CN114645006B - High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production - Google Patents
High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production Download PDFInfo
- Publication number
- CN114645006B CN114645006B CN202011516662.6A CN202011516662A CN114645006B CN 114645006 B CN114645006 B CN 114645006B CN 202011516662 A CN202011516662 A CN 202011516662A CN 114645006 B CN114645006 B CN 114645006B
- Authority
- CN
- China
- Prior art keywords
- bacillus coagulans
- lactic acid
- ljldh
- glucose
- dehydrogenase gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/56—Lactic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01028—D-Lactate dehydrogenase (1.1.1.28)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Abstract
The application discloses a high sugar-resistant lactic acid production strain and application thereof in D-lactic acid production. The application provides bacillus coagulans G35, which has a preservation number of CGMCC No.21293 in China general microbiological culture collection center. The application also provides bacillus coagulans G35-LjLDH, which is a recombinant strain obtained by replacing the D-lactate dehydrogenase gene of the strain G35 by the D-lactate dehydrogenase gene derived from Lactobacillus jensenii. The strain developed by the application has high sugar tolerance, can utilize low-concentration organic nitrogen source and high-temperature resistance, has high D-lactic acid yield, and has important practical significance.
Description
Technical Field
The application relates to the field of microorganisms, in particular to a high-sugar-resistant lactic acid production strain and application thereof in D-lactic acid production.
Background
Polylactic acid is a biodegradable high molecular polymer produced by taking optical pure lactic acid (the optical purity is more than 99%) as a raw material. Polylactic acid has better plasticity, can be processed by using the same process as that of general thermoplastic plastics, and is made into disposable tableware, packaging materials, orthopedic internal fixation materials, disassembly-free surgical suture lines and other products, thus having very broad market prospect. Polylactic acid also has good biodegradability, can be absorbed by microorganisms in seawater, and can be completely degraded into carbon dioxide and water under composting or soil conditions. Along with the enhancement of environmental protection consciousness, polylactic acid is taken as a novel environment-friendly polymer material and is gradually paid attention to by people.
Optical pure L-lactic acid is a main monomer for polymerization of polylactic acid, but polylactic acid prepared from pure L-lactic acid has the weaknesses of instability to heat, brittleness and the like, and the mechanical property and the thermal stability of the polylactic acid can be enhanced by adding the optical pure D-lactic acid into the polylactic acid. In addition, D-lactic acid has been used for synthesis of various chiral substances as an important chiral intermediate. For example, the D-lactic acid can be used as a raw material to prepare optically active R-2-chloropropionic acid, and then the R-2-chloropropionic acid can be used as a precursor to prepare a large class of optically active herbicide. For example, the D-methyl lactate formed by esterifying high optical purity D-lactic acid (optical purity is more than 99%) and methanol can be used for synthesizing various chiral compounds such as R-1, 2-propanediol, R-2-hydroxy carboxylic acid ester, polysubstituted proline and the like, so that important medical intermediates can be synthesized. Microbial fermentation is the main method for producing D-lactic acid. The D-lactic acid produced by the microbial fermentation method can utilize renewable resources as carbon sources, realize green production, and can effectively solve the energy crisis and environmental pollution caused by fossil fuel. During lactic acid fermentation, the production strain is often stressed by various factors, wherein the permeation of high concentration substrate in the initial stage of fermentation is one of the bottlenecks restricting lactic acid production. In addition, the organic nitrogen source accounts for 38% of the production cost of the lactic acid, so that the production cost can be greatly reduced by reducing the addition amount of the organic nitrogen source. In addition, most of D-lactic acid fermentation strains are normal temperature bacteria at present, the production process is easy to dye bacteria, and the requirements on equipment and operation conditions are high. Therefore, it is of great practical importance to develop high temperature resistant D-lactic acid producing strains that are tolerant to high sugar and can utilize low concentrations of organic nitrogen sources.
Bacillus coagulans (Bacillus coagulans) DSM1 was an optically pure L-lactic acid producing strain, from which the L-lactic acid dehydrogenase was previously knocked out by the team, and the D-lactic acid dehydrogenase derived from Lactobacillus delbrueckii was integrated into the strain DSM1 genome, to construct an optically pure D-lactic acid producing strain D-DSM1 (Zhang, et al, non-sterilized fermentation of high optically pure D-lactic acid by a genetically modified thermophilic Bacillus coagulans strain, microb.cell face. (2017) 16:213). The strain can produce D-lactic acid by utilizing glucose at 50 ℃, the yield is 145g/L, the sugar acid conversion rate reaches 0.98g/g, and the optical purity of the D-lactic acid reaches 99.9%. Although the strain has the advantages of high fermentation temperature, high sugar acid conversion rate, high product purity and the like, the high-concentration glucose inhibits the growth of the strain, and a large amount of yeast powder is required to be added in the fermentation process, so that the production cost is increased.
Disclosure of Invention
The application aims to provide a high-sugar-resistant lactic acid production strain and application thereof in D-lactic acid production.
In a first aspect, the application claims a bacillus coagulans (Bacillus coagulans) G35.
The application discloses bacillus coagulans (Bacillus coagulans) G35 which has a preservation number of CGMCC No.21293 in China general microbiological culture collection center.
In a second aspect, the application claims a Bacillus coagulans (Bacillus coagulans) G35-LjLDH.
The Bacillus coagulans (Bacillus coagulans) G35-LjLDH claimed in the application is a recombinant strain obtained by replacing the D-lactate dehydrogenase gene (D-LDH) of the Bacillus coagulans (Bacillus coagulans) G35 by the D-lactate dehydrogenase gene (LjLDH) derived from Lactobacillus jensenii.
Further, the D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii may be replaced in situ by homologous recombination with the D-lactate dehydrogenase gene (D-LDH) of the Bacillus coagulans (Bacillus coagulans) G35 itself.
Furthermore, the upstream homology arm when the homologous recombination is performed may be as shown in SEQ ID No.1 (834 bp sequence upstream of the D-lactate dehydrogenase (D-LDH) gene of the strain G35), and the downstream homology arm may be as shown in SEQ ID No.2 (833 bp sequence downstream of the D-lactate dehydrogenase (D-LDH) gene of the strain G35). The D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii can be represented by SEQ ID No. 3.
In a specific embodiment of the application, the bacillus coagulans (Bacillus coagulans) G35-LjLDH is prepared according to a method comprising the following steps: sequentially connecting the upstream homology arm, a D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii and the downstream homology arm, and constructing the mixture into a pMH77 plasmid to obtain a recombinant vector; and then introducing the recombinant vector into bacillus coagulans (Bacillus coagulans) G35, and obtaining bacillus coagulans (Bacillus coagulans) G35-LjLDH through 2 times of homologous recombination.
In a third aspect, the application claims a kit for producing D-lactic acid.
The kit for producing D-lactic acid claimed in the present application comprises:
(1) The bacillus coagulans (Bacillus coagulans) G35 described above or the bacillus coagulans (Bacillus coagulans) G35-LjLDH described above;
(2) A fermentation medium described later.
In a fourth aspect, the application claims any of the following applications:
use of P1, bacillus coagulans (Bacillus coagulans) G35 as described above or bacillus coagulans (Bacillus coagulans) G35-LjLDH as described above or a kit of parts as described above for the production of D-lactic acid;
use of P2, bacillus coagulans (Bacillus coagulans) G35 as described above or bacillus coagulans (Bacillus coagulans) G35-LjLDH as described above for the preparation of a kit as described above.
Wherein the production of D-lactic acid is the production of D-lactic acid under the following conditions 1) and/or 2) and/or 3): 1) Utilizing high sugar; 2) Low nitrogen is utilized; 3) At high temperature; the high sugar is 180-200g/L glucose; the low nitrogen is 0.5-1g/L organic nitrogen; the high temperature is 50-55 ℃.
Further, the organic nitrogen includes, but is not limited to, yeast powder, corn steep liquor dry powder, soybean meal powder, and the like.
In a specific embodiment of the application, the organic nitrogen is specifically yeast powder.
In a fifth aspect, the application claims a method of producing D-lactic acid.
The method for producing D-lactic acid claimed in the present application may comprise the steps of: inoculating the bacillus coagulans (Bacillus coagulans) G35 or the bacillus coagulans (Bacillus coagulans) G35-LjLDH in a fermentation medium for culturing, and obtaining the D-lactic acid from a fermentation product.
Wherein the fermentation medium contains 180-200g/L glucose; 0.5-1g/L organic nitrogen; the temperature at which the culture is carried out is 50-55 ℃.
Further, the organic nitrogen includes, but is not limited to, yeast powder, corn steep liquor dry powder, soybean meal powder, and the like.
In a specific embodiment of the application, the organic nitrogen is specifically yeast powder.
Further, the solvent of the fermentation medium is water, and the solute and concentration are 180-200g/L (such as 200 g/L) of glucose; yeast powder 0.5-1g/L (such as 0.5g/L or 1 g/L); ammonium sulfate 4g/L; ammonium chloride 4g/L; dipotassium hydrogen phosphate 0.2g/L; potassium dihydrogen phosphate 0.2g/L; zinc sulfate, 0.2g/L; 100g/L of calcium carbonate. When fermentation culture is performed by using a fermenter, since the fermenter can be fed with an alkali solution, the fermentation medium may not contain calcium carbonate.
Further, in the process of carrying out the culture, controlling the pH of the culture system to be constant at 6.5; and/or, the cultivation time is 48 hours.
Further, in the course of the culture, the culture system was stirred at a stirring speed of 120rpm and a stirring radius of 38mm.
In a sixth aspect, the application claims a process for the preparation of bacillus coagulans (Bacillus coagulans) G35-LjLDH as described hereinbefore.
The preparation method of the bacillus coagulans (Bacillus coagulans) G35-LjLDH disclosed by the application can comprise the following steps: the D-lactate dehydrogenase gene (D-LDH) of Bacillus coagulans (Bacillus coagulans) G35 itself was replaced with a D-lactate dehydrogenase gene (LjLDH) derived from Lactobacillus jensenii.
Further, the D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii replaces the D-lactate dehydrogenase gene (D-LDH) of the Bacillus coagulans (Bacillus coagulans) G35 itself in situ by means of homologous recombination.
Further, the upstream homology arm at the time of performing the homologous recombination is shown as SEQ ID No.1 (834 bp sequence upstream of the D-Lactate Dehydrogenase (LDH) gene of the strain G35), and the downstream homology arm is shown as SEQ ID No.2 (833 bp sequence downstream of the D-Lactate Dehydrogenase (LDH) gene of the strain G35). The D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii is shown in SEQ ID No. 3.
In a specific embodiment of the application, the bacillus coagulans (Bacillus coagulans) G35-LjLDH is prepared according to a method comprising the following steps: the upstream homology arm, a D-lactate dehydrogenase gene (LjLDH) derived from the Lactobacillus jensenii and the downstream homology arm are sequentially connected and then constructed into a pMH77 plasmid (such as inserted between enzyme cutting sites BamHI and HindIII) to obtain a recombinant vector; and then introducing the recombinant vector into bacillus coagulans (Bacillus coagulans) G35, and obtaining bacillus coagulans (Bacillus coagulans) G35-LjLDH through 2 times of homologous recombination.
The application takes bacillus coagulans (Bacillus coagulans) D-DSM1 as an initial strain, adopts an atmospheric pressure room temperature plasma (ARTP) mutagenesis technology and combines an adaptive evolution technology to screen and obtain a strain G35 which can tolerate high-concentration primary sugar (200G per liter of primary sugar) and produce D-lactic acid in a low yeast powder (less than 1G per liter) culture medium, and the yield of the D-lactic acid can reach 134G per liter of fermentation liquor. And further substituting D-lactate dehydrogenase encoding gene (D-LDH) of strain G35 itself with D-lactate dehydrogenase gene (LjLDH) derived from Lactobacillus jensenii in situ (Caimeng et al, microbiology report, 2015, vol.03, 460-466) to obtain strain G35-LjLDH capable of producing optically pure D-lactic acid in high initial glucose and low yeast powder medium, wherein D-lactic acid yield can reach 166G/liter fermentation broth, and L-lactic acid concentration in fermentation broth is lower than detection limit. The high-temperature resistant D-lactic acid production strain which is high in sugar tolerance and can utilize low-concentration organic nitrogen source and is developed by the application has important practical significance.
Preservation description
Strain name: bacillus coagulans
Latin name: bacillus coagulans
Reference biological materials (strain): G35G 35
Preservation mechanism: china general microbiological culture Collection center (China Committee for culture Collection of microorganisms)
The preservation organization is abbreviated as: CGMCC
Address: beijing city, chaoyang area, north Chenxi Lu No.1 and 3
Preservation date: 2020, 12 months and 4 days
Accession numbers of the preservation center: CGMCC No.21293
Drawings
FIG. 1 shows the biomass (OD) of the cells during the adaptive evolution of the high initial glucose medium 600 ) Is a variation of (c).
FIG. 2 is a graph showing the change in glucose concentration during adaptive evolution of high initial glucose media.
FIG. 3 is a liquid chromatogram of strain G35 fermentation broth.
FIG. 4 is a liquid chromatogram of the fermentation broth of strain G35-LjLDH.
Detailed Description
The following detailed description of the application is provided in connection with the accompanying drawings that are presented to illustrate the application and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the application in any way.
The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.
Bacillus coagulans (Bacillus coagulans) D-DSM1: described in "Zhang, et al, non-sterilized fermentation of high optically pure D-lactic acid by a genetically modified thermophilic Bacillus coagulans strain, microb. Cell face (2017) 16:213", publicly available from applicant as soon as possible for repeat experiments of the application, and not available to him.
Example 1 acquisition and fermentation characterization of Bacillus coagulans (Bacillus coagulans) G35 and G35-LjLDH
In the embodiment, bacillus coagulans (Bacillus coagulans) D-DSM1 is taken as an initial strain, an atmospheric pressure room temperature plasma (ARTP) mutagenesis technology is adopted, and an adaptive evolution technology is combined, so that a strain G35 which can tolerate high-concentration primary sugar (200G per liter of primary sugar) and produce D-lactic acid in a low yeast (less than 1G per liter) culture medium is screened and obtained, and the yield of the D-lactic acid can reach 134G per liter of fermentation liquor. The method comprises the following steps:
1. ARTP mutagenesis
1.1 mutagenesis procedure
After Bacillus coagulans (Bacillus coagulans) D-DSM1 was activated with 513 liquid medium (containing 50g/L of glucose, 10g/L of yeast powder and 30g/L of neutralizing agent) for 12 hours, the solid medium (containing 50g/L of glucose, 10g/L of yeast powder, 30g/L of neutralizing agent, 17-20% (w/v) of agar) was streaked 513. Preparation of bacterial suspension (OD) with sterilized 0.9% (w/v) physiological saline 600 10 μl of the bacterial suspension was uniformly smeared onto irradiated metal plates for ARTP mutagenesis. Helium was used as the working gas at a power of 140W, a gas flow of 10slpm, and processing times of 0s,25s,50s,75s,100s,125s, and 150s. At the end of mutagenesis, the solution was diluted with a sterile physiological saline gradient and plated onto 513 solid medium (see above for formulation). The plates were placed in an incubator at 50-55℃overnight and single colonies were transferred to a solid screening medium containing 200g/l of initial glucose and 1g/l of yeast powder to screen strains with large lytic circles. Inoculating to liquid culture medium containing 200g/L initial glucose and 1g/L yeast powder, and screening to obtain strain with increased D-lactic acid production in high initial glucose and low yeast powder culture medium.
1.2 method for measuring glucose:
an SBA-40C analyzer was used. The sample is centrifuged, the supernatant is collected, 25 mu L of the supernatant is sucked by a sample injection needle after proper dilution and is injected into a reaction tank, a substrate contacts and reacts with an immobilized enzyme layer through an enzyme membrane ring, and a current signal is generated, the current signal and the concentration of the substrate are in linear proportion, and the result can be directly displayed and printed through a microcomputer-controlled signal.
1.3L-lactic acid and D-lactic acid measurement method
A chiral separation column (Mitsubishi chemical corporation, japan, MCI GEL-CRS10W,4.6mm ID. Times.50 mm) was equipped using an Agilent 1260 liquid chromatograph. The specific operating conditions are as follows: 2mM copper sulfate as mobile phase, flow rate 0.5mL/min, sample injection amount 5 μl, ultraviolet detector, detection wavelength 254nm, and operating temperature 25 ℃. And respectively utilizing L-lactic acid and D-lactic acid standard substances to make a standard curve, and then calculating the contents of L-lactic acid and D-lactic acid in the fermentation liquid (fermentation system) according to the standard curve.
1.4 results
The method for measuring and calculating the survival rate comprises the following steps: 1 ml of the mutagenized bacterial suspension was diluted with a 0.9% physiological saline gradient (dilution factor 1X 10) 2 ，1×10 3 ，1×10 4 ) Bacterial suspensions of different dilutions were plated 513 with solid medium (see formulation supra), and colonies were counted after incubation at 50-55℃for 24 hours. Three determinations were made and an average was taken.
Survival (%) = (average colony count of strain/control of each treatment group) ×100
The results are shown in Table 1.
TABLE 1 ARTP mutagenesis results
| Irradiation time(s) | 0 | 25 | 50 | 75 | 100 | 125 |
| Survival (%) | 100 | 20 | 10 | 5 | 1 | 0 |
Single colonies with faster growth and larger calcium dissolving ring in the plates are selected and inoculated into a liquid culture medium (formula: containing 180-200g/L of glucose, 1g/L of yeast powder, 3g/L of ammonium sulfate, 3g/L of ammonium chloride, 0.2g/L of dipotassium hydrogen phosphate, 0.2g/L of potassium dihydrogen phosphate, 0.2g/L of zinc sulfate and 60g/L of calcium carbonate) containing 200g/L of initial glucose and 1g/L of yeast powder for re-screening. The strain which has a high glucose consumption rate and which does not produce L-lactic acid was detected by a biosensor. The strain G1 which consumes glucose more rapidly in the medium of high initial glucose and in the medium of low yeast powder is obtained by screening. After a second round of ARTP mutagenesis treatment, strain G2 was obtained which consumed glucose in the high initial glucose medium and glucose in the low yeast powder medium faster.
2. High initial glucose and low yeast powder medium growth strain adaptive evolution
The strain G2 obtained by ARTP mutagenesis was subjected to an adaptive evolution experiment. Adaptive evolution the active medium composition (grams per liter) used: glucose, 50; yeast powder, 10; calcium carbonate, 30. The screening medium composition was (grams per liter): glucose, 200; yeast powder, 1; ammonium sulfate, 3; ammonium chloride, 3; dipotassium hydrogen phosphate, 0.2; potassium dihydrogen phosphate, 0.2; zinc sulfate, 0.2. Calcium hydroxide was used as a neutralizing agent, and the pH was 6.5. The temperature was 50 ℃. First generation: inoculating the seed solution of the G2 strain activated for 12 hours into a screening culture medium with high initial glucose according to an inoculum size of 10% (v/v), and culturing at 50 ℃ for 48 hours to determine the residual glucose content in the fermentation broth. Second generation: inoculating the bacterial liquid obtained by the first generation adaptive evolution into a screening culture medium with high initial glucose according to an inoculum size of 10% (v/v), culturing for 48 hours at 50 ℃, and measuring the residual glucose content in the fermentation liquid. The strain was activated stepwise according to the above method. Until strains with fast sugar consumption are obtained by screening. Fermentation demonstrated its ability to produce D-lactic acid by fermentation in high initial glucose media.
Results: in the high initial glucose medium, the strain was serially inoculated for 35 passages, and the strain biomass gradually increased with the number of passages (fig. 1). Starting from passage 8, biomass (OD of the strain 600 ) Stable at about 20, and the biomass of the bacterial cells slightly fluctuates with the increase of the passage times. In terms of glucose consumption, from generation 1 to generation 5, the strain had a relatively slow glucose consumption rate in a medium having an initial glucose concentration of 200 g/liter, and the residual glucose in the fermentation broth after 40 hours of cultivation reached 153 g/liter. The sugar consumption rate of the strain increased gradually with the increase of the passage times, and when the strain passed to the 35 th generation, the residual glucose in the fermentation broth was 34 g/l (FIG. 2). The strain with fast sugar consumption was designated as G35.
The strain G35 is preserved in China general microbiological culture Collection center (China general microbiological culture Collection center) on 12 months and 4 days in 2020, and has the name of bacillus coagulans (Bacillus coagulans), the biological material (strain) of reference is G35, and the preservation number is CGMCC No.21293.
Strain G35 was inoculated under aseptic conditions into a triangular flask containing 50 ml 513 of liquid medium (see above for formulation), and cultured at 50℃and 120rpm for 12 hours to prepare a seed culture solution. A triangular flask containing 50 ml of high initial glucose liquid medium (the culture medium comprises (g/L) glucose, 200, yeast powder, 1, ammonium sulfate, 4, ammonium chloride, 4, dipotassium hydrogen phosphate, 0.2, potassium dihydrogen phosphate, 0.2, zinc sulfate, 0.2 and calcium carbonate, 100) was filled with 5ml of seed culture solution, and the culture was carried out at 50℃and 120rpm for 48 hours. The strain G35 obtained by screening can be used for generating D-lactic acid by glucose under the condition of high initial glucose, the yield is 134G/L, and the L-lactic acid is lower than the detection limit (figure 3).
3. Construction and fermentation verification of recombinant strain G35-LjLDH
3.1 integration of the Lactobacillus jensenii D-lactate dehydrogenase Gene (LjLDH) into the Strain G35 genome
The Lactobacillus jensenii D-lactate dehydrogenase gene (LjLDH) was amplified using primers LjLDH-F and LjLDH-R as templates with Lactobacillus jensenii (Lactobacillus jensenii) 269-3 (Caimeng et al, study of the enzymatic properties of thermostable D-lactate dehydrogenase from Lactobacillus jensenii, microbiological report 2015, vol.03, 460-466) (GenBank: EEQ 23913.1). Of course, the LjLDH gene (i.e., SEQ ID No. 3) may also be obtained directly by artificial synthesis.
LjLDH-F：5’-gaatggaaaggaagctgtcgt-atgacaaagatttttgcttatgc-3’；
LjLDH-R：5’-caattataaaaaatctgcttatgttct-ttaacctaacttaactggag-3’。
The primers UP-F and UP-R were used to amplify 834bp of the gene upstream of the strain G35 self D-lactate dehydrogenase (D-LDH) (i.e.upstream homology arm, SEQ ID No. 1) using the Bacillus coagulans (Bacillus coagulans) D-DSM1 genome as template.
UP-F：5’-cttagtgactcggatcctctagacacgttgagcgttggtttaatg-3’；
UP-R：5’-gcataagcaaaaatctttgtcat-acgacagcttcctttccattc-3’。
The primers DOWN-F and DOWN-R were used to amplify the sequence 833bp downstream of the strain G35 self D-lactate dehydrogenase (D-LDH) gene (i.e., downstream homology arm, SEQ ID No. 1) using the Bacillus coagulans (Bacillus coagulans) D-DSM1 genome as template.
DOWN-F：5’-gttaagttaggttaa-agaacataagcagattttttataattgtgag-3’；
DOWN-R：5’-catgattacgccaagcttctcgtcattctccacagcactaaaaaag-3’。
Three sequences were ligated together using the Gibson method, inserted into the cleavage site (BamHI, hindIII) of plasmid pMH77 (Zhang, et al, non-sterilized fermentation of high optically pure D-lactic acid by a genetically modified thermophilic Bacillus coagulans strain. Microb. Cell face. (2017) 16:213), and plasmid pMH77-LDHup-LjLDH-LDHdown was constructed and verified to be correct by sequencing.
Plasmid pMH77-LDHup-LjLDH-LDHdown was transformed into strain G35.
First homologous recombination: liquid culturing the strain containing knocked out plasmid (pMH 77-LDHup-LjLDH-LDHdown) at 45deg.C for 12 hr, transferring to new BC liquid culture medium (formula: sucrose 50g, yeast extract 10g, diammonium phosphate 2g, ammonium sulfate 3.5g, bis-Tris 10g, agar 15g (solid culture medium), regulating pH to 6.6-6.7, distilled water constant volume to 1000mL, autoclaving at 115deg.C for 10min, sterilizing the solid culture medium, adding 1g magnesium chloride, filtering before using the culture medium, adding calcium chloride 0.003g, magnesium chloride 0.005g, cobalt chloride hexahydrate 0.2X10 g -3 g, copper chloride dihydrate 0.01X10 -3 g, boric acid 0.3X10 -3 g, sodium molybdate dihydrate 0.03X10 -3 g, nickel sulfate hexahydrate 0.02X10 -3 g, manganese chloride tetrahydrate 0.03X10) -3 g, zinc chloride 0.05X10 -3 g) And further culturing at 60℃for 12 hours, then collecting the cells by centrifugation and plating on BC solid medium containing chloramphenicol (7. Mu.g/ml), culturing at 60℃for 1-2 days until single colonies are grown. The occurrence of the first homologous recombination was verified by PCR with the G35 self D-lactate dehydrogenase (D-LDH) gene intermediate 700bp primer (forward primer: gagacgagggcggatgaattccccttatttc; reverse primer: gagcgcatccgtatccacttcagcaccat) and the Lactobacillus jensenii D-lactate dehydrogenase gene (LjLDH) primer (forward primer: gaatggaaaggaagctgtcgtatgacaaagatttttgcttatgc; reverse primer: caattataaaaaatctgcttatgttctttaacctaacttaactggag). Positive clones gave two bands of equal intensity, 1000bp and 700bp respectively.
Second homologous recombination: strains that have been confirmed to undergo the first homologous recombination (positive) are liquid-cultured at 45℃for 3 to 4 generations and then diluted by an appropriate factor (10 5 、10 6 、10 7 ) Spread on the solid culture medium without resistance BC, cultured for 1-2 days at 45 ℃, and the single colony grows out and then is inoculated on the solid culture medium with chloramphenicol and without resistance BC. Bacteria which cannot grow on the corresponding chloramphenicol resistant medium were selected and labeled as G35-LjLDH for successful replacement of the LjLDH gene.
3.2 production of D-lactic acid by Strain G35-LjLDH in high initial glucose Medium
(1) Seed culture: inoculating 513 liquid culture medium (containing glucose 50G/L, yeast powder 10G/L, and calcium carbonate 30G/L) with strain G35-LjLDH under aseptic condition, and culturing at 50deg.C and 120rpm for 12 hr to obtain seed culture solution;
(2) Fermentation culture: a fermentation medium prepared by 2.0L and dissolved to 1.8L is added into a fermentation tank of 5L Shanghai Baoxing BIOTECH, 200ml of seed culture solution is added into the fermentation medium, and 25% (v/v) calcium hydroxide solution is used for controlling the pH value to be constant at 6.5 in the whole fermentation process. The fermentation medium composition was (grams per liter): glucose, 200; yeast powder, 0.5; ammonium sulfate, 4; ammonium chloride, 4; dipotassium hydrogen phosphate, 0.2; potassium dihydrogen phosphate, 0.2; zinc sulfate, 0.2. Culturing at 50-55 deg.c for 48 hr at stirring speed of 120rpm and stirring radius of 38mm.
At the end of fermentation, the fermentation broth was centrifuged at 10,000 rpm for 5 minutes, and the supernatant was collected and the concentrations of glucose, D-lactic acid and L-lactic acid in the fermentation broth were measured according to the above-mentioned measurement method. The experiment was repeated three times and the results averaged.
Calculation of optical purity: is a measure of the amount of one enantiomer in excess of the other in an optically active sample. The optical purity of D-lactic acid in the present application is calculated according to the following formula: d-lactic acid content ≡ (L-lactic acid content + D-lactic acid content) ×100%.
Sugar acid conversion is defined as: l-lactic acid production (g/L)/(consumption of total glucose (g/L). Times.100%).
Results: the strain G35-LjLDH can produce D-lactic acid from glucose under high initial glucose conditions at a yield of 166G/L, L-lactic acid below the limit of detection (Table 2, FIG. 4).
TABLE 2 results of 3 repeated experiments of fermenting D-lactic acid with glucose
| Repeating | D-lactic acid production (g/L) | Sugar acid conversion (%) | D-lactic acid optical purity (%) |
| 1 | 158.0 | 90.2 | 100 |
| 2 | 165.0 | 89.8 | 100 |
| 3 | 174.0 | 92.9 | 100 |
| Mean ± standard deviation | 165.7±8.0 | 91.0±1.7 | 100 |
The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.
<110> institute of microorganisms at national academy of sciences
<120> high sugar tolerant lactic acid producing strain and use thereof in D-lactic acid production
<130> GNCLN203144
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 834
<212> DNA
<213> Artificial sequence
<400> 1
acacgttgag cgttggttta atgtctataa tccgctattt atatagtttt taagagatag 60
gtaaaatatt tttcatactg gaagcagata ttcagaccct taagaacacc gggggagcca 120
tcaagaaact cgatgaacaa attaataatg atcgaaaatt gcaagcgtaa aagaggcaaa 180
ccatgggcaa caaagtcgac atggcggaag tccattcttt ttcggatgaa ttaaaatcag 240
cgacaagttc gttaaaaagc cagctggatg ccattaagaa aagcgcagat caaattgcag 300
aaatggattc ctttactgga ttacagcaga tgctgcgaaa gattatctca aagattttca 360
tatgaaaaca acggaaaact ttatttgaaa gcttgagtgt acaattctcc agtcatattt 420
tatcggtcca gtcagaagta gattcaagca acgcagtgct tttagacagc gactatctag 480
aacttcctga ataaacaaaa attacaaatt tgacaaggat ttctgccact tttgtcgaat 540
aaaaagtgta ggggttttat aggaaacacg taaaatcttt gcttttgaag ccgttacgat 600
gtacaaaaag accggacgat cgttcacttt ggcaaaaatg aaatagaaag aatcgctgat 660
ccgtcttgtt ggattgggca tgggtatctt ggcgctggcg tggcaaaacc aggattctgg 720
acaccggaat ccaattggga gacatgggga ggagatgggt ttattgcggt cgtggttaat 780
gaagccctgc gttgttttta gcatgatcaa aatgaatgga aaggaagctg tcgt 834
<210> 2
<211> 833
<212> DNA
<213> Artificial sequence
<400> 2
agaacataag cagatttttt ataattgtga gacaaaaata gaagtattta agcacatatt 60
gaatgaccat tttacagcat tgttgttggc ctgatccgtt gaaataatgg gggtaagctg 120
attttttgcg ttaatttttc gattatggta aactaattaa taaatcgttc aaaaaagctg 180
ttgagcgctg tccggttact catccgtgat gtgtcccgtc tttaacggca ttataacccg 240
ctttcactat ttaaggtata aagaagatag gtggggaaac cagttgcctg taaaaatctt 300
tagaggcgcc ttaagcctcc gtttcccgtc cgccacagtc catcttaagc cctttttcat 360
tttgcttact gcacacttgc ccgctatctt cgagttgttt atcaatttct tgcacttcat 420
atgcctgcca tctattcggt ggtttttctg gaaatattag cagaaatgcc gaagtatcga 480
cgagtggttt ttgaatttca atgatgattc ccattgcatt cgtctgcggg tttttgaaaa 540
agaaaaccaa aacaaatgcc ggaagatgaa aaaatctttt atcaatgcaa gtatcaaaaa 600
aacgaatctt tatagaaggg aagacagatg ccgaaaacta tcataataag gagtagattt 660
gaaaaatggt atttaacaag aaaaaaatta acatcgttaa tattcgacaa acgaaaaaaa 720
gtgtgtttgc tacgggagta ggaaacgcga tggaatggtt tgattttggc ttgtattctt 780
atctagcggt cattatcagc cggaactttt ttagtgctgt ggagaatgac gag 833
<210> 3
<211> 1002
<212> DNA
<213> Artificial sequence
<400> 3
atgacaaaga tttttgctta tgcaattcgt aaagatgaag aaccattcct taacgaatgg 60
aaagaagccc acaaggatgt tgaagttgat tacactgatc aattattaac tcctgaaact 120
gcaaaacttg ctaagggtgc agatggtgtt gttgtttacc aacaattaga ctacactgca 180
gaaactttac aagcattagc tgatgctggc gttactaaga tgtcattacg taacgttggt 240
gttgataaca ttgacatgga caaggctaag gaacttggtt ttgaaattac taacgttcct 300
gtttactcac caaacgctat tgctgaacac gcagcaattc aagcagctcg tgtattgcgt 360
caagacaagg ttactgacat gaagatggct aagcgcgact tacgttgggc tccaaacatt 420
ggtcgtgaag ttcgtgacca agttgttggt gttgtaggta ctggtcacat tggtcaagta 480
tttatgcaaa tcatggaagg cttcggcgca aaggttattg ctttcgatat cttccacaac 540
ccagaacttg aaaagaaggg ttactacgta gacagccttg acgaattata caagaaggct 600
gacgtaattt cacttcacgt acctgacgtt ccagctaacg ttcacatgat taacgacgac 660
tcaatcaagg aaatgaaaga tggcgttgtt atcgtaaacg tatcacgtgg tccacttgtt 720
gacactgacg cagttatccg tggtcttgac tcaggtaagg tctttggttt cgtaatggac 780
acttacgaag gcgaagttgg tgtattcaac aaggactggc aaggtaagga attcccagat 840
gcacgtttag cagacctaat tgaccgtcca aacgtattgg taactcctca cactgctttc 900
tacactactc acgctgtacg taacatggtt gttaaagcat ttgataacaa ctacgctatg 960
gttgaaggta aagagcctga aactccagtt aagttaggtt aa 1002
Claims (17)
1. Bacillus coagulans @Bacillus coagulans) G35, the preservation number of the G35 in China general microbiological culture collection center is CGMCC No.21293.
2. Bacillus coagulans @Bacillus coagulans）G35-LjLDHFor right toThe bacillus coagulans according to the claim 1Bacillus coagulans) The recombinant strain obtained by replacing the D-lactate dehydrogenase gene of G35 with the D-lactate dehydrogenase gene derived from Lactobacillus jensenii;
the D-lactate dehydrogenase gene derived from the Lactobacillus jensenii is shown in SEQ ID No. 3.
3. The bacillus coagulans according to claim 2Bacillus coagulans）G35-LjLDHThe method is characterized in that: the D-lactic dehydrogenase gene derived from the Lactobacillus jensenii replaces the Bacillus coagulans in situ by means of homologous recombinationBacillus coagulans) G35 itself, D-lactate dehydrogenase gene.
4. The bacillus coagulans according to claim 3Bacillus coagulans）G35-LjLDHThe method is characterized in that: the upstream homology arm is shown as SEQ ID No.1, and the downstream homology arm is shown as SEQ ID No.2 when the homologous recombination is carried out.
5. A kit for producing D-lactic acid, comprising:
(1) The bacillus coagulans of claim 1Bacillus coagulans) G35 or Bacillus coagulans according to any one of claims 2 to 4Bacillus coagulans）G35-LjLDHThe method comprises the steps of carrying out a first treatment on the surface of the And
(2) A fermentation medium;
the fermentation medium contains 180-200g/L glucose; 0.5-1g/L organic nitrogen.
6. The kit of claim 5, wherein: the solvent of the fermentation medium is water, and the solute and the concentration are as (A1) or (A2):
(A1) 180-200g/L glucose; 0.5-1g/L of yeast powder; ammonium sulfate 4g/L; ammonium chloride 4g/L; dipotassium hydrogen phosphate 0.2g/L; potassium dihydrogen phosphate 0.2g/L; zinc sulfate 0.2g/L; 100g/L of calcium carbonate;
(A2) 180-200g/L glucose; 0.5-1g/L of yeast powder; ammonium sulfate 4g/L; ammonium chloride 4g/L; dipotassium hydrogen phosphate 0.2g/L; potassium dihydrogen phosphate 0.2g/L; zinc sulfate 0.2g/L.
7. The bacillus coagulans of claim 1Bacillus coagulans) G35 or Bacillus coagulans according to any one of claims 2 to 4Bacillus coagulans）G35-LjLDHOr the use of a kit according to claim 5 for the production of D-lactic acid.
8. The bacillus coagulans of claim 1Bacillus coagulans) G35 or Bacillus coagulans according to any one of claims 2 to 4Bacillus coagulans）G35-LjLDHUse of a kit according to claim 5 for the preparation of a product。
9. The use according to claim 7, characterized in that: the D-lactic acid is produced under the following conditions of 1) and/or 2) and/or 3): 1) Utilizing high sugar; 2) Low nitrogen is utilized; 3) At high temperature;
the high sugar is 180-200g/L glucose; the low nitrogen is 0.5-1g/L organic nitrogen; the high temperature is 50-55 ℃.
10. A method for producing D-lactic acid, comprising the steps of: the bacillus coagulans according to claim 1Bacillus coagulans) G35 or Bacillus coagulans according to any one of claims 2 to 4Bacillus coagulans）G35-LjLDHInoculating in a fermentation medium for culturing, and obtaining D-lactic acid from a fermentation product;
the fermentation medium contains 180-200g/L glucose; 0.5-1g/L organic nitrogen; the temperature at which the culture is carried out is 50-55 ℃.
11. The method according to claim 10, wherein: the solvent of the fermentation medium is water, and the solute and the concentration are as (A1) or (A2):
(A1) 180-200g/L glucose; 0.5-1g/L of yeast powder; ammonium sulfate 4g/L; ammonium chloride 4g/L; dipotassium hydrogen phosphate 0.2g/L; potassium dihydrogen phosphate 0.2g/L; zinc sulfate 0.2g/L; 100g/L of calcium carbonate;
(A2) 180-200g/L glucose; 0.5-1g/L of yeast powder; ammonium sulfate 4g/L; ammonium chloride 4g/L; dipotassium hydrogen phosphate 0.2g/L; potassium dihydrogen phosphate 0.2g/L; zinc sulfate 0.2g/L.
12. The method according to claim 10, wherein: during the culture, the pH of the culture system was controlled to be constant at 6.5.
13. The method according to claim 10, wherein: in the process of culturing, the culturing time is 48 hours.
14. The method according to claim 10, wherein: in the process of the culture, the culture system is stirred at a stirring speed of 120rpm and a stirring radius of 38mm.
15. The bacillus coagulans according to claim 2Bacillus coagulans）G35-LjLDHThe preparation method of (2) comprises the following steps: the bacillus coagulans according to claim 1Bacillus coagulans) The D-lactate dehydrogenase gene of G35 itself is replaced with a D-lactate dehydrogenase gene derived from Lactobacillus jensenii;
the D-lactate dehydrogenase gene derived from the Lactobacillus jensenii is shown in SEQ ID No. 3.
16. The method according to claim 15, wherein: the D-lactic dehydrogenase gene derived from the Lactobacillus jensenii replaces the Bacillus coagulans in situ by means of homologous recombinationBacillus coagulans) G35 itself, D-lactate dehydrogenase gene.
17. The method according to claim 16, wherein: the upstream homology arm is shown as SEQ ID No.1, and the downstream homology arm is shown as SEQ ID No.2 when the homologous recombination is carried out.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011516662.6A CN114645006B (en) | 2020-12-21 | 2020-12-21 | High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011516662.6A CN114645006B (en) | 2020-12-21 | 2020-12-21 | High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114645006A CN114645006A (en) | 2022-06-21 |
| CN114645006B true CN114645006B (en) | 2023-09-01 |
Family
ID=81989805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011516662.6A Active CN114645006B (en) | 2020-12-21 | 2020-12-21 | High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114645006B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101173242A (en) * | 2007-10-18 | 2008-05-07 | 中国科学院微生物研究所 | Method for producing L-lactic acid and coagulate bacillus cereus special for the same |
| CN101173240A (en) * | 2007-10-18 | 2008-05-07 | 中国科学院微生物研究所 | Method for producing D-lactic acid and brood-cell lactobacillus special for the same |
| CN101285047A (en) * | 2008-05-16 | 2008-10-15 | 南京工业大学 | D-lactic acid-producing strain with high optical purity and process for producing D-lactic acid by fermentation thereof |
| CN101805758A (en) * | 2010-03-24 | 2010-08-18 | 天津工业生物技术研究所 | Method by utilizing double-reactor system to produce fermentation liquor containing D-lactic acid in circular fermentation way |
| CN102978134A (en) * | 2012-11-21 | 2013-03-20 | 华南理工大学 | Lactobacillus and method for producing D-lactic acid by fermenting using lactobacillus |
| CN103547671A (en) * | 2010-11-22 | 2014-01-29 | 美国佛罗里达大学研究基金会公司 | Engineering of thermotolerant bacillus coagulans for production of D(-)-lactic acid |
| CN104974966A (en) * | 2015-07-22 | 2015-10-14 | 江南大学 | Bacillus coagulans and high-density fermentation method thereof, and dry bacterium powder preparation method |
-
2020
- 2020-12-21 CN CN202011516662.6A patent/CN114645006B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101173242A (en) * | 2007-10-18 | 2008-05-07 | 中国科学院微生物研究所 | Method for producing L-lactic acid and coagulate bacillus cereus special for the same |
| CN101173240A (en) * | 2007-10-18 | 2008-05-07 | 中国科学院微生物研究所 | Method for producing D-lactic acid and brood-cell lactobacillus special for the same |
| CN101285047A (en) * | 2008-05-16 | 2008-10-15 | 南京工业大学 | D-lactic acid-producing strain with high optical purity and process for producing D-lactic acid by fermentation thereof |
| CN101805758A (en) * | 2010-03-24 | 2010-08-18 | 天津工业生物技术研究所 | Method by utilizing double-reactor system to produce fermentation liquor containing D-lactic acid in circular fermentation way |
| CN103547671A (en) * | 2010-11-22 | 2014-01-29 | 美国佛罗里达大学研究基金会公司 | Engineering of thermotolerant bacillus coagulans for production of D(-)-lactic acid |
| CN102978134A (en) * | 2012-11-21 | 2013-03-20 | 华南理工大学 | Lactobacillus and method for producing D-lactic acid by fermenting using lactobacillus |
| CN104974966A (en) * | 2015-07-22 | 2015-10-14 | 江南大学 | Bacillus coagulans and high-density fermentation method thereof, and dry bacterium powder preparation method |
Non-Patent Citations (1)
| Title |
|---|
| 高产 D- 乳酸生产菌株的选育;于培星;《食品与生物技术学报》;第29卷(第5期);第796-800页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114645006A (en) | 2022-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Akutsu et al. | Effects of temperature and substrate concentration on biological hydrogen production from starch | |
| Do et al. | Growth of Rhodospirillum rubrum on synthesis gas: conversion of CO to H2 and poly‐β‐hydroxyalkanoate | |
| WO2011143800A1 (en) | Bacillus coagulans strain used in producing l-lactic acid and use thereof | |
| EP4317415A1 (en) | Bacillus natto for producing menaquinone-7 and use thereof | |
| JP6444419B2 (en) | Sporolactobacillus terae and its use | |
| Song et al. | Isolation and characterization of a new hydrogen-producing strain Bacillus sp. FS2011 | |
| US20240102058A1 (en) | Caproate-producing bacterium with multiple substrate utilization capabilities and its applications | |
| CN106434483B (en) | A kind of lactobacillus buchneri and its application | |
| CN113122488B (en) | Klebsiella engineering bacteria and application thereof in producing glycerol and dihydroxyacetone | |
| CN110241043B (en) | Strain for producing lactic acid through high-temperature fermentation and method for producing lactic acid | |
| CN106995790A (en) | One plant utilizes bacterial strain and its application that xylan is that sole carbon source directly produces butanol | |
| CN116286545B (en) | Rhodobacter sphaeroides mutant strain HCYJ-01 and application thereof | |
| CN114645006B (en) | High sugar-tolerant lactic acid production strain and application thereof in D-lactic acid production | |
| CN110747149B (en) | Salt-tolerant methanogenic archaea and application thereof | |
| El-Rab et al. | Costless and huge hydrogen yield by manipulation of iron concentrations in the new bacterial strain Brevibacillus invocatus SAR grown on algal biomass | |
| CN102719502A (en) | Method for producing L-alanine by mutating lactate-production bacteria | |
| CN114015607B (en) | Bacillus amyloliquefaciens for high yield of 5-methyltetrahydrofolic acid and application thereof | |
| CN103667107B (en) | A kind of manure enterococcin strain producing Pfansteihl | |
| CN100564515C (en) | One strain Bordetella and the application in preparation rCO and courage steroid-4-alkene-3-ketone thereof | |
| CN113717886A (en) | Bacillus coagulans and method for producing 2' -deoxyadenosine by catalyzing same | |
| JP2611835B2 (en) | Anaerobic digestion | |
| CN112175889B (en) | Strain for highly producing vitamin K2 and application thereof | |
| CN108949654A (en) | A kind of engineering bacteria and its application in production α-ketoglutaric acid | |
| KR101173468B1 (en) | Enterobacter sp?ES392 KACC 91568P and method of producing hydrogen by using the same | |
| CN116144516B (en) | Saccharomyces cerevisiae for producing succinic acid and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |