CN114657252A - Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof - Google Patents

Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof Download PDF

Info

Publication number
CN114657252A
CN114657252A CN202210450323.5A CN202210450323A CN114657252A CN 114657252 A CN114657252 A CN 114657252A CN 202210450323 A CN202210450323 A CN 202210450323A CN 114657252 A CN114657252 A CN 114657252A
Authority
CN
China
Prior art keywords
ccl18
glioma
gene
protein
prognosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202210450323.5A
Other languages
Chinese (zh)
Inventor
李继喜
李媛媛
高文青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fudan University
Original Assignee
Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fudan University filed Critical Fudan University
Priority to CN202210450323.5A priority Critical patent/CN114657252A/en
Publication of CN114657252A publication Critical patent/CN114657252A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863—Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52—Assays involving cytokines
    • G01N2333/521—Chemokines
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biological diagnosis and medicine, and particularly relates to application of an expression product of a glioma marker gene in preparation of a detection kit for diagnosis, screening and/or prognosis of glioma. The research of the invention shows that the mRNA and protein level of the tumor tissue CCL18 of a glioma patient are obviously higher than those of healthy people, and the gene and/or the expression product of the gene are obviously related to the disease condition and prognosis of the patient. Therefore, the CCL18 gene and the expression product thereof can be used as molecular markers for prognosis evaluation and treatment effect and applied to reagents for disease condition and prognosis evaluation of glioma patients. The invention also provides a detection kit for glioma diagnosis, screening and/or prognosis, which comprises a detection reagent for detecting the expression quantity of the CCL18 protein in a sample.

Description

Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof
Technical Field
The invention belongs to the technical field of biological diagnosis and medicine, and particularly relates to a potential glioma biomarker CCL18 gene function and application thereof, including application of CCL18 in diagnosis, treatment and prognosis of malignant glioma.
Background
Glioblastoma (GBM) is the most common primary malignancy in the adult brain and central nervous system, with very high morbidity and mortality due to lack of effective early diagnosis and treatment, and is considered one of the most intractable tumors in neurosurgery. The 2016 World Health Organization (WHO) classified gliomas as grade i to IV. Wherein GBM is used as IV grade glioma, the malignancy degree is highest, the progression is fast, the recurrence is easy, the median overall survival time (OS) of a patient is about 8 months, and the five-year survival rate is only about 6.8%. The high invasiveness of the GBM cells, the tolerance to chemotherapy and radiotherapy, the high-level vascularization of brain tissues around glioma, complex tumor microenvironment, difficult infiltration of chemotherapeutic drugs due to blood brain barrier and the like lead to poor surgical excision, radiotherapy and chemotherapy effect on glioma. In recent years, new treatments have been developed which may improve the quality of life of GBM patients, but do not significantly improve the overall survival of GBM patients. Therefore, the search of tumor markers and therapeutic targets with index significance in glioma tissues is of great significance to the diagnosis and treatment of patients.
The Tumor Microenvironment (TME) is one of the key factors in GBM development and treatment and is the primary site of interaction between tumor cells and the host immune system. Through the interaction between chemokines and chemokine receptors, different subsets of immune cells are recruited into the TME. Depending on the first two cysteine (C) residue positions in the protein sequence, the cell chemokines can be classified into four categories: CC-chemokines, CXC-chemokines, C-chemokines and CX 3C-chemokines. Chemokines have a significant impact on tumor growth, metastasis, progression and prognosis. Wherein CCL18 (C-C Motif Chemokine Ligand 18)Mainly produced by Antigen Presenting Cells (APC), to naive T cells, CD4+And CD8+T cells and unactivated lymphocytes have chemotactic activity and thus may play a role in humoral and cellular immunity. Studies found that high risk GBM patients showed higher CCL18 expression levels, which correlates with high levels of Tim-3, suggesting a correlation between chemokine-mediated immune cell infiltration and GBM prognosis. More and more studies have shown that chemokines can directly affect cancer cell proliferation, thereby modulating tumor progression, or affect tumor growth and metastasis by indirectly modulating immune cell recruitment.
Disclosure of Invention
The invention aims to provide an application of a chemokine CCL18 in prediction of glioma prognosis.
The research of the invention shows that the CCL18 is obviously highly expressed in glioma and can be used for the auxiliary diagnosis of glioma; the high-expression CCL18 gene and protein are related to the poor prognosis of glioma, and the CCL18 gene and the expression product thereof can be used as molecular markers for prognosis evaluation and treatment effect.
According to the invention, the mRNA expression levels of the CCL18 gene in glioblastoma multiforme (GBM) tissues (Tumor) and Normal tissues (Normal) are detected by a bioinformatics analysis method, and the difference of the mRNA expression of the CCL18 gene in glioblastoma multiforme tissues (Tumor) and Normal tissues (Normal) is shown, so that the average expression level of the CCL18 in cancer tissues is obviously higher than that in Normal tissues.
The correlation between the CCL18 mRNA level and the GBM patient overall survival time is analyzed by a Cox regression method, compared with a patient with CCL18 gene low expression, the GBM patient overall survival time (OS), disease specific survival time (DSS) and progression-free survival time (PFI) with CCL18 high expression are obviously reduced, and the indication that an expression product of the CCL18 gene can be used as a GBM prognostic marker is provided. By detecting the expression of the CCL18 gene, the prognosis of GBM patients can be assessed, suggesting the potential survival time of patients, and at the same time, can be used to assess the therapeutic effect of GBM. More significantly, compared with the other 34 chemokines, CCL18 has a higher risk ratio (HR) of overall survival rate of GBM patients, i.e., the overall survival rate of GBM patients with high CCL18 expression is shorter, which suggests that CCL18 can be used as a molecular marker for GBM diagnosis and prognosis with more accuracy.
The combination of ROC curve analysis shows that the area under the curve (AUC) values of the CCL18 gene applied to GBM total survival (OS), Disease Specific Survival (DSS) and progression free survival (PFI) diagnosis are all higher than 0.6 in the 1-year prediction period, and the CCL18 gene has high specificity and high sensitivity when being used as a glioblastoma diagnosis and prognosis marker. By detecting the CCL18 gene expression, the prognosis of the patient with glioblastoma is evaluated in time, and the method has guiding significance for adjusting clinical treatment strategies, further improving the clinical treatment effect and improving the life quality of the patient.
Accordingly, the application of the chemokine CCL18 in prediction of glioma prognosis specifically comprises the application of providing an expression product of a glioma marker CCL18 gene and/or CCL18 gene in preparation of a detection reagent for glioma diagnosis, screening and/or prognosis. The sequence of the CCL18 gene is shown as SEQ ID NO. 1.
Optionally, the expression product of the glioma marker CCL18 gene comprises CCL18 mRNA and/or CCL18 protein. The CCL18 protein sequence is shown in SEQ ID NO. 2.
The invention also provides a detection kit for glioma diagnosis, screening and/or prognosis.
The detection kit comprises: the kit comprises a pretreatment reagent for pretreating a sample to be detected to obtain a sample, and a detection reagent for detecting the expression level of the CCL18 protein in the sample.
In the present invention, the detection reagent includes: an antibody that specifically recognizes/binds to an expression product of the CCL18 gene.
The antibody comprises a monoclonal antibody, a polyclonal antibody or a nano antibody; monoclonal antibodies are preferred.
The antibody which specifically recognizes/binds to an expression product of a CCL18 gene can recognize a human full-length CCL18 protein, and the affinity reaches 20pg/mL or higher.
The detection reagent specifically comprises: tissue lysate, a 96-well plate coated by a specific antibody of CCL18 protein, CCL18 protein standard sample freeze-dried powder, a standard sample diluent, a biotin-coupled secondary antibody, a biotin-coupled antibody diluent, peroxidase (HRP) -labeled streptavidin, a streptavidin diluent, a Trimethylbenzene (TMB) substrate solution, a reaction terminator, a washing buffer and the like.
In addition, the detection kit further comprises: a label or instructions for use; the label or the instruction indicates that the kit is used for predicting prognosis of glioma and the like. Reagents for quantifying CCL18 protein can function based on known methods of immunology: for example, western blot, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, immunohistochemistry, immunofluorescent labeling, etc., CCL18 protein was quantitatively detected.
In the invention, the sample to be detected is brain tissue of a glioma patient.
In the invention, the glioma comprises I-IV grade glioma in WHO 2016 glioma classification.
In the present invention, the protein coding region (CDS) sequence of human CCL18 Gene can be referred to the national center for Biotechnology information (NIH) Gene ID:6362 (NM-002988), and the specific sequence is as follows:
atgaagggccttgcagctgccctccttgtcctcgtctgcaccatggccctctgctcctgtgcacaagttggtaccaacaaagagctctgctgcctcgtctatacctcctggcagattccacaaaagttcatagttgactattctgaaaccagcccccagtgccccaagccaggtgtcatcctcctaaccaagagaggccggcagatctgtgctgaccccaataagaagtgggtccagaaatacatcagcgacctgaagctgaatgcctga（SEQ ID NO：1）。
according to the gene sequence of CCL18, the CCL18 protein sequence is referred to UniProt database ID: P55774, and the specific sequence is as follows:
MKGLAAALLVLVCTMALCSCAQVGTNKELCCLVYTSWQIPQKFIVDYSETSPQCPKPGVILLTKRGRQICADPNKKWVQKYISDLKLNA（SEQ ID NO：2）。
furthermore, the person skilled in the art knows how to obtain an antibody specifically recognizing/binding CCL18 protein, e.g. an antibody specifically recognizing CCL18 protein (with an affinity of up to 20pg/mL or more) can be obtained by using the full-length CCL18 protein or a partial protein sequence thereof as an antigen, e.g. an immunized animal such as a mouse, a rabbit or an alpaca, etc. The antibody is a monoclonal antibody, a polyclonal antibody or a nanobody, preferably a monoclonal antibody. The antibody may be prepared by itself, or a commercial recognition CCL18 antibody and enzyme-linked immunoreaction kit, such as human CCL18 ELISA kit (cat. No.: RK 00247) from Abclonal may be purchased.
The research of the invention shows that the higher the expression of the CCL18 gene or protein level is, the lower the survival rate of a glioma patient is, namely the over-expression of the CCL18 gene or protein clearly indicates the poorer survival prognosis of the patient, which indicates that the CCL18 gene and/or the expression product thereof can be used as a prognosis marker of the glioma and is used for predicting the prognosis of the patient.
In conclusion, the invention provides a new theoretical basis and a new target for glioma treatment, and also provides a new auxiliary diagnosis and prognosis diagnosis method and a new therapeutic drug for glioma.
The technical scheme of the invention is summarized as follows:
1. the application of the expression product of the glioma marker CCL18 gene and/or CCL18 gene in the preparation of a detection kit for glioma diagnosis, screening and/or prognosis;
the glioma comprises I-IV stage glioma in WHO 2016 glioma classification;
the expression product of the glioma marker CCL18 gene comprises CCL18 mRNA and/or CCL18 protein.
2. A kit for diagnosis and prognosis of glioma, said kit comprising the following components: antibodies useful for specifically recognizing/binding the CCL18 gene expression product;
the antibody specifically recognizing/combining the CCL18 gene expression product in the kit is a monoclonal antibody, a polyclonal antibody or a nano antibody. The antibody has the following characteristics: the human full-length CCL18 protein can be identified, and the affinity reaches 20pg/mL or higher;
the enzyme-linked immunosorbent assay kit for specifically recognizing/combining the expression product of the CCL18 gene in the kit is a human CCL18 ELISA kit (cargo number: RK 00247) of Abclonal company;
the kit quantitatively detects the CCL18 protein by immunological means, such as Western blotting, enzyme-linked immunosorbent assay, radioimmunoassay, immunohistochemistry method, immunofluorescence labeling method and the like.
Drawings
FIG. 1 shows the expression levels (A-B) of mRNA of 41 chemokines provided in example 1 of the present invention in Normal tissue (Normal) and glioblastoma tissue (Tumor); the lower grade in the WHO classification (G2 & G3) contrasts with expression in glioblastoma (GBM, G4) (C-D).
FIG. 2 is a forest diagram of survival analysis of the effect of the expression levels of 35 chemokine genes on Overall Survival (OS) of glioblastoma multiforme (GBM) patients, as provided in example 2 of the present invention.
FIG. 3 is a survival analysis curve showing the effect of the expression level of the chemokine CCL18 gene on the Overall Survival (OS) of glioblastoma multiforme (GBM) patients, according to example 2 of the present invention.
FIG. 4 is a survival analysis curve showing the effect of CCL18 gene expression level on GBM patient disease-specific survival (DSS) and progression-free survival (PFI) provided in example 3 of the present invention.
FIG. 5 is a survival analysis curve showing the effect of CCL18 gene expression level on the Overall Survival (OS) of GBM patients in the China glioma genomic map (CCGA) database, provided in example 4 of the present invention.
FIG. 6 is a time-dependent ROC curve of CCL18 gene expression level for detecting OS, DSS and PFI of glioblastoma multiforme provided in example 5 of the present invention.
Fig. 7 is a quantitative analysis of the relative expression level of CCL18 protein in different glioma malignant degree (a), different IDH1 gene status (B) and a survival analysis curve (C) of the effect of CCL18 protein expression level on overall survival of glioma patients in clinical glioma samples provided in example 6 of the present invention.
Detailed Description
The invention is further illustrated below with reference to specific embodiments and the accompanying drawings. In the following examples, the reagents and starting materials used in the experimental procedures, which are not specified under specific conditions, are generally commercially available according to the conventional techniques in the art.
The reagents involved in the following examples are as follows:
RIPA lysate was purchased from Beyotime (cat # P0013B); bradford protein concentration assay kit (detergent compatible type) was purchased from Beyotime corporation (cat # P0006C); the CCL18 protein ELISA kit was purchased from Abclonal (cat. No.: RK 00247).
Example 1
The present embodiment provides a method for detecting the expression level of mRNA of 41 chemokine genes in Normal tissue (Normal) and glioblastoma tissue (Tumor) by bioinformatics analysis, specifically including the following steps:
41 chemokine mRNA expression profiles in normal and GBM tumor tissues were downloaded on the TCGA database (https:// portal. gdc. cancer. gov /) and the GTEx database (http:// gtexport. org/home /). The difference in the expression level of CCL18 in normal tissues and cancer tissues was examined by Wilcoxon rank sum test.
The correlation between chemokine gene expression and clinical different WHO grades of glioma was examined by Kruskal-Wallis test on 41 chemokine mRNA information and patient information from the TCGA database in glioma tissues.
FIG. 1 shows the differential expression of mRNA of 41 chemokines in Normal (Normal) and glioma tissues (Tumor) (A-B), and the comparison of the expression in WHO classification of II-III gliomas (G2 & G3) and IV grade glioblastomas (GBM, G4) (C-D). As can be seen from fig. 1, CCL18 is significantly higher in the expression level in cancer tissues than in normal tissues, and significantly increases in the mRNA level in grade iv glioblastoma species, which are more malignant.
Example 2
In this example 2, 35 chemokine mRNA information and patient information in GBM cancer tissues obtained by the TCGA database were analyzed for correlation between the levels of each chemokine mRNA and the overall survival time of the patient by Cox regression method, to obtain a survival analysis forest map as shown in fig. 2; the survival analysis curve of the effect of the chemokine CCL18 mRNA level on Overall Survival (OS) in patients is shown in figure 3.
As can be seen from fig. 2 and 3, the risk ratio (HR) of the overall survival rate of Glioblastoma (GBM) patients with high CCL18 gene expression is significantly higher than that of GBM patients with low CCL18 expression (P < 0.01), suggesting that the expression product of CCL18 gene can be used as a prognostic marker of GBM, and by detecting the CCL18 gene expression, the prognosis and potential survival time of GBM patients can be evaluated, and the therapeutic effect of GBM can be evaluated. In particular, CCL18 showed a higher HR overall survival for GBM patients compared to the other 34 chemokines, i.e., the overall survival for GBM patients with high CCL18 expression was shorter, suggesting that CCL18 could be a more accurate molecular marker for GBM diagnosis and prognosis.
Example 3
Using the CCL18 mRNA level in GBM cancer tissue obtained from TCGA database in example 2 and patient information, the correlation of CCL18 gene expression level with disease-specific survival (DSS) and progression-free survival (PFI) was analyzed by Kaplan-Meier curve and log-rank detection, resulting in a survival analysis curve as shown in fig. 4.
As can be seen from fig. 4, the disease-specific survival rate (DSS) and the tumor progression-free survival rate (PFI) of the glioblastoma patients with high CCL18 gene expression (GBM) were significantly lower than those of the GBM patients with low CCL18 gene expression (P < 0.01) at the same survival time, and it was further verified that the expression product of the CCL18 gene could be used as a prognostic marker for GBM. The detection of the CCL18 gene expression can evaluate the GBM prognosis in time, and has guiding significance for adjusting clinical treatment strategies, further improving clinical treatment effects and improving the quality of life of patients.
Example 4
CXCL18 gene expression information and patient information in glioblastoma were obtained from the CCGA database (http:// www.cgga.org.cn /), and the correlation of CCL18 gene expression level with Overall Survival (OS) was analyzed by Kaplan-Meier curve and log-rank test to obtain a survival analysis curve as shown in FIG. 5, with the horizontal axis representing total survival time (days) and the vertical axis representing survival rate.
As can be seen from fig. 5, the total survival rate of GBM patients with high CCL18 gene expression was significantly lower than that of GBM patients with low CCL18 gene expression (P < 0.01) at the same survival time, and it was confirmed that the expression product of CCL18 gene had accurate diagnostic significance in glioblastoma.
Example 5
The present embodiment aims to provide a method for evaluating CCL18 gene expression level for glioma diagnosis value, specifically comprising the following steps: the GBM patient information obtained from the TCGA database in example 2 was edited and analyzed by software to obtain a time-dependent roc (receiver operator characteristic curve) (fig. 6).
The software is R (3.6.3 version), wherein the R packet used for statistical analysis is timeROC (0.4 version), and the R packet used for data visualization is ggplot2 (3.3.3 version).
The ROC curve is an image showing the relationship between true positive rate (sensitivity, or sensitivity, TPR) and False Positive Rate (FPR). A good classification model, in the present context a reliable cancer marker, should be as close as possible to the upper left corner of the ROC curve. Meanwhile, the area under the curve (AUC) can also evaluate the model, the greater the AUC, the higher the diagnostic accuracy.
As shown in fig. 6, the areas under ROC curves (AUC) for OS, DSS and PFI of GBM patients were 0.631, 0.647 and 0.629, respectively, at the predicted age of 1 year; the areas under the ROC curves (AUC) for OS, DSS, PFI of GBM patients were 0.572, 0.575, 0.650, respectively, at the predicted age of 2 years. Therefore, CCL18 has high specificity and high sensitivity as a GBM diagnosis and prognosis marker and is an ideal target for GBM early molecular diagnosis and disease risk screening.
Example 6
CCL18 is highly expressed in glioma with high malignancy, and the high level of protein expression is related to poor prognosis of patients.
1. Study object
Subjects selected 72 clinical samples of glioma patients, WHO rated class II 15, class III 14, and class IV 43, and the study was reviewed and approved by the hospital ethics committee and all patients were informed on written notice prior to enrollment.
2. And detecting the expression quantity of the CCL18 protein in a clinical glioma sample by enzyme-linked immunosorbent assay.
The clinical glioma tissues are crushed into tissue homogenate by a tissue crusher, then the cells of each component are crushed by RIPA cell lysate, the proteins are dissolved, and the total amount of the proteins is quantitatively adjusted by using a BCA protein quantitative kit under the same conditions, and then ELILSA detection and analysis are carried out. The method comprises the following specific steps:
washing the antibody-coated pore plate for 3 times by using a washing solution buffer solution, adding a to-be-detected tissue lysate, using CCL18 with different concentrations as a control, and incubating for 2 h at 37 ℃ after sealing; washing for 3 times by using a washing buffer solution, adding the diluted biotin coupling antibody, and incubating for 1 h at 37 ℃ after sealing; washing with washing buffer solution for 3 times, adding diluted HRP-labeled streptavidin solution, sealing, and incubating at 37 ℃ for 30 min; washing with washing buffer solution for 3 times, adding TMB substrate solution, sealing, and incubating at 37 deg.C for 20 min in dark; then adding a reaction terminator, detecting the absorbance at 450 nm within 5min, and carrying out relative quantification by comparing with a standard product. Statistical analysis was performed in conjunction with patient clinical information and the results obtained are shown in figure 6.
Clinical significance of CCL18 protein overexpression.
A Kalpan-Meier method is adopted to draw a survival analysis curve, and the statistical significance of the survival analysis curve is detected by a log-rank method. The detection coefficient P < 0.05 was statistically significantly different. And (3) R package: survival package (versions 3.2-10) statistical analysis of survival data for the relationship of CCL18 protein expression to Overall Survival (OS) in glioma patients. CCL18 protein overexpression and underexpression were delineated by the median level of CCL18 protein expression levels in the samples. The correlation between the CCL18 protein expression level and glioma level and IDH1 mutation is analyzed by combining different grades of clinical glioma patients and IDH1 gene mutation information and applying a t test of GraphPad Prism 7 software, and the result is shown in FIG. 7.
As can be seen from fig. 7, in the glioblastoma (G4) tissue with higher malignancy, the CCL18 protein expression level was significantly higher than that in the lower grade glioma tissue (G2 & G3), and CCL18 was highly expressed in IDH1 wild-type glioma. IDH1 wild-type was associated with poor prognosis, suggesting that CCL18 protein levels were positively correlated with glioma malignancy. In addition, the overall survival rate (OS) of glioma patients with over-expression of CCL18 protein was significantly reduced in 72 glioma tissues. In conclusion, the CCL18 protein has high expression level and can be used as a marker for poor prognosis of glioma.
The above-mentioned embodiments are only preferred embodiments of the present invention, and the description thereof is specific, but not construed as limiting the scope of the invention. It will be appreciated by those skilled in the art that variations and modifications may be made without departing from the principles of the invention, which is intended to be within the scope of the invention.
Sequence listing
<110> university of Compound Dan
<120> chemokine for diagnosis and prognosis of brain malignant glioma and application thereof
<130> 001
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 270
<212> DNA
<213> Homo sapiens
<400> 1
atgaagggcc ttgcagctgc cctccttgtc ctcgtctgca ccatggccct ctgctcctgt 60
gcacaagttg gtaccaacaa agagctctgc tgcctcgtct atacctcctg gcagattcca 120
caaaagttca tagttgacta ttctgaaacc agcccccagt gccccaagcc aggtgtcatc 180
ctcctaacca agagaggccg gcagatctgt gctgacccca ataagaagtg ggtccagaaa 240
tacatcagcg acctgaagct gaatgcctga 270
<210> 2
<211> 89
<212> PRT
<213> Homo sapiens
<400> 2
Met Lys Gly Leu Ala Ala Ala Leu Leu Val Leu Val Cys Thr Met Ala
1 5 10 15
Leu Cys Ser Cys Ala Gln Val Gly Thr Asn Lys Glu Leu Cys Cys Leu
20 25 30
Val Tyr Thr Ser Trp Gln Ile Pro Gln Lys Phe Ile Val Asp Tyr Ser
35 40 45
Glu Thr Ser Pro Gln Cys Pro Lys Pro Gly Val Ile Leu Leu Thr Lys
50 55 60
Arg Gly Arg Gln Ile Cys Ala Asp Pro Asn Lys Lys Trp Val Gln Lys
65 70 75 80
Tyr Ile Ser Asp Leu Lys Leu Asn Ala
85

Claims (9)

1. The application of the expression product of the glioma marker gene in the preparation of a detection reagent for glioma diagnosis, screening and/or prognosis; the sequence of the CCL18 gene is shown as SEQ ID NO. 1.
2. The use according to claim 1, wherein the expression product of the glioma marker CCL18 gene is CCL18 mRNA and/or CCL18 protein; the sequence of the CCL18 protein is shown as SEQ ID NO. 2.
3. A test kit for diagnosis, screening and/or prognosis of glioma, comprising: the kit comprises a pretreatment reagent for pretreating a sample to be detected to obtain a sample, and a detection reagent for detecting the expression level of the CCL18 protein in the sample; the CCL18 protein sequence is shown as SEQ ID NO. 2.
4. The test kit according to claim 3, wherein the test reagent comprises: an antibody that specifically recognizes/binds to an expression product of CCL18 gene.
5. The detection kit according to claim 4, wherein the antibody comprises a monoclonal antibody, a polyclonal antibody or a nanobody.
6. The detection kit of claim 5, wherein the antibody specifically recognizing/binding to the expression product of CCL18 gene recognizes human full-length CCL18 protein with an affinity of 20pg/mL or higher.
7. The test kit according to one of claims 3 to 6, the test reagents comprising in particular: the kit comprises tissue lysate, a 96-well plate coated by a specific antibody of CCL18 protein, CCL18 protein standard sample freeze-dried powder, a standard sample diluent, a biotin-coupled secondary antibody, a biotin-coupled antibody diluent, peroxidase-labeled streptavidin, a streptavidin diluent, a trimethylbenzene substrate solution, a reaction terminator and a washing buffer solution.
8. The detection kit according to claim 7, further comprising: a label or instructions for use; the label or instructions indicate that the kit is used for predicting prognosis of glioma and the like; reagents for quantifying CCL18 protein can function based on known methods of immunology: comprises the quantitative detection of the CCL18 protein by using western blotting, enzyme-linked immunosorbent assay, radioimmunoassay, immunohistochemistry method and immunofluorescence labeling method.
9. The detection kit according to claim 7, wherein the sample to be tested is brain tissue of a glioma patient.
CN202210450323.5A 2022-04-26 2022-04-26 Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof Pending CN114657252A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210450323.5A CN114657252A (en) 2022-04-26 2022-04-26 Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210450323.5A CN114657252A (en) 2022-04-26 2022-04-26 Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof

Publications (1)

Publication Number Publication Date
CN114657252A true CN114657252A (en) 2022-06-24

Family

ID=82037224

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210450323.5A Pending CN114657252A (en) 2022-04-26 2022-04-26 Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof

Country Status (1)

Country Link
CN (1) CN114657252A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090215053A1 (en) * 2005-10-19 2009-08-27 Inserm (Institut National De La Sante Et De La Recherche Medicale) Vitro Method for the Prognosis of Progression of a Cancer and of the Outcome in a Patient and Means for Performing Said Method
US20180330049A1 (en) * 2016-01-22 2018-11-15 The Trustees Of Columbia University In The City Of New York Methods for classification of glioma
CN113234815A (en) * 2021-03-18 2021-08-10 西北大学 Application of lncRNA molecule in GBM

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090215053A1 (en) * 2005-10-19 2009-08-27 Inserm (Institut National De La Sante Et De La Recherche Medicale) Vitro Method for the Prognosis of Progression of a Cancer and of the Outcome in a Patient and Means for Performing Said Method
US20180330049A1 (en) * 2016-01-22 2018-11-15 The Trustees Of Columbia University In The City Of New York Methods for classification of glioma
CN113234815A (en) * 2021-03-18 2021-08-10 西北大学 Application of lncRNA molecule in GBM

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JORDI BERENGUER: "Glycosylated extracellular vesicles released by glioblastoma cells are decorated by CCL18 allowing for cellular uptake via chemokine receptor CCR8", JOURNAL OF EXTRACELLULAR VESICLES, vol. 7, no. 1, pages 1 - 23 *
YIMIN HUANG: "Microglia/macrophage-derived human CCL18 promotes glioma progression via CCR8-ACP5 axis analyzed in humanized slice model", CELL REPORTS, vol. 39, no. 2, pages 1 - 23 *
韩瑞: "临床生物化学检验技术", 华中科技大学出版社, pages: 33 - 35 *

Similar Documents

Publication Publication Date Title
CN111337678B (en) Biomarker related to tumor immunotherapy effect and application thereof
Xu et al. Multifunctional neuron-specific enolase: its role in lung diseases
US20110201517A1 (en) Autoantigen biomarkers for early diagnosis of lung adenocarcinoma
CN112362871B (en) Biomarker for esophageal cancer and application thereof
US20190317087A1 (en) Novel assay
JP2019532260A (en) Determination of non-human mammal TK1 protein levels
CN115877006B (en) Ovarian cancer-related biomarker and application thereof
AU2016273230B2 (en) Biomarkers for a combination therapy comprising lenvatinib and everolimus
AU2016297676B2 (en) Biomarker combinations for prostate disease
EP2569637B1 (en) Methods for the diagnosis and prognosis of a tumor using bcat1 protein
CN114657252A (en) Chemotactic factor for diagnosis and prognosis of brain malignant glioma and application thereof
CN115372616A (en) Gastric cancer related biomarker and application thereof
KR102131860B1 (en) Biomarker Composition for Diagnosing Colorectal Cancer Specifically Binding to Arginine-methylated Gamma-glutamyl Transferase 1
AU2017248061A1 (en) Methods and kits for predicting the sensitivity of a subject suffering of renal cancer to cancer treatment
KR102128251B1 (en) Biomarker Composition for Diagnosing Colorectal Cancer Specifically Binding to Arginine-methylated Dopamine Receptor D2
US20230266331A1 (en) Use of antigen combination for detecting autoantibodies in lung cancer
Li et al. Autoantibodies against Endophilin A2 as a novel biomarker are beneficial to early diagnosis of breast cancer
EP4359800A1 (en) Predicting cancer relapse
TWI525101B (en) Peptides for detecting survivin antibody
WO2023230584A1 (en) Methods and systems for risk stratification and management of bladder cancer
CN115038969A (en) Predicting patient survival
CN114174827A (en) Method for diagnosing colorectal cancer
CN116413430A (en) Autoantibody/antigen combination and detection kit for early prediction of liver cancer
CN113933509A (en) Antibody assay
EP3756013A1 (en) Immunological method and kit for in vitro diagnosis of tumour and/or inflammatory diseases

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20220624