20bp base for splitting library from sequencing data)

The following procedure was run:

steps 2-4 were performed for 10 cycles.

6.4 purification of the amplified library using Ampure XP magnetic beads. Library quality testing was performed using TapeStation.

Example 2 sequencing and data analysis of the files obtained in example 1

1. PE100 paired-end sequencing was performed using the Illumina NextSeq platform. Wherein, the first 16 bits of the sequencing data read by the read1 are molecular tags, and 16-100 bits are reverse complementary sequences of the original mRNA; the sequencing data read from read2 was the forward sequence of the original mRNA.

2. After the 16-100 bit data of the read1 are reversely complemented, the read is simultaneously aligned with the data of the read2 to a reference genome, and the sequencing result of each aligned gene in the reference genome is counted. And (4) counting the comparison conditions of the molecular tags and the corresponding sequencing results, and combining all the sequencing results which have the same molecular tag and are compared with the same gene into one expression frequency. And (4) inducing the expression times of all genes to generate a sequencing result.

3. And (6) summarizing the result.

3.1 ratio (%) of mRNA in the library, as shown in FIG. 2.

For comparison, the data published for EMBR-seq showed 77-82% of library mRNA in the same sample starting amount.

3.2 Capture Gene number, as shown in FIG. 3.

In contrast, the same sample starting amount of library capture gene in the data published by EMBR-seq is 3200-3800.

According to the present invention, the detection of RNA can be carried out on a sample of a prokaryote. Further, the differences in RNA sequence, type and expression level between different cells can be compared. Differences between these cells include, but are not limited to: different species sources, different host sources, different environmental sources, different prokaryotic species, different cell cycles, different developmental stages, different culture conditions, different processing conditions, different individual prokaryotes.

According to the present invention, the study of cellular properties or functions, as well as chromatin conformation, DNA, RNA and protein functions, can be used in combination with other methods of studying DNA, RNA, proteins. These other methods of studying DNA, RNA, proteins include, but are not limited to: single cell sequencing, gene ChIP, QPCR, first-generation sequencing, second-generation sequencing, third-generation sequencing, fourth-generation sequencing, gene sequencing, genome sequencing, metagenome sequencing, exon sequencing, intron sequencing, Target gene capture sequencing, RNA sequencing, expression profile sequencing, transcriptome sequencing, small RNA transcriptome, micro RNA sequencing, macrotranscriptome sequencing, LncRNA sequencing, tumor gene sequencing, tumor genome sequencing, Bisulfit methylation sequencing, ChIP-DNA sequencing, MeDIP sequencing, RRBS sequencing, Target-BS sequencing and hmC sequencing.

The invention has application potential in etiological research, prevention, diagnosis, treatment, rehabilitation guidance, detection and prognosis of infectious diseases, pathogen infection, infectious inflammation, oral diseases such as dental caries, plaque gingivitis, periodontitis, pericoronitis of wisdom tooth, necrotizing ulcerative gingivitis, angina and other diseases.

It should be noted that any feature or combination of features described as part of one embodiment in this specification can be applied to other embodiments as well, without significantly departing from the spirit of the invention; further, the technical features described as the constituent elements of the different technical aspects may be combined in any manner to constitute the other technical aspects, without significantly departing from the gist of the present invention. The present invention also includes technical means obtained by combining the above cases, and these technical means are described in the present specification.

While the foregoing description shows and describes the preferred embodiments of the present invention, it is to be understood that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as described herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention, as defined by the appended claims.

Claims (8)

1. A method for constructing a prokaryotic RNA sequencing library, the method comprising the steps of:

obtaining RNA: extracting a prokaryotic RNA sequence;

adding an extension sequence: adding a nucleotide sequence shown as SEQ ID No.1 at the 3' end of the RNA sequence to obtain an extended RNA sequence;

reverse transcription: carrying out reverse transcription on the extended RNA sequence by adopting a nucleotide sequence shown as SEQ ID No.2 to obtain a cDNA sequence;

building a library: the cDNA sequence was used to construct a library for sequencing.

2. The method of claim 1, wherein the step of reverse transcribing is followed by a step of removing rRNA.

3. The method according to claim 1, wherein the extracted prokaryotic RNA has a mass of 0.1-2000 ng, preferably a mass of 0.2-1000 ng, more preferably a mass of 0.5-500 ng.

4. The method of claim 1, wherein the amino acid sequence of SEQ ID NO: 1, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, even more preferably the proportion of ribonucleotides is 0 to 25%, even more preferably the proportion of ribonucleotides is 0 to 10%, most preferably the proportion of ribonucleotides is 0, i.e. when the nucleotide sequence shown in SEQ ID NO: 1 each of which consists of deoxyribonucleotides.

5. The method of claim 1, wherein the amino acid sequence of SEQ ID NO: 2, preferably the proportion of ribonucleotides is 0 to 80%, more preferably the proportion of ribonucleotides is 0 to 50%, further preferably the proportion of ribonucleotides is 0 to 25%, further preferably the proportion of ribonucleotides is 0 to 10%, and most preferably the proportion of ribonucleotides is 0.

6. The method of claim 1, wherein the amplified cDNA sequence is obtained by PCR of the cDNA sequence after the reverse transcription step.

7. A prokaryotic RNA sequencing library obtained by the method of any one of claims 1-6, comprising at least an RNA sequence or its reverse complement, an elongation sequence or its complement, and a molecular tag or its reverse complement.

8. A method of sequencing a prokaryotic RNA sequencing library by sequencing the library constructed by the method of any one of claims 1-6.

Images