CN114644703B - Wheat stem rust resistance protein, and coding gene and application thereof - Google Patents

Abstract

The invention provides a wheat stem rust resistance protein, and a coding gene and application thereof. Wherein the wheat stem rust resistance protein comprises (a): has the sequence of SEQ ID NO:3, and a protein consisting of an amino acid sequence shown in 3; or (b): a protein having an activity against wheat stem rust in which the amino acid sequence of (a) is substituted and/or deleted and/or added with one or more amino acids; or (c): a protein having 80% or more homology with the amino acid sequence defined in any one of (a) and (b) and having the same function. The protein has wheat stem rust resistance, solves the problem that wheat is easy to dye stem rust and has serious yield loss after the wheat is infected in the prior art, and is suitable for the fields of wheat breeding and biotechnology.

Description

Wheat stem rust resistance protein, and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to wheat stem rust resistance protein, and a coding gene and application thereof.

Background

Wheat is one of the most important grain crops, and ensuring the safe production of the wheat is important for the grain safety of China. Wheat stem rust is an air-borne fungal disease caused by the specialized wheat of the genus puccinia (Puccinia graminis Pers. Var. Tritici Eriks et Henn.) and is one of the most important diseases that jeopardize the safe production of wheat. Rust disease occurs in most countries and regions where wheat is planted, and the epidemic year can lead the wheat to be reduced by 50% -70% and even be out of order when serious. The frequent and easy-to-develop areas of stem rust in China comprise northeast and northwest wheat areas, and the areas are Jianghuai and southeast coastal areas, and part of southwest wheat areas. Before the 60 s of the 20 th century, china had exploded a few stem rust pandemics, resulting in serious yield loss.

In recent years, wheat stem rust is continuously expanded in the incidence range of a plurality of wheat main producing areas in the world, and the damage degree is increasingly serious, so that the very serious wheat yield loss is caused. Strong virulence minispecies of the Ug99 series, including TRTTF, TKTTF, TTRTF and JRCQC, among others, appear in a number of non-Ug 99 types. At present, more than 95% of wheat varieties cultivated in China have no resistance to stem rust, and once the wheat varieties with small toxicity are transferred into China, the safety production of wheat in China is seriously threatened.

Cloning and utilizing stem rust resistance gene and cultivating disease-resistant wheat variety is the most economical, safe and environment-friendly measure for controlling the disease. Durum wheat t.durum contains abundant stem rust resistance gene resources from which to locate and clone new stem rust resistance genes, which will provide important gene resources and theoretical basis for wheat disease resistance breeding. To date, more than 60 wheat stem rust resistance genes have been formally named, but because common wheat is heterohexaploid, has very large genome (about 17 Gb), has a large number of repeated sequences and the like, complicated steps such as fine positioning of genes, chromosome walking, candidate gene prediction, gene function verification and the like are required in carrying out the research of wheat gene map-based cloning, so that map-based cloning of wheat functional genes is slow, and only a small number of genes are successfully cloned at present.

Disclosure of Invention

The invention mainly aims to provide a wheat stem rust resistance protein, and a coding gene and application thereof, so as to solve the problem of less resistance protein in the prior art.

In order to achieve the above object, according to one aspect of the present invention, there is provided a wheat stem rust resistance protein comprising:

(a) Has the sequence of SEQ ID NO:3, and a protein consisting of an amino acid sequence shown in 3; or (b)

(b) A protein having an activity against wheat stem rust in which the amino acid sequence of (a) is substituted and/or deleted and/or added with one or more amino acids; or (b)

(c) A protein having 80% or more homology with the amino acid sequence defined in any one of (a) and (b) and having the same function.

Further, the wheat stem rust resistance protein includes a protein having 85% or more, preferably 90% or more, more preferably 95% or more, still more preferably 99% or more homology with the amino acid sequence defined in any one of (a) and (b) and having the same function.

According to a second aspect of the present application, there is provided a wheat stem rust resistance gene comprising:

(a) A nucleotide sequence encoding the wheat stem rust resistance protein; or (b)

(b) A nucleotide sequence which hybridizes under stringent conditions to the DNA molecule defined in (a) and which hybridizes under stringent conditions to the wheat stem rust resistance protein described above; or (b)

(c) Has the sequence of SEQ ID NO:2, a nucleotide sequence shown in seq id no; or (b)

(d) A gene having 70% or more homology with any one of the nucleotide sequences defined in (a) to (c) and encoding a protein having the same function.

Further, the gene includes a gene which has 75% or more, preferably 85% or more, more preferably 95% or more, still more preferably 99% or more homology with any of the nucleotide sequences defined in (a) to (c) and encodes a protein having the same function.

According to a third aspect of the present application, there is provided an expression cassette comprising a regulatory sequence and the wheat stem rust resistance gene described above.

Further, the above regulatory sequences include promoters; preferably, the promoter comprises one or more of the following promoters: constitutive, enhanced, tissue specific and inducible.

According to a fourth aspect of the present application, there is provided a recombinant vector comprising the wheat stem rust resistance gene described above or the expression cassette described above; preferably, the recombinant vector comprises a translational control signal; preferably, the translational control signals include enhancers; preferably, enhancers include translational enhancers and/or transcriptional enhancers; preferably, the translational control signals are derived from natural sequences or synthetic sequences; preferably, the recombinant vector comprises a plant expression vector; preferably, the plant expression vectors include Agrobacterium transformed binary vectors and gene gun bombarded vectors; preferably, the plant expression vector comprises pCAMBIA1300.

Further, the recombinant vector includes a reporter gene; preferably, the reporter gene comprises a resistance gene or a gene expressing an enzyme or luminescent compound that produces a color change; preferably, the above-mentioned resistance gene includes an antibiotic resistance gene or a chemical resistance gene.

According to a fifth aspect of the present application there is provided a non-plant host cell transformed with a recombinant vector as described above; preferably, the host cell comprises E.coli or Agrobacterium tumefaciens; preferably, the E.coli comprises DH 5. Alpha; preferably, the agrobacterium tumefaciens includes EHA105.

According to a sixth aspect of the present application, there is provided the use of a wheat stem rust resistance protein, wheat stem rust resistance gene, expression cassette, recombinant vector, or host cell as described above for modulating resistance to stem rust in a plant, enhancing or reducing resistance to stem rust in a plant, or growing a transgenic plant with enhanced or reduced resistance to stem rust.

According to a seventh aspect of the present application, there is provided a method for preparing a transgenic plant, comprising introducing the above wheat stem rust resistance gene, or the above expression cassette, recombinant vector, host cell carrying the wheat stem rust resistance gene, into a plant of interest to obtain a transgenic plant resistant to stem rust.

Further, the recombinant vector is introduced into the plant of interest by a plant viral vector, gene gun or agrobacterium infection method.

Further, the plant of interest is a dicotyledonous plant or a monocotyledonous plant; preferably, the plant of interest is wheat; preferably, the wheat is Fielder wheat; preferably, the wheat stem rust resistance gene is driven by a constitutive promoter.

According to an eighth aspect of the present application, there is provided a method of increasing or decreasing stem rust resistance in a plant, the method comprising increasing or decreasing the activity or amount of a wheat stem rust resistance protein in the plant of interest, such that the resistance of the plant to stem rust is increased or decreased.

Further, the method can be used for plant breeding; preferably, the plant of interest is a dicotyledonous plant or a monocotyledonous plant; preferably, the plant of interest is wheat; preferably, the wheat is Fielder wheat; preferably, stem rust is stem rust caused by a physiological race of rust-stalk bacteria; preferably, the rust-stalk physiological race is a foreign rust-stalk virulent race or a chinese rust-stalk virulent race, the foreign rust-stalk virulent race including TRTTF and/or BCCBC, the chinese rust-stalk virulent race including any one or more of RTJRM, 21C3CTTTM, 34MKGQM, 34MTGSM, and 34C3RTGQM.

By applying the technical scheme of the invention, a novel stem rust resistance protein, a coding gene and application thereof are provided, which are helpful for analyzing the research of disease resistance mechanism of disease resistance genes on pathogenic bacteria, improving the resistance of wheat to stem rust and providing a reliable and effective stem rust resistance source for wheat molecular breeding.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention. In the drawings:

FIGS. 1a,1b and 1c show schematic diagrams of example 1 according to the invention, F produced by crossing of the disease-resistant parent T4-3102 (T4-3102 is the mutant family in which Sr13 has been terminated in advance), the disease-resistant parent Rusty ₂ Identification of the resistance of the population part individuals to stem rust physiological micro-species TRTTF and BCCBC. Wherein FIG. 1a is T4-3102, rusty, part F ₂ Phenotype after stem rust physiological race TRTTF culture of the single strain is inoculated for 12 days; FIG. 1b is T4-3102, rusty, part F ₂ Phenotype after stem rust physiological race BCCBC culture for 12 days is inoculated to the single strain; FIG. 1C shows the phenotype of T4-3102 and Rusty inoculated rust physiological micro-species RTJRM, 21C3CTTTM, 34MKGQM, 34MTGSM and 34C3RTGQM after 12 days of culture. 1 is disease-resistant parent T4-3102;2 is a disease-susceptible parent Rusty;3-5 is F ₂ Disease-resistant plants separated from the population; 6-8 is F ₂ And (3) a plant with a disease separated from the population.

FIGS. 2a,2b,2c and 2d show schematic representations of examples 2 and 3 according to the invention, which are map-based clones of the stem rust resistance gene SrKN. Wherein, FIG. 2a is a wheat 2B chromosome; FIG. 2b is a fine localization genetic map of SrKN; FIG. 2c is a schematic representation of NBS-LRR (NLR) genes expressed in Svevo candidate regions of tetraploid durum wheat reference genome; FIG. 2d shows the structure of the candidate gene SrKN.

Fig. 3a and 3b show schematic diagrams according to example 4 of the present invention, which are verification of EMS mutants of SrKN gene. Wherein, FIG. 3a is a graph of the identification of the point mutant line T4-3163 (causing a mutation of R1348) of the early termination of SrKN in EMS mutant pool of durum wheat Kronos; FIG. 3b shows the phenotypic differences after 12 days of inoculation TRTTF for double mutant lines 19059-26 (-srkn-sr 13) and single mutant lines 19059-27 (-sr 13). 19059-26 is homozygous double mutant F obtained by hybridization of SrKN mutant T4-3163 (-SrKN) and Sr13 mutant T4-3102 (-Sr 13) ₃ Family; 19059-27 is a sister line of 19059-26 containing only a single mutant (-Sr 13) of Sr 13.

FIGS. 4a and 4b show a schematic representation of example 5 according to the invention, for the complementation verification of the transgene of the SrKN gene. Wherein, FIG. 4a is a SrKN chromosome fragment for transgene complementation verification, comprising 3371bp upstream of the gene, 5197bp full length of the gene (from ATG to TAA) and 2406bp downstream of the gene; FIG. 4b isControl variety Fielder and T ₀ Phenotype difference of the transgenic plants KN1, KN2, KN4, KN6 and KN7 after 12 days of inoculation culture of the physiological micro-strain 34MKGQM of the rust stalk fungus.

Detailed Description

It should be noted that, in the case of no conflict, the embodiments and features in the embodiments may be combined with each other. The present invention will be described in detail with reference to examples.

Term interpretation:

rust (r): wheat stem rust caused by wheat stalk rust, i.e., puccinia graminis wheat specialization.

Translation control signal: i.e., protein translational control signals, refer to nucleotide sequences, such as enhancers, that are present upstream or downstream of a gene and that regulate transcription of the gene of interest, thereby affecting protein translation.

Map-based cloning: i.e., positional cloning, refers to a technical method of gradually determining and isolating a target gene based on the position of a molecular marker closely linked to the target gene on a chromosome.

As mentioned in the background art, since most wheat varieties cultivated in China are not resistant to stem rust, once the wheat varieties are transferred into China, the safety production of wheat in China is seriously threatened. Cloning and utilizing stem rust resistance gene and cultivating disease-resistant wheat variety is the most economical, safe and environment-friendly measure for controlling the disease. However, to date, although more than 60 wheat stem rust resistance genes have been formally named, only a small portion of them have been successfully cloned.

Thus, the inventors of the present application conducted intensive studies on a stem rust resistance gene in tetraploid durum wheat, have precisely located, map cloned and functionally verified a stem rust resistance gene SrKN, and found that the resistance protein encoded by the gene has a wheat stem rust resistance activity. A series of protection schemes of the present application are thus presented.

In a first embodiment of the invention, there is provided a wheat stem rust resistance protein comprising:

(a) Has the sequence of SEQ ID NO:3, and a protein consisting of an amino acid sequence shown in 3; or (b)

(b) A protein having an activity against wheat stem rust in which the amino acid sequence of (a) is substituted and/or deleted and/or added with one or more amino acids; or (b)

(c) A protein having 80% or more homology with the amino acid sequence defined in any one of (a) and (b) and having the same function.

Among the above proteins, a protein having a homology of 85% or more, preferably 90% or more, more preferably 95% or more, still more preferably 99% or more with the amino acid sequence defined in any one of (a) and (b) and having the same function is preferred.

The wheat stem rust resistance protein has activity of resisting wheat stem rust. Mutating, substituting and/or deleting and/or adding one or more amino acids to the protein based on the sequence of (a), wherein if the mutation occurs at the active site of the protein, the mutation possibly causes the key amino acid binding site of the protein to be changed, so that the activity of the protein against wheat stem rust is influenced, and the activity of the protein is increased or reduced or even lost; if mutation occurs at an inactive site of the protein, it may affect the folding manner, three-dimensional structure, etc. of the protein, thereby affecting physicochemical properties and activity of the protein. Proteins having homology of 80%, 85%, 90%, 95%, 99% or more and having the same functions have the same major probability as the proteins provided by the sequence (a), and are homologous proteins obtained by amino acid mutation.

In a second embodiment of the invention, there is provided a wheat stem rust resistance gene comprising:

(a) A nucleotide sequence encoding the wheat stem rust resistance protein; or (b)

(b) A nucleotide sequence which hybridizes under stringent conditions to the DNA molecule defined in (a) and which encodes a wheat stem rust resistance protein as described above; or (b)

(c) Has the sequence of SEQ ID NO:2, a nucleotide sequence shown in seq id no; or (b)

(d) A gene having 70% or more homology with any one of the nucleotide sequences defined in (a) to (c) and encoding a protein having the same function.

Among the above genes, a gene having 75% or more, preferably 85% or more, more preferably 95% or more, still more preferably 99% or more homology with any of the nucleotide sequences defined in (a) to (c) and encoding a protein having the same function is used.

The wheat stem rust resistance gene may encode a protein having activity against wheat stem rust. Mutating the nucleotide on the basis of the sequence of (a), hybridizing with the DNA molecule defined in (a) under stringent conditions, and not generating frame shift mutation, wherein if the mutation occurs on the nucleotide of the active site of the encoded protein, the mutation can cause the key amino acid binding site of the encoded protein to be changed, so that the activity of the protein encoded by the gene against wheat stem rust is influenced, and the activity of the protein is increased or reduced or even lost; if mutations occur at nucleotides encoding inactive sites of the protein, they may affect the folding pattern, three-dimensional structure, etc. of the encoded protein, and thus the physicochemical properties and activity of the protein. A wheat stem rust resistance gene which has a homology of 70%, 75%, 85%, 95% or 99% or more and encodes a protein having the same function, wherein the active site, active pocket, active mechanism, etc. of the encoded protein are the same as those provided by the sequence (a) with a high probability, and the gene is a homologous gene obtained by nucleotide mutation.

The resistant parent Kronos of the present invention, there is a partially assembled reference genome database and a library of mutants of ethyl methylsulfonate (ethyl methane sulfonate, EMS) that are chemically mutagenized, both databases being disclosed. However, the function of the disease resistance gene SrKN contained in the resistant parent is unknown in the database, that is, in the database, the data of the resistant parent Kronos is partially assembled by sequencing, but the genome is not annotated, and the assembled data contains tens of thousands of genes, which gene is the stem rust resistance gene SrKN is not annotated.

The invention combines the genome sequence assembled by Kronos part to find the gene by using the method of map cloning, and uses EMS mutant and transgene complementation experiment to perform functional verification. The method for obtaining the gene SrKN is map cloning, and complicated steps such as fine positioning of genes, annotation analysis of sequences, candidate gene prediction, gene function verification and the like are needed, and an unknown new gene is map cloned by a forward genetic method, so that the new gene is very difficult to obtain because wheat is heteropolyploid and has huge and complex genome.

In a third embodiment of the present invention, there is provided an expression cassette comprising a regulatory sequence and the wheat stem rust resistance gene described above.

In the above expression cassette, regulatory sequences include, but are not limited to, promoters; preferably, the promoter includes, but is not limited to, one or more of the following promoters: constitutive, enhanced, tissue specific and inducible.

The expression cassette, namely the gene expression cassette, consists of a regulatory sequence and the wheat stem rust resistance gene, and can also comprise other nucleic acid fragments. The transcription, translation and other expression of the wheat stem rust resistance gene are influenced by the regulatory sequences. The regulatory sequence can be nucleic acid fragments such as promoters, enhancers, silencers, regulatory protein attachment sites and the like, wherein the promoters can be one or more of constitutive promoters, enhanced promoters, tissue-specific promoters, inducible promoters or other types of promoters to act in combination so as to achieve the aim of regulating gene expression.

In a fourth embodiment of the present invention, there is provided a recombinant vector comprising the wheat stem rust resistance gene or expression cassette described above; preferably, the recombinant vector comprises a translational control signal; translation control signals may be derived from natural sequences or synthetic sequences, including but not limited to enhancers; enhancers include translational enhancers and/or transcriptional enhancers; the recombinant vector comprises a plant expression vector; plant expression vectors include Agrobacterium transformed binary vectors and gene gun bombarded vectors such as pCAMBIA1300.

The recombinant vectors described above, comprising a wheat stem rust resistance gene or the expression cassette described above, may also comprise other nucleic acid fragments such as replication initiation sites, multiple cloning sites, translational control signals, and the like. Translation control signals derived from natural or synthetic sequences include enhancers, molecular chaperones, and other nucleotide sequences that can affect protein translation. The enhancer includes a translation enhancer and/or a transcription enhancer, and can be used singly or in combination to control protein transcription and translation. The recombinant vector can be a plant expression vector, can be transformed into a plant, expresses a target gene in the plant, and generates a target protein to play a role; plant expression vectors including, but not limited to, agrobacterium transformed binary vectors and gene gun bombarded vectors, including pCAMBIA1300 used in example 5, can be introduced into plant cells by different transformation methods to increase transformation efficiency.

The recombinant vector contains a reporter gene; preferably, the reporter gene includes, but is not limited to, a resistance gene or a gene that expresses an enzyme or luminescent compound that produces a color change; wherein the resistance gene includes, but is not limited to, an antibiotic resistance gene or a chemical resistance gene.

The recombinant vector can also comprise a reporter gene, wherein the reporter gene can be a resistance gene or a gene expressing enzyme generating color change or a luminescent compound or other genes, so that whether the recombinant vector is successfully transformed and expressed is judged through various modes such as resistance screening, color screening, fluorescence screening and the like; the resistance genes include, but are not limited to, antibiotic resistance genes or chemical reagent resistance genes, and the transformed parent can be efficiently screened by antibiotics, chemical reagents and other medicines to judge whether the recombinant vector is successfully transformed and expressed. From the aspect of transgene safety, the transformation can be directly screened whether to succeed or not by phenotype without adding any reporter gene.

In a fifth embodiment of the invention, there is provided a non-plant host cell transformed with the recombinant vector described above. Preferably, the above host cells include, but are not limited to, E.coli, agrobacterium tumefaciens; coli may be dh5α; the agrobacterium tumefaciens can be EHA105.

The host cell is transformed with a recombinant vector, and the recombinant vector can be carried to perform various functions such as recombinant vector copy, gene expression, gene integration into chromosome and the like. The host cell may be various strains such as E.coli, agrobacterium tumefaciens, etc., wherein E.coli may be conventional DH 5. Alpha. And Agrobacterium tumefaciens may be conventional EHA105 used in example 5.

In a sixth embodiment of the invention, there is provided a use in a transgenic plant of the above wheat stem rust resistance protein, gene, expression cassette, recombinant vector or host cell to regulate plant resistance to stem rust, to enhance or reduce plant resistance to stem rust, or to cultivate a transgenic plant with enhanced or reduced resistance to stem rust.

The application utilizes wheat stem rust resistance protein, gene, expression cassette, recombinant vector or host cell, and regulates the resistance of plants to stem rust by the resistance protein, the protein coded by the resistance gene and the like; enhancing or reducing plant resistance to stem rust by regulatory sequences, translational control signals, and the like; host cells harboring the recombinant vector are transformed into a parent plant using a variety of transformation means, thereby breeding transgenic plants with increased or decreased resistance to stem rust.

In a seventh embodiment of the present invention, there is provided a method of preparing a transgenic plant by introducing a wheat stem rust resistance gene, expression cassette, recombinant vector or host cell as described above into a plant of interest, resulting in a transgenic plant with increased resistance to stem rust.

In the above method, the above recombinant vector is introduced into the target plant by a plant viral vector, a gene gun or an Agrobacterium infection method.

In the above method, the plant of interest is a dicotyledonous plant or a monocotyledonous plant; preferably, the plant of interest may be wheat; wheat includes, but is not limited to Fielder wheat; the wheat stem rust resistance gene is driven by a constitutive promoter.

In the method for preparing the transgenic plant, a plurality of methods such as plant virus vectors, gene guns or agrobacterium infection are utilized to introduce a wheat stem rust resistance gene, an expression cassette, a recombinant vector or a host cell into a target plant, so as to obtain the transgenic plant with enhanced stem rust resistance. The target plant is dicotyledon or monocotyledon; preferably, the monocot plant can be wheat, varieties of which include, but are not limited to, the use of Fielder wheat. The method can be used for obtaining mutant families by establishing a mutant library, and influencing the expression of wheat stem rust resistance genes, the activity of proteins or the translation of the wheat stem rust resistance genes by means of mutation at nucleotide sites of the resistance genes, and the like, so as to obtain transgenic plants with reduced or enhanced resistance to stem rust.

In an eighth embodiment of the invention, there is provided a method of increasing or decreasing stem rust resistance in a plant, comprising:

increasing or decreasing the activity or amount of a wheat stem rust resistance protein in a plant of interest, such that the plant's resistance to stem rust is increased or decreased.

The method can increase or decrease the activity or content of the wheat stem rust resistance protein in the target plant by means of mutation of nucleotide sequences, change of regulatory sequences and/or translation control signals and the like, so that the resistance of the plant to stem rust is increased or decreased.

The above method can be used for plant breeding; preferably, the plant of interest is a dicotyledonous plant or a monocotyledonous plant; the plant of interest may be wheat; the wheat may be Fielder wheat; the rust is stem rust caused by physiological race of rust stalk; the rust fungus physiological race is a foreign epidemic rust fungus toxic race or a Chinese epidemic rust fungus toxic race, the foreign epidemic rust fungus toxic race comprises but is not limited to TRTTF and BCCBC, and the Chinese epidemic rust fungus toxic race comprises but is not limited to RTJRM, 21C3CTTTM, 34MKGQM, 34MTGSM and 34C3RTGQM.

The advantageous effects of the present application will be explained in further detail below in connection with specific examples.

Example 1: genetic analysis and resistance spectrum identification of rust resistance gene SrKN

In previous studies, the tetraploid durum wheat (t. Durum) material Kronos (i.e., PI 576168) was found to contain two stem rust resistance genes, one of which is the gene Sr13 that has been cloned in the map, and the other of which is temporarily designated SrKN. By Krono containing no Sr13 geneS mutant family T4-3102 as starting material, which is hybridized with the affected parent Rusty to produce F ₂ The populations were inoculated with the physiological race TRTTF and BCCBC of rust in africa and america, respectively, and the materials were phenotyped for stem rust 12 days after inoculation (see figures 1a and 1b for results, where R represents disease resistance and S represents disease susceptibility). Wherein the disease resistant parent T4-3102 is about three-quarters of F ₂ The individual showed good resistance, while the susceptible parent Rusty and another quarter of F ₂ The individual plant shows a high-sensitivity phenotype (figures 1a and 1 b), and the number 1 is an anti-disease parent T4-3102; number 2 is the susceptible parent Rusty;3-5 is F ₂ Disease-resistant plants separated from the population; no. 6-8 is F ₂ And (3) a plant with a disease separated from the population. By analysis of F ₂ The susceptibility to segregation ratio of the population, indicated the presence of a dominant stem rust resistance gene in T4-3102, designated SrKN.

The disease-resistant and disease-sensitive parent materials are respectively inoculated with 5 other puccinia strigosa physiological micro-seeds including RTJRM, 21C3CTTTM, 34MKGQM, 34MTGSM and 34C3RTGQM. The results show that: the disease-resistant parents T4-3102 all show disease resistance, and the disease-sensitive parents all show high sense (figure 1 c), and the No. 1 is the disease-resistant parents T4-3102; and the number 2 is a disease-susceptible parent Rusty.

Example 2: fine localization of rust resistance gene SrKN

For carrying out genetic localization on SrKN, the anti-disease parent T4-3102, the infected parent Rusty and 23 anti-disease F are treated ₂ Single plant and 23 infectious diseases F ₂ The individual was subjected to a 90K SNP chip assay to initially localize SrKN to chromosome 2BL (fig. 2 a).

For fine localization of stem rust disease-resistant gene SrKN, polymorphic sites between parents within candidate chromosomal regions were rapidly identified using the reference genome of the disease-resistant parent Kronos that has been sequenced (but not fully assembled) and the exome sequencing data of the disease-resistant parent Rusty, and molecular markers were developed. Using 1683F ₂ Segregating population of individual plants and resulting key recombinants F _2:3 The family, the resistance gene SrKN, was finely mapped between molecular markers pku4856F2R2 and pku4917F3R3 with a genetic distance of 0.29cM (fig. 2 b), the corresponding physical interval in the reference genome of tetraploid wheat Svevo was 5.6Mb.

Example 3: determination of SrKN candidate Gene as rust resistance Gene

Two tetraploid durum wheat materials Vernal and Svevo showed disease resistant phenotypes similar to T4-3102 for the above mentioned physiological races of Leptosphaeria sp. Hybridization of the selected line Td31-5R of T4-3102 with Vernal (Vernal-BF 9 e) and Svevo, respectively, gives F ₂ The population was subjected to extensive allelic testing, which indicated that they may all contain the same resistance gene SrKN.

Using the Svevo reference genome that has been completely sequenced, 52 annotated highly reliable candidate genes were found to exist within the 5.6Mb candidate interval, 9 of which are typical NBS-LRR genes. Meanwhile, comparing the Svevo genome with the partially assembled Kronos genome, the sequences of 52 candidate genes were found to be identical in Svevo and Kronos. Analysis of candidate gene expression using the published Kronos transcriptome database (https:// dubcovskylab. Ucdavis. Edu/heat_blast) revealed that 7 of the important NBS-LRR candidate genes were expressed, including TRITD2Bv1G223210, TRITD2Bv1G223370, TRITD2Bv1G223450, TRITD2Bv1G223460, TRITD2Bv1G223490, TRITD2Bv1G223550, and TRITD2Bv1G223640 (FIG. 2 c).

To further narrow the candidate gene range, haplotype analysis of different tetraploid wheat materials was performed. And (3) carrying out anti-spectrum and disease-resistant reaction type analysis to obtain a plurality of tetraploid wheat varieties possibly containing SrKN and infected wheat varieties not containing the gene, designing primers, carrying out full-length amplification on seven NBS-LRR candidate genes, and sequencing. The results indicate that TRITD2Bv1G223210 (abbreviated as CNL 1) is most likely a candidate gene for SrKN (fig. 2 d). The full length of the gene is 5197bp (from ATG to TAA, contained in SEQ ID NO: 1), the gene consists of 3 exons, the nucleotide sequence of a coding region is 4857bp (shown as SEQ ID NO: 2), and the coding protein contains 1618 amino acids (shown as SEQ ID NO: 3).

Example 4: EMS mutant verification of rust resistance Gene SrKN

Using the existing EMS mutant library of Kronos (https:// dubcovskylab. Ucdavis. Edu/heat_blast), a mutant line T4-3163 was identified from this by blast search, gene annotation and mutation site analysis, which had a point mutation in the coding region of candidate gene CNL1, resulting in premature termination of translation of the protein encoded thereby (FIG. 3 a).

Since Kronos also contains stem rust resistance gene Sr13, this gene is resistant to the stalk rust race TRTTF. Thus, T4-3163 was crossed with the disease resistant parent T4-3102 (Sr 13 premature termination mutant), at F ₂ Genotyping the population to obtain 1F containing homozygous double mutation ₂ Single plant, F ₂ F is obtained by single plant selfing ₃ Family 19059-26 in which both the SrKN candidate gene and the protein encoded by the Sr13 gene terminate prematurely; meanwhile, a sister line 19059-27 is obtained, the SrKN candidate gene is not mutated in the family, and the protein coded by the Sr13 gene is terminated in advance.

Indoor rust inoculation is carried out on the obtained families 19059-26 and 19059-27. As shown in FIG. 3b, all plants in double mutant lines 19059-26 exhibited disease resistance, while all individual plants in their sister lines 19059-27 exhibited disease resistance, demonstrating that this candidate gene CNL1 is necessary for SrKN to provide stem rust resistance.

Example 5: transgenic complementation verification of rust resistance gene SrKN

To determine whether candidate gene CNL1 provides stem rust resistance, transgenic complementation verification of candidate gene was performed.

1. Construction of complementary vector p1300-SrKN

The cloned Kronos chromosome fragment is shown as SEQ ID NO:1, including 3371bp upstream of the start codon of the gene, the full length of the gene (from ATG to TAA,5197 bp) and 2406bp downstream of the stop codon (FIG. 4 a). PCR amplification was performed using primers p1300-SrKNF1/R1 and p1300-SrKNF2/R2, and then performed according to Bao Ri doctor Material technology (Beijing) Co., ltd

The HD Cloning Kit method recombined the candidate gene onto linearized pCAMBIA1300.

Wherein the primer sequences are as follows:

p1300-SrKNF1：(SEQ ID NO：4)

CCATGATTACGAATTCGAGCTCTTGTGATCCATGTAGTCTCATCAGCTGA

p1300-SrKNR1：(SEQ ID NO：5)

TCCAAATATTCATGCCCTGTTTCCTCCAATCT

p1300-SrKNF2：(SEQ ID NO：6)

GGGCATGAATATTTGGAAAAATTAGTGGATTTGGGCTTCT

p1300-SrKNR2：(SEQ ID NO：7)

ACGGCCAGTGCCAAGCTTGTACTACAATATAACTTGGTCGGATAGAAAAGACAT

2、T ₀ generation of transgenic plants

Extracting and purifying plasmid of complementary vector p1300-SrKN by using plasmid extraction kit (purchased from Tiangen Biochemical technology Beijing Co., ltd.), transferring into Agrobacterium strain EHA105, transferring into common wheat field by Agrobacterium infection method, obtaining 14 SrKN complementary T strain ₀ And (5) replacing transgenic plants.

3. Identification of resistance of transgenic plants (pedigree)

T obtained first by using a marker pair ₀ The generation complementary transgenic plants are positively identified, and the result shows that the obtained 14 transgenic plants are all positive materials. Next, we inoculated the positive transgenic plants with the puccinia stalk physiological race 34MKGQM, and after 12 days of culture, identified phenotypes: t (T) ₀ The transgenic plants of the generations (positive transgenic plants) KN1, KN2, KN4, KN6 and KN7 all exhibited disease resistance, while the control Fielder all was disease-sensitive (fig. 4 b). Harvesting T ₀ Seed of transgenic plants to obtain T ₁ And (3) generating families, wherein 25 seeds are selected for planting in each family, and the rust bacteria inoculation is carried out when two leaves are in a heart period. Phenotypic identification results show that 10 families isolate disease-resistant and disease-sensitive individuals, while all offspring individuals in the other 4 families are disease-resistant. Genotyping results indicated that there was a co-segregation relationship between genotype and phenotype. The above results demonstrate that candidate gene CNL1 is stem rust resistance gene SrKN in T4-3102.

From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: the invention obtains the stem rust resistance gene SrKN from tetraploid durum wheat, which is helpful for analyzing the research of the disease resistance mechanism of disease resistance genes on pathogenic bacteria; the nucleotide sequence for coding the SrKN protein is introduced into wheat, so that the wheat stem rust resistance is improved, and a reliable and effective stem rust resistance source is provided for wheat molecular breeding.

The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> university of Beijing modern agriculture institute

<120> wheat stem rust resistance protein SrKN, and coding gene and application thereof

<130> PN162537XDNY

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10974

<212> DNA

<213> Triticum aestivum

<400> 1

ttgtgatcca tgtagtctca tcagctgatc tgtgaagtaa gattttaatt gccatctaat 60

ttctatttgg ttatccatgt tctgacgctg ttaggcatat gaattaaatg gagaaaattt 120

ggcggggagg cctgtcaggc ttgattttgc tcgtgagcga ggcgctatta ctcctggcag 180

cgggtgattt tctatcccac cgattatcta cctagaaatt gcctggacat gctaaccatg 240

gatgcgccta attttctgtg ttcaggaggg acaatagttc tttcaagaag cctggtcaaa 300

gcaatactgc ctttgttaga ggatttgatg catctcttgg ggaggaagag gtaattcaaa 360

gcgttaaaca tgtctttttg tggtaaaatc tgattgattt gaccgagtta aaagtttgag 420

tcttgtgtta tatgtaaatg ttttctgtca ccagatccga agctcgcttc aagatcattt 480

tagctcatgt ggagatatta gaagagtttc aatcccaaag gattatgata ctggcgcaag 540

caaagggtaa gttctttgcg gaaagcgctc tggcatataa aatgtgcctg ctccaggtca 600

atccatatcc tcgtatcttg taattgactc ttgtctgctt ggtttggtcc tgcaggatag 660

cgtacataga atttgatgac agcagttctt tgcccaaagc gcttgagctg aacgggtcta 720

acattggaga aggcttaagc ttgtttgttg atgaagccaa gcctagggca gataacagag 780

atggcgctga tagtggtaac aggagagcag gaagatttga cgggggcggg ggccgcagag 840

gtggaagatt tgatgggggc tcgggccgca gaggtggaag atttgacggg ggcgcgggcc 900

gcagaggtgg tggaagattc ggccggggtg acagaggcgg ccggagtgac aggggccgtg 960

gtcggggtgg tgcacccccc aggcagagtg ctggcacacc tagtgcaggt aacttcccgc 1020

ctacatgaac accagtctgc tctagtttca ttatctttct ggcagagaag tactggtttt 1080

tgacatttgt ttgttgtttc tttggcaggg aagaagataa ctttcggtga tgactgaaat 1140

tggtgactcc gcttgaaatt gcgcagaaac tccaacccac ccctagtgaa atgtcgaaca 1200

tttccttttt gcctggagac tcgtacttgc tgtttttaat attatgttat tattattatt 1260

gtggaccgtg gtggtttatc tgccagacta tgtcgtctgt ttgggagatt tatactcgtg 1320

atgaattttg gtcagatata tatatattac ctcttggctt tgctttggtg atttggttga 1380

ccttttaaat atgcatattt catttgtttg cttggggtat ccaacttagc ttaacagtag 1440

tgagaagcac ttgaaaatgt ctaagattta gccagggaga acccatcgct ggaattttgc 1500

agctaatgca acgggaaaat cattgtagat gcttacaaca tcaaatagaa ctgaatattt 1560

ttggcccctg caatgttttt gatcttctgt ataaaggttg gctgggccat gagctgttgc 1620

agcatcgccc atgttgtgaa gcctttgcaa tggctggccg tgcagcccgc aacatcgatg 1680

gcgacgctgc tcagtctcat ggcacggtgt ggcgcggatt gtagcaacga ctacgttggt 1740

gctgcaagcc atttaggaca gaaacaagaa aaaaaaaccc aaatgacagc agtctttttc 1800

cagatttttt tgaccagact ttctaaatat ttccgctttg ttttcagaaa gaccaaattt 1860

acatgtatag aggcgcgatg ttttgtaacc ggccgctacc cgagctgaga cctgttcatc 1920

acggccttgg tgccactctc ttccccttcc cccctcgcct cgagccgaca cctctaccac 1980

gcatttccgc gccgctcgta accgcaccag aatccacatc gcgccactca tggacgagcc 2040

cgtctaccgc ggcgtgcgtg cctgcccgcg tcccggccac gctcgcggct gtccagcggg 2100

gtcgcgccct cgacgtgttg gacgaaatgc cccgccggag aatctgcgcc tggtccacgc 2160

ggggtccacg cgcgggtggt ggccctagct agcgcagcca tcagcgtcgg cgatctccat 2220

cccagcgtcc cgtcgagtgg tggagccgga ggatcgatgt cgtgggctca tcgtgtccat 2280

ggctctcccc tggccctggt ggctcaccct cgctggtccg cagcacgagg gtaagaaaag 2340

tctctgggtt ttttctacca tatgttgctt ccttggccag attacccatg tccgcagacc 2400

aagggatgtg cagtctggtt atctgctatg ctaactgaac atacagagcc gcttcaaagt 2460

aaataaaatg gttttgctat ggttcctact gccttcagaa tttggaaacg taccctacac 2520

aagatagccg tttgggatct ctagggacac cgtgtttgag gaattgaccg gtgtaatcgt 2580

tcccccggct ccgtcttaga tagctgctcg tactctacat accaagattt tgttgacagg 2640

cacaaggttg tgtataaacc atcaagatca agctgtctca ttaatttttt ttattggtgc 2700

aaggttgtag aaaccatcga cactaagcat ctcattaatt tgtcactcgg tacaaggttg 2760

cacatactta tcaggaacca tcaacatcaa tcaaagtata taatgagtat tcagtttaag 2820

cctagcgata gcatgaccct tcgtgatgtc ttgtcccgta ctgcttgtac catttgttca 2880

gtatgcatat gcgtccacat attccaggct gctctaggac cactgcttat cctttattct 2940

cttctctagg ctcagcttcc acgaaaatac tctataattg tcatgtaaca tcataagctc 3000

gtcttttcca catggctgac agctaagtca tgtttatcag taaagaggag tctatttcac 3060

agtcatacaa tattgtgcga ctgtggagcc aagacttgat caatgacttc cacagttcca 3120

cggccgtgcg gaccccacct cgagcttgcc atgaggggcc tgtgtgtcag ttgaagggat 3180

gctagtgtta cctggtaaag ttagctgttt tttggtgcat tgttagactc ttctcatttg 3240

ctgaattgct gcctgccttt tggttcacta aaactctcct ttcctctgag accatctgtt 3300

tggtttttcc gctgtgcaag gcctaccttt gctcctgccg ttgctgtgct gccataggtg 3360

tgccgggaaa gatgtcgggg ttgcttggca cggtggttga tgcagcaata ggatggctgg 3420

tgcaaagcat ccttgacagt ttctttactg aacgtatgga agcatggact cgtgaaatcg 3480

ggcttgctga agatgtggag aagctcaagt ttcagatgag gtatgtgcag atggttcttg 3540

ctgctgccaa gggaaggagt attgacaata tgcctctggc ccagtcactg gatgatctca 3600

gagggctgat ttatgactca gaggacgtga tggacgagct tgactactac cgactcgagc 3660

aacagatcat agaaggtgct tcatatttct ttactgtttc atttttattg ctttcagttt 3720

cttttatgta ggcgtaatat gtaaccaaga gtagctgaat atcgtaggca ccacctctca 3780

gattatctct tgcttaattg tgatcttttt gaattcagct tttgttaaat tttggaactt 3840

ttattaatta ttagcacttg catgataata tttgcttttg cttaagtggc cttggtttgc 3900

ttgtcgccaa ataactgaga gttttcttat gcagggaaag gttgtagtgc tcctactggt 3960

actaatcttg aaggaagcta tgtgtcttca tccactctat cctctgtggt taaattagta 4020

tgcagtgcca caagccaaat aactgactgg atctcacatg gcagaaaaag gaaacgtgaa 4080

gaagaggggc ttgctcattg taacatgctg cctcttgaga ttaaagatag catttctaag 4140

aggatcaatg taatagtgaa tcttctatgc agtaatggaa attctgtaaa gggggttctt 4200

cagcttgaga acttgcgcac catggcaaca tcaagtaaga gtcagaatat tgccagggat 4260

cattacatga caacttctgt tccgattgag tctaaggtgt acggaagaga tgcagagaga 4320

gacaagataa tagatatgtt gataaagggg ggatctagtg atctgaatgt tctgccagtg 4380

gttggcagtg gtggtattgg gaagacgaca cttgttagat atgtatacca tgctaaaaga 4440

attaaagatc attttgattt gctaatatgg gtctgtgtat ccactaactt tgatgtagtg 4500

gggctaacac ttcagatcct agatcatgta tgtgaagata gaccatatga aaaaaaaagc 4560

agtttgaata aattgcagga gatacttcaa gaaaatatta gaaacaaaag atttctgctt 4620

gtaatggatg atatgtggga agagaaggac aggagtggat ggattaaact cttggctcca 4680

ttgaaaagta ataaagtaaa aggttgcatg gtactagcaa caaccagaac aaaatcagtg 4740

gcaaaaatga taggaactat ggatgaaatc acattgagtg gtctggatga gaaggagttt 4800

tggctgtttt tcaaggcatg tgcatttcgc aatgacaacc gcgagcacca tcctagtttg 4860

caatctattg ggaaacaaat tgctaaagca ctaaaaggct tcccactagc tgcacaaagt 4920

gttggtgcac ttctgagcac agatgttagc tatgagcatt ggacgacagt tcgggacaaa 4980

tggaaatctc ttcaaggata tgatgatgat attttaccca tcttgaagct cagttatgat 5040

tatctaccag tctaccttca gcggtgtttc tcatactgct ctttgtatcc agaggactac 5100

ggatttgatg ggaaagaatt ggtccatgcc tggatatcac agaattttgt gcaatgcaaa 5160

gatcctacca taagattgga ggaaacaggg catgaatatt tggaaaaatt agtggatttg 5220

ggcttcttcc aaaaggatgg ctcacactat gttatgcatg acctaatgca tgtattggca 5280

gggatggttt catcaaatga gtgtgctact atagatggat tgaaatccgg ggcaattcga 5340

gcaagtgttc ggcatttgtc gatcataatt actgattatg ataaagatga acatgtcagc 5400

aattctagtg agaagtttga caaaatactt cagaaggtgt cttggcagaa attgaggaca 5460

ttgatggtgt ttgggcgaag gaccatacat ttattaggtt cattacatac tttatgcaag 5520

gaggcaaaat gtttacggtt actaagaatt catgtgccag gtggcgacat cagttatata 5580

aacagtttat tgaatccatg ccatcttcgc tatataatgg catatggagt ctaccaaaaa 5640

cctgcgtttt gtcaagttct gacaaggtgc tatcaccttc aagtattgaa tgtgggcatt 5700

tttacaggcg atcgtgatgt acctactgat atgaataatc ttgttaatct gcgccatctt 5760

attgctcatg ataaagtgca ccatgcgata tattgcgtcg gcaaaatgac ctctcttcag 5820

gaactaaaat tcaaggttca aaatgttggc agttttgaga taggacaact tcagtccatg 5880

aatgagcttg tatcacttgg agcttctcaa cttgaaaatg tgaagactaa agaagaggcg 5940

agggtggcca tgctgacaca caaagagtat ctagaaacat tgtccttgtc atgggagaat 6000

agtagcatga gccttcaacc tgaggctgca aaggatgtgc ttgatggtct tcaaccacat 6060

cagaacctca aaactctaga aataactgga tatggtggtg ctacctcccc aacctggctt 6120

tctagtgcgt tttcagttac ctcactgcag atactacatc tagaggagtg caaggaatgg 6180

caaattctac caactcatgg aatgcattcc cttaggaagc tgacattgat caggatgttg 6240

aatttaatgg aactctcagt tccttccttg gtagagttga tcttgattgg catgccaaaa 6300

ttagaaaaat gtaccggttc ttatggaatg gaattgactt cccatttaag ggttttgacg 6360

atcaagaact gccctcaact gaatgagctc actcttttcc agagttactc ttctttcgac 6420

gctgagcaga aatcatggtt tccgtctctc agcaaactct ccatcgggca gtgtccttgt 6480

atattgaagt aattttcttc tctctgtttt tttcctgttc aatacatttg taaattgttg 6540

gacacttact ttgataaatg atgttgcagc aactggcaaa tcctcccact aagtgaaatg 6600

agggcgctca gtgagttgga gctgatggac ctgcatgttg gcagagtttc agttccttct 6660

ctggagaagt tggtgttgac taaaatgcca aacctggaat tttgcagcag tctaatgacc 6720

caaggagatc aaatgggatg gccatctagt ctgcgtagaa ttaccatcca tgattgccct 6780

tgtttgatag tgccacaccc tcttccgcct tctgctttga tttccgagat gtccatcagg 6840

ggagttccgg gacttgcaca aatgagtata aaccatagat ggttcactat tgaatctaat 6900

gagttgagtg tgctagatga cagtatcctg gcattcagta accttggggg cataagattg 6960

tttcaaataa gaaggtgtcc aaatctgatc tctctttcaa gtgaatcttt cagccagctc 7020

atcgctttag agactttatg tatacacgac tgccctaatc tgactatgtc aaacattatg 7080

ccagagattg tccaggaaaa cagcacgtct gcaagcagcc ttgtcctccc atctctcaaa 7140

tctgtcaaca ttagcagatg tggcgtaact gggaggtggc tatctcaact gctttcacat 7200

tcacagtccc ttgagaagtt gctattaggg ggctgtcctc agataaagtt tttatcaatc 7260

agtcaaccta cagaaacgga aggaaccagc agtttggctt ctgcagtgat gacctcagcc 7320

caagatgaac atgaattgaa actgccatat aatctcctat gttctctcaa ggtgctatgg 7380

attcagcaaa gcctggatct gaagttcttt gggggtaata gacactctac aagattcacc 7440

tctcttactg agctagtcct tgcttgttgc cctaagtttg tctcatcgtt ggtgggtgaa 7500

acgaaagatg acggtaccat tgatgttgaa ttactcccac catcacttga aaaccttttt 7560

atcggttctt tcccagaaaa cctgcagtcc tttgctcctc aaggccttct ctacctaaaa 7620

aagttaagtc tatttggtgg cccgtgtttg aagtctgtac aactgcattc ctgtacggct 7680

ttacaggagc tgcgaatcgg ggggtgtgtc cagctggctg tactggaggg cttgcagttc 7740

ctcacctccc tccgaagctt gtatattgag atgagaccgg agctgtcttc tgcatgggat 7800

ctcaaactgc aggagcaaga acagggtggg aatcaaattc agctatttcc tctgtcactt 7860

gataaacttg agatcacagc tgtcacggac agggtccaat cccgtcttct gtcctgcctt 7920

cccgccatga ccaaattagc agtacagaga agtccagaac tgacgtctct acagttggca 7980

tgctgcactg cactgaaaga gttggaaatt ggagactgcg acttgcttgc gtcgatcgag 8040

ggcctccagt tctgtagaaa cctgacatcc ttgaaagtat ttaactcccc cggcctatct 8100

tcctgtttgg agcttgtgtc gcaccagcaa ggggcctctg ggatctgctc tggactgaaa 8160

actcttgaga ttagtgatgc gtctgtcctt tccacgccct tctgcaagca gctcacatct 8220

ctaacacgcc tagagttcag tcctcggggt ggtaaacaga gagagagctt ggtgagccta 8280

acaggggaac aagagagagc gttacagctt ctaacctccc tccaagaact tgaattctct 8340

ttttacacgc atctcttgtc acttcctgca aaccttcata gcctgacctc ccttgagagg 8400

ttatctatct ttcattgtca gtgcatcaca aggctgccag acatgggcct cccaacttcg 8460

ctcaggcacc ttcagttatc ctattgtagt gacgagctaa gcatgcaatg cagaatggca 8520

gcaacggaga agctacgggt caggattgat aatcagtatg tgaattaatc accggtgtct 8580

acttccaagg tacacttccg gagcattttc cctacagaaa tagtttacac gctcaccctc 8640

ttcttgctaa aagttattca tctctctgca gactggagcc acccgagatg ttgtacatat 8700

tgctgcgctc gctgtcactg gcacatttgt gcaactgccg tatacctatt tggctttcca 8760

tgagctactc tagctgcatg atggatggac caaggaaacc atgttgaaag tggcaactct 8820

tttgttttat catgggcatt atgaatttcc gctcattctt gtgtcttcta gttgctggct 8880

gggtgtgagc tatgctgtag caagacttac catggtatgt ttttcgcttt tagttttata 8940

tcctggttag atttgtcagt ggctgagtgc tgtagttgtt ggtgatatta ttttctgaat 9000

cattgttatt ttgttagttg ctcaagcatt gttatttttt tgctaggttt gttattcagt 9060

aaactcggca acgggccgct ggagcgcaat ctcacatagg atgctatcat gtttaatgag 9120

tgatggctac acattaattt gttggttgcc tggcgctacc atttctggta tgtccagttt 9180

attgtttgtt tatgatcacc gtcactaaca cgttacacgt gagtgcacct tttctgattc 9240

atctgtcgta ccttatcgta gacgcatgtg tttgcctgat tttaaatgtt gatcatatgt 9300

ttcagctctc gacatgttat atcgtagtga gaaagaaaag aaagaaagcg tgttttaaga 9360

agaaataaaa ttttgtttat gaatcttacg tcactcagcc ttctattaac accttcgtcc 9420

tataagcaga acggaattgc tctgcggtaa aattgcatat gaaattatcc cagtcctaca 9480

gtgaacacaa tgggcgtctg ttatgcagct ttttttattc ttttaaacaa gaacctaata 9540

aactagaatt gagtcagtgg aaaaaaggtg ccgtacacag atcgtacaaa aatcatcgca 9600

cgtgtagctg cacccaagca gaatcaagta ggagcttatt tgactattgt tttacactta 9660

ttattctggt gcctgcacat ctaatctaag taggatgaat ttactgatga gccgctaatc 9720

atggtgccag gtgtgctggt gacctagtgt ggattggcag ttgagccatg tccaagaacc 9780

aagaacatct gaagacaata cagcaatcaa atcagtcggt gacaatctgt gactaaaact 9840

ggaggctgaa gtcggaggtg gggtggactg ttatacgaac tgcagcctag caaatacgag 9900

tatgttcgga ctctgaactg catggagttt catggcacca accactgatt caagagcaaa 9960

tcaatgaaga tcaatcgcga gtgatcacac acaaacccat ggatggaacc atatatggcg 10020

aggggagacc atttcttcac ggaggcaccg agaaggcagc tgcctggtgc cgctttcgct 10080

tgtcgtgaat acagagccac acataggaag ccgatcatca acggctttgc catagaacta 10140

tctaagtttt ttttctttgg agataatgaa ctattgaagt ttttttttaa agaactatca 10200

aagtattgta ttggcagttt ggcacgccat cattagtttg caaacaccgt ctcgttttgc 10260

ttcctccatc acctgatcgg ctcacgacct ccatctcctc ctctgctgcc tcctcactta 10320

tcagcagcag atcgattgtg cgaaagccgg tcgggctcga cggcagggag gctttgattg 10380

atcgtgaggt gaggaccgtc gaggtcgctc agctgaaact gcgggcatgt acagtcctcc 10440

cagatactgt ttcaagggac gtactcttct aggagtactg ctgaagaaca cctagtggaa 10500

tgctacgtac ccttgcgggt gggagggcga tgctattgct aggtgcgtcg ggctgcagcg 10560

ggcgatgaag tgttgtggcc tgtgcataaa catcatatca ccatgctaaa tcctctcaca 10620

ctattactat ttgattcata tgcacaccgt ttgcattgtt tgttcatcag ttttttttaa 10680

ttcaaacagg gcacttggat gcttaaggtc atcatgttat gtcacggcac ttgaaatctt 10740

cggtcaacca gggataactg attagtgacg actgatgaga tgaccacaca tttttcttga 10800

tggcaggcgc taccacttca ggacttcagg tacgctctgt tcattgcttt gtttatcatc 10860

accctcacca aaatgccagt gcacagttct tgattcattt tgcgcactta tcttagattc 10920

atgtattgta tatggtggat gtcttttcta tccgaccaag ttatattgta gtac 10974

<210> 2

<211> 4857

<212> DNA

<213> Triticum aestivum

<400> 2

atgtcggggt tgcttggcac ggtggttgat gcagcaatag gatggctggt gcaaagcatc 60

cttgacagtt tctttactga acgtatggaa gcatggactc gtgaaatcgg gcttgctgaa 120

gatgtggaga agctcaagtt tcagatgagg tatgtgcaga tggttcttgc tgctgccaag 180

ggaaggagta ttgacaatat gcctctggcc cagtcactgg atgatctcag agggctgatt 240

tatgactcag aggacgtgat ggacgagctt gactactacc gactcgagca acagatcata 300

gaagggaaag gttgtagtgc tcctactggt actaatcttg aaggaagcta tgtgtcttca 360

tccactctat cctctgtggt taaattagta tgcagtgcca caagccaaat aactgactgg 420

atctcacatg gcagaaaaag gaaacgtgaa gaagaggggc ttgctcattg taacatgctg 480

cctcttgaga ttaaagatag catttctaag aggatcaatg taatagtgaa tcttctatgc 540

agtaatggaa attctgtaaa gggggttctt cagcttgaga acttgcgcac catggcaaca 600

tcaagtaaga gtcagaatat tgccagggat cattacatga caacttctgt tccgattgag 660

tctaaggtgt acggaagaga tgcagagaga gacaagataa tagatatgtt gataaagggg 720

ggatctagtg atctgaatgt tctgccagtg gttggcagtg gtggtattgg gaagacgaca 780

cttgttagat atgtatacca tgctaaaaga attaaagatc attttgattt gctaatatgg 840

gtctgtgtat ccactaactt tgatgtagtg gggctaacac ttcagatcct agatcatgta 900

tgtgaagata gaccatatga aaaaaaaagc agtttgaata aattgcagga gatacttcaa 960

gaaaatatta gaaacaaaag atttctgctt gtaatggatg atatgtggga agagaaggac 1020

aggagtggat ggattaaact cttggctcca ttgaaaagta ataaagtaaa aggttgcatg 1080

gtactagcaa caaccagaac aaaatcagtg gcaaaaatga taggaactat ggatgaaatc 1140

acattgagtg gtctggatga gaaggagttt tggctgtttt tcaaggcatg tgcatttcgc 1200

aatgacaacc gcgagcacca tcctagtttg caatctattg ggaaacaaat tgctaaagca 1260

ctaaaaggct tcccactagc tgcacaaagt gttggtgcac ttctgagcac agatgttagc 1320

tatgagcatt ggacgacagt tcgggacaaa tggaaatctc ttcaaggata tgatgatgat 1380

attttaccca tcttgaagct cagttatgat tatctaccag tctaccttca gcggtgtttc 1440

tcatactgct ctttgtatcc agaggactac ggatttgatg ggaaagaatt ggtccatgcc 1500

tggatatcac agaattttgt gcaatgcaaa gatcctacca taagattgga ggaaacaggg 1560

catgaatatt tggaaaaatt agtggatttg ggcttcttcc aaaaggatgg ctcacactat 1620

gttatgcatg acctaatgca tgtattggca gggatggttt catcaaatga gtgtgctact 1680

atagatggat tgaaatccgg ggcaattcga gcaagtgttc ggcatttgtc gatcataatt 1740

actgattatg ataaagatga acatgtcagc aattctagtg agaagtttga caaaatactt 1800

cagaaggtgt cttggcagaa attgaggaca ttgatggtgt ttgggcgaag gaccatacat 1860

ttattaggtt cattacatac tttatgcaag gaggcaaaat gtttacggtt actaagaatt 1920

catgtgccag gtggcgacat cagttatata aacagtttat tgaatccatg ccatcttcgc 1980

tatataatgg catatggagt ctaccaaaaa cctgcgtttt gtcaagttct gacaaggtgc 2040

tatcaccttc aagtattgaa tgtgggcatt tttacaggcg atcgtgatgt acctactgat 2100

atgaataatc ttgttaatct gcgccatctt attgctcatg ataaagtgca ccatgcgata 2160

tattgcgtcg gcaaaatgac ctctcttcag gaactaaaat tcaaggttca aaatgttggc 2220

agttttgaga taggacaact tcagtccatg aatgagcttg tatcacttgg agcttctcaa 2280

cttgaaaatg tgaagactaa agaagaggcg agggtggcca tgctgacaca caaagagtat 2340

ctagaaacat tgtccttgtc atgggagaat agtagcatga gccttcaacc tgaggctgca 2400

aaggatgtgc ttgatggtct tcaaccacat cagaacctca aaactctaga aataactgga 2460

tatggtggtg ctacctcccc aacctggctt tctagtgcgt tttcagttac ctcactgcag 2520

atactacatc tagaggagtg caaggaatgg caaattctac caactcatgg aatgcattcc 2580

cttaggaagc tgacattgat caggatgttg aatttaatgg aactctcagt tccttccttg 2640

gtagagttga tcttgattgg catgccaaaa ttagaaaaat gtaccggttc ttatggaatg 2700

gaattgactt cccatttaag ggttttgacg atcaagaact gccctcaact gaatgagctc 2760

actcttttcc agagttactc ttctttcgac gctgagcaga aatcatggtt tccgtctctc 2820

agcaaactct ccatcgggca gtgtccttgt atattgaaca actggcaaat cctcccacta 2880

agtgaaatga gggcgctcag tgagttggag ctgatggacc tgcatgttgg cagagtttca 2940

gttccttctc tggagaagtt ggtgttgact aaaatgccaa acctggaatt ttgcagcagt 3000

ctaatgaccc aaggagatca aatgggatgg ccatctagtc tgcgtagaat taccatccat 3060

gattgccctt gtttgatagt gccacaccct cttccgcctt ctgctttgat ttccgagatg 3120

tccatcaggg gagttccggg acttgcacaa atgagtataa accatagatg gttcactatt 3180

gaatctaatg agttgagtgt gctagatgac agtatcctgg cattcagtaa ccttgggggc 3240

ataagattgt ttcaaataag aaggtgtcca aatctgatct ctctttcaag tgaatctttc 3300

agccagctca tcgctttaga gactttatgt atacacgact gccctaatct gactatgtca 3360

aacattatgc cagagattgt ccaggaaaac agcacgtctg caagcagcct tgtcctccca 3420

tctctcaaat ctgtcaacat tagcagatgt ggcgtaactg ggaggtggct atctcaactg 3480

ctttcacatt cacagtccct tgagaagttg ctattagggg gctgtcctca gataaagttt 3540

ttatcaatca gtcaacctac agaaacggaa ggaaccagca gtttggcttc tgcagtgatg 3600

acctcagccc aagatgaaca tgaattgaaa ctgccatata atctcctatg ttctctcaag 3660

gtgctatgga ttcagcaaag cctggatctg aagttctttg ggggtaatag acactctaca 3720

agattcacct ctcttactga gctagtcctt gcttgttgcc ctaagtttgt ctcatcgttg 3780

gtgggtgaaa cgaaagatga cggtaccatt gatgttgaat tactcccacc atcacttgaa 3840

aaccttttta tcggttcttt cccagaaaac ctgcagtcct ttgctcctca aggccttctc 3900

tacctaaaaa agttaagtct atttggtggc ccgtgtttga agtctgtaca actgcattcc 3960

tgtacggctt tacaggagct gcgaatcggg gggtgtgtcc agctggctgt actggagggc 4020

ttgcagttcc tcacctccct ccgaagcttg tatattgaga tgagaccgga gctgtcttct 4080

gcatgggatc tcaaactgca ggagcaagaa cagggtggga atcaaattca gctatttcct 4140

ctgtcacttg ataaacttga gatcacagct gtcacggaca gggtccaatc ccgtcttctg 4200

tcctgccttc ccgccatgac caaattagca gtacagagaa gtccagaact gacgtctcta 4260

cagttggcat gctgcactgc actgaaagag ttggaaattg gagactgcga cttgcttgcg 4320

tcgatcgagg gcctccagtt ctgtagaaac ctgacatcct tgaaagtatt taactccccc 4380

ggcctatctt cctgtttgga gcttgtgtcg caccagcaag gggcctctgg gatctgctct 4440

ggactgaaaa ctcttgagat tagtgatgcg tctgtccttt ccacgccctt ctgcaagcag 4500

ctcacatctc taacacgcct agagttcagt cctcggggtg gtaaacagag agagagcttg 4560

gtgagcctaa caggggaaca agagagagcg ttacagcttc taacctccct ccaagaactt 4620

gaattctctt tttacacgca tctcttgtca cttcctgcaa accttcatag cctgacctcc 4680

cttgagaggt tatctatctt tcattgtcag tgcatcacaa ggctgccaga catgggcctc 4740

ccaacttcgc tcaggcacct tcagttatcc tattgtagtg acgagctaag catgcaatgc 4800

agaatggcag caacggagaa gctacgggtc aggattgata atcagtatgt gaattaa 4857

<210> 3

<211> 1618

<212> PRT

<213> Triticum aestivum

<400> 3

Met Ser Gly Leu Leu Gly Thr Val Val Asp Ala Ala Ile Gly Trp Leu

1 5 10 15

Val Gln Ser Ile Leu Asp Ser Phe Phe Thr Glu Arg Met Glu Ala Trp

20 25 30

Thr Arg Glu Ile Gly Leu Ala Glu Asp Val Glu Lys Leu Lys Phe Gln

35 40 45

Met Arg Tyr Val Gln Met Val Leu Ala Ala Ala Lys Gly Arg Ser Ile

50 55 60

Asp Asn Met Pro Leu Ala Gln Ser Leu Asp Asp Leu Arg Gly Leu Ile

65 70 75 80

Tyr Asp Ser Glu Asp Val Met Asp Glu Leu Asp Tyr Tyr Arg Leu Glu

85 90 95

Gln Gln Ile Ile Glu Gly Lys Gly Cys Ser Ala Pro Thr Gly Thr Asn

100 105 110

Leu Glu Gly Ser Tyr Val Ser Ser Ser Thr Leu Ser Ser Val Val Lys

115 120 125

Leu Val Cys Ser Ala Thr Ser Gln Ile Thr Asp Trp Ile Ser His Gly

130 135 140

Arg Lys Arg Lys Arg Glu Glu Glu Gly Leu Ala His Cys Asn Met Leu

145 150 155 160

Pro Leu Glu Ile Lys Asp Ser Ile Ser Lys Arg Ile Asn Val Ile Val

165 170 175

Asn Leu Leu Cys Ser Asn Gly Asn Ser Val Lys Gly Val Leu Gln Leu

180 185 190

Glu Asn Leu Arg Thr Met Ala Thr Ser Ser Lys Ser Gln Asn Ile Ala

195 200 205

Arg Asp His Tyr Met Thr Thr Ser Val Pro Ile Glu Ser Lys Val Tyr

210 215 220

Gly Arg Asp Ala Glu Arg Asp Lys Ile Ile Asp Met Leu Ile Lys Gly

225 230 235 240

Gly Ser Ser Asp Leu Asn Val Leu Pro Val Val Gly Ser Gly Gly Ile

245 250 255

Gly Lys Thr Thr Leu Val Arg Tyr Val Tyr His Ala Lys Arg Ile Lys

260 265 270

Asp His Phe Asp Leu Leu Ile Trp Val Cys Val Ser Thr Asn Phe Asp

275 280 285

Val Val Gly Leu Thr Leu Gln Ile Leu Asp His Val Cys Glu Asp Arg

290 295 300

Pro Tyr Glu Lys Lys Ser Ser Leu Asn Lys Leu Gln Glu Ile Leu Gln

305 310 315 320

Glu Asn Ile Arg Asn Lys Arg Phe Leu Leu Val Met Asp Asp Met Trp

325 330 335

Glu Glu Lys Asp Arg Ser Gly Trp Ile Lys Leu Leu Ala Pro Leu Lys

340 345 350

Ser Asn Lys Val Lys Gly Cys Met Val Leu Ala Thr Thr Arg Thr Lys

355 360 365

Ser Val Ala Lys Met Ile Gly Thr Met Asp Glu Ile Thr Leu Ser Gly

370 375 380

Leu Asp Glu Lys Glu Phe Trp Leu Phe Phe Lys Ala Cys Ala Phe Arg

385 390 395 400

Asn Asp Asn Arg Glu His His Pro Ser Leu Gln Ser Ile Gly Lys Gln

405 410 415

Ile Ala Lys Ala Leu Lys Gly Phe Pro Leu Ala Ala Gln Ser Val Gly

420 425 430

Ala Leu Leu Ser Thr Asp Val Ser Tyr Glu His Trp Thr Thr Val Arg

435 440 445

Asp Lys Trp Lys Ser Leu Gln Gly Tyr Asp Asp Asp Ile Leu Pro Ile

450 455 460

Leu Lys Leu Ser Tyr Asp Tyr Leu Pro Val Tyr Leu Gln Arg Cys Phe

465 470 475 480

Ser Tyr Cys Ser Leu Tyr Pro Glu Asp Tyr Gly Phe Asp Gly Lys Glu

485 490 495

Leu Val His Ala Trp Ile Ser Gln Asn Phe Val Gln Cys Lys Asp Pro

500 505 510

Thr Ile Arg Leu Glu Glu Thr Gly His Glu Tyr Leu Glu Lys Leu Val

515 520 525

Asp Leu Gly Phe Phe Gln Lys Asp Gly Ser His Tyr Val Met His Asp

530 535 540

Leu Met His Val Leu Ala Gly Met Val Ser Ser Asn Glu Cys Ala Thr

545 550 555 560

Ile Asp Gly Leu Lys Ser Gly Ala Ile Arg Ala Ser Val Arg His Leu

565 570 575

Ser Ile Ile Ile Thr Asp Tyr Asp Lys Asp Glu His Val Ser Asn Ser

580 585 590

Ser Glu Lys Phe Asp Lys Ile Leu Gln Lys Val Ser Trp Gln Lys Leu

595 600 605

Arg Thr Leu Met Val Phe Gly Arg Arg Thr Ile His Leu Leu Gly Ser

610 615 620

Leu His Thr Leu Cys Lys Glu Ala Lys Cys Leu Arg Leu Leu Arg Ile

625 630 635 640

His Val Pro Gly Gly Asp Ile Ser Tyr Ile Asn Ser Leu Leu Asn Pro

645 650 655

Cys His Leu Arg Tyr Ile Met Ala Tyr Gly Val Tyr Gln Lys Pro Ala

660 665 670

Phe Cys Gln Val Leu Thr Arg Cys Tyr His Leu Gln Val Leu Asn Val

675 680 685

Gly Ile Phe Thr Gly Asp Arg Asp Val Pro Thr Asp Met Asn Asn Leu

690 695 700

Val Asn Leu Arg His Leu Ile Ala His Asp Lys Val His His Ala Ile

705 710 715 720

Tyr Cys Val Gly Lys Met Thr Ser Leu Gln Glu Leu Lys Phe Lys Val

725 730 735

Gln Asn Val Gly Ser Phe Glu Ile Gly Gln Leu Gln Ser Met Asn Glu

740 745 750

Leu Val Ser Leu Gly Ala Ser Gln Leu Glu Asn Val Lys Thr Lys Glu

755 760 765

Glu Ala Arg Val Ala Met Leu Thr His Lys Glu Tyr Leu Glu Thr Leu

770 775 780

Ser Leu Ser Trp Glu Asn Ser Ser Met Ser Leu Gln Pro Glu Ala Ala

785 790 795 800

Lys Asp Val Leu Asp Gly Leu Gln Pro His Gln Asn Leu Lys Thr Leu

805 810 815

Glu Ile Thr Gly Tyr Gly Gly Ala Thr Ser Pro Thr Trp Leu Ser Ser

820 825 830

Ala Phe Ser Val Thr Ser Leu Gln Ile Leu His Leu Glu Glu Cys Lys

835 840 845

Glu Trp Gln Ile Leu Pro Thr His Gly Met His Ser Leu Arg Lys Leu

850 855 860

Thr Leu Ile Arg Met Leu Asn Leu Met Glu Leu Ser Val Pro Ser Leu

865 870 875 880

Val Glu Leu Ile Leu Ile Gly Met Pro Lys Leu Glu Lys Cys Thr Gly

885 890 895

Ser Tyr Gly Met Glu Leu Thr Ser His Leu Arg Val Leu Thr Ile Lys

900 905 910

Asn Cys Pro Gln Leu Asn Glu Leu Thr Leu Phe Gln Ser Tyr Ser Ser

915 920 925

Phe Asp Ala Glu Gln Lys Ser Trp Phe Pro Ser Leu Ser Lys Leu Ser

930 935 940

Ile Gly Gln Cys Pro Cys Ile Leu Asn Asn Trp Gln Ile Leu Pro Leu

945 950 955 960

Ser Glu Met Arg Ala Leu Ser Glu Leu Glu Leu Met Asp Leu His Val

965 970 975

Gly Arg Val Ser Val Pro Ser Leu Glu Lys Leu Val Leu Thr Lys Met

980 985 990

Pro Asn Leu Glu Phe Cys Ser Ser Leu Met Thr Gln Gly Asp Gln Met

995 1000 1005

Gly Trp Pro Ser Ser Leu Arg Arg Ile Thr Ile His Asp Cys Pro Cys

1010 1015 1020

Leu Ile Val Pro His Pro Leu Pro Pro Ser Ala Leu Ile Ser Glu Met

1025 1030 1035 1040

Ser Ile Arg Gly Val Pro Gly Leu Ala Gln Met Ser Ile Asn His Arg

1045 1050 1055

Trp Phe Thr Ile Glu Ser Asn Glu Leu Ser Val Leu Asp Asp Ser Ile

1060 1065 1070

Leu Ala Phe Ser Asn Leu Gly Gly Ile Arg Leu Phe Gln Ile Arg Arg

1075 1080 1085

Cys Pro Asn Leu Ile Ser Leu Ser Ser Glu Ser Phe Ser Gln Leu Ile

1090 1095 1100

Ala Leu Glu Thr Leu Cys Ile His Asp Cys Pro Asn Leu Thr Met Ser

1105 1110 1115 1120

Asn Ile Met Pro Glu Ile Val Gln Glu Asn Ser Thr Ser Ala Ser Ser

1125 1130 1135

Leu Val Leu Pro Ser Leu Lys Ser Val Asn Ile Ser Arg Cys Gly Val

1140 1145 1150

Thr Gly Arg Trp Leu Ser Gln Leu Leu Ser His Ser Gln Ser Leu Glu

1155 1160 1165

Lys Leu Leu Leu Gly Gly Cys Pro Gln Ile Lys Phe Leu Ser Ile Ser

1170 1175 1180

Gln Pro Thr Glu Thr Glu Gly Thr Ser Ser Leu Ala Ser Ala Val Met

1185 1190 1195 1200

Thr Ser Ala Gln Asp Glu His Glu Leu Lys Leu Pro Tyr Asn Leu Leu

1205 1210 1215

Cys Ser Leu Lys Val Leu Trp Ile Gln Gln Ser Leu Asp Leu Lys Phe

1220 1225 1230

Phe Gly Gly Asn Arg His Ser Thr Arg Phe Thr Ser Leu Thr Glu Leu

1235 1240 1245

Val Leu Ala Cys Cys Pro Lys Phe Val Ser Ser Leu Val Gly Glu Thr

1250 1255 1260

Lys Asp Asp Gly Thr Ile Asp Val Glu Leu Leu Pro Pro Ser Leu Glu

1265 1270 1275 1280

Asn Leu Phe Ile Gly Ser Phe Pro Glu Asn Leu Gln Ser Phe Ala Pro

1285 1290 1295

Gln Gly Leu Leu Tyr Leu Lys Lys Leu Ser Leu Phe Gly Gly Pro Cys

1300 1305 1310

Leu Lys Ser Val Gln Leu His Ser Cys Thr Ala Leu Gln Glu Leu Arg

1315 1320 1325

Ile Gly Gly Cys Val Gln Leu Ala Val Leu Glu Gly Leu Gln Phe Leu

1330 1335 1340

Thr Ser Leu Arg Ser Leu Tyr Ile Glu Met Arg Pro Glu Leu Ser Ser

1345 1350 1355 1360

Ala Trp Asp Leu Lys Leu Gln Glu Gln Glu Gln Gly Gly Asn Gln Ile

1365 1370 1375

Gln Leu Phe Pro Leu Ser Leu Asp Lys Leu Glu Ile Thr Ala Val Thr

1380 1385 1390

Asp Arg Val Gln Ser Arg Leu Leu Ser Cys Leu Pro Ala Met Thr Lys

1395 1400 1405

Leu Ala Val Gln Arg Ser Pro Glu Leu Thr Ser Leu Gln Leu Ala Cys

1410 1415 1420

Cys Thr Ala Leu Lys Glu Leu Glu Ile Gly Asp Cys Asp Leu Leu Ala

1425 1430 1435 1440

Ser Ile Glu Gly Leu Gln Phe Cys Arg Asn Leu Thr Ser Leu Lys Val

1445 1450 1455

Phe Asn Ser Pro Gly Leu Ser Ser Cys Leu Glu Leu Val Ser His Gln

1460 1465 1470

Gln Gly Ala Ser Gly Ile Cys Ser Gly Leu Lys Thr Leu Glu Ile Ser

1475 1480 1485

Asp Ala Ser Val Leu Ser Thr Pro Phe Cys Lys Gln Leu Thr Ser Leu

1490 1495 1500

Thr Arg Leu Glu Phe Ser Pro Arg Gly Gly Lys Gln Arg Glu Ser Leu

1505 1510 1515 1520

Val Ser Leu Thr Gly Glu Gln Glu Arg Ala Leu Gln Leu Leu Thr Ser

1525 1530 1535

Leu Gln Glu Leu Glu Phe Ser Phe Tyr Thr His Leu Leu Ser Leu Pro

1540 1545 1550

Ala Asn Leu His Ser Leu Thr Ser Leu Glu Arg Leu Ser Ile Phe His

1555 1560 1565

Cys Gln Cys Ile Thr Arg Leu Pro Asp Met Gly Leu Pro Thr Ser Leu

1570 1575 1580

Arg His Leu Gln Leu Ser Tyr Cys Ser Asp Glu Leu Ser Met Gln Cys

1585 1590 1595 1600

Arg Met Ala Ala Thr Glu Lys Leu Arg Val Arg Ile Asp Asn Gln Tyr

1605 1610 1615

Val Asn

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(50)

<223> p1300-SrKNF1 PCR amplification F-terminal primer

<400> 4

ccatgattac gaattcgagc tcttgtgatc catgtagtct catcagctga 50

<210> 5

<211> 32

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(32)

<223> p1300-SrKNR1 PCR amplification R-terminal primer

<400> 5

tccaaatatt catgccctgt ttcctccaat ct 32

<210> 6

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(40)

<223> p1300-SrKNF2 PCR amplification of F-terminal primer

<400> 6

gggcatgaat atttggaaaa attagtggat ttgggcttct 40

<210> 7

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<221> misc_feature

<222> (1)..(54)

<223> p1300-SrKNR2 PCR amplification R-terminal primer

<400> 7

acggccagtg ccaagcttgt actacaatat aacttggtcg gatagaaaag acat 54

Claims (38)

1. A wheat stem rust resistance protein comprising a polypeptide consisting of SEQ ID NO:3, and a protein composed of the amino acid sequences shown in 3.

2. A wheat stem rust resistance gene comprising a nucleotide sequence encoding the wheat stem rust resistance protein of claim 1.

3. The gene of claim 2, wherein the wheat stem rust resistance gene comprises the amino acid sequence of SEQ ID NO:2, and a nucleotide sequence shown in the following formula.

4. The gene of claim 2, characterized by having a sequence identical to SEQ ID NO:2 and a gene encoding the wheat stem rust resistance protein of claim 1.

5. The gene of claim 2, characterized by having a sequence identical to SEQ ID NO:2 and a gene encoding the wheat stem rust resistance protein of claim 1.

6. The gene of claim 2, characterized by having a sequence identical to SEQ ID NO:2 and a gene encoding the wheat stem rust resistance protein of claim 1.

7. The gene of claim 2, characterized by having a sequence identical to SEQ ID NO:2 and a gene encoding the wheat stem rust resistance protein of claim 1.

8. The gene of claim 2, characterized by having a sequence identical to SEQ ID NO:2 and a gene encoding the wheat stem rust resistance protein of claim 1.

9. An expression cassette comprising a regulatory sequence and the wheat stem rust resistance gene of any one of claims 2 to 8.

10. The expression cassette of claim 9, wherein the regulatory sequence comprises a promoter.

11. The expression cassette of claim 10, wherein the promoter comprises one or more of the following promoters: constitutive, enhanced, tissue specific and inducible.

12. A recombinant vector comprising the wheat stem rust resistance gene of any one of claims 2 to 8 or the expression cassette of any one of claims 9 to 11.

13. The recombinant vector according to claim 12, wherein the recombinant vector comprises a translation control signal.

14. The recombinant vector according to claim 13, wherein the translational control signal comprises an enhancer.

15. The recombinant vector according to claim 14, characterized in that the enhancer comprises a translation enhancer and/or a transcription enhancer.

16. The recombinant vector according to claim 15, wherein the translational control signal is derived from a natural sequence or a synthetic sequence.

17. The recombinant vector according to claim 12, wherein the recombinant vector comprises a plant expression vector.

18. The recombinant vector according to claim 17, wherein the plant expression vector comprises an agrobacterium transformed binary vector and a gene gun bombarded vector.

19. The recombinant vector according to claim 17, wherein said plant expression vector comprises pCAMBIA1300.

20. The recombinant vector according to claim 12, wherein the recombinant vector comprises a reporter gene.

21. The recombinant vector according to claim 20, wherein the reporter gene comprises a resistance gene or a gene expressing an enzyme or a luminescent compound that produces a color change.

22. The recombinant vector according to claim 21, wherein the resistance gene comprises a chemical resistance gene.

23. The recombinant vector according to claim 22, wherein the chemical resistance gene comprises an antibiotic resistance gene.

24. A non-plant host cell transformed with the recombinant vector of any one of claims 12 to 23.

25. The host cell of claim 24, wherein the host cell comprises escherichia coli or agrobacterium tumefaciens.

26. The host cell of claim 25, wherein the escherichia coli comprises DH5 a.

27. The host cell of claim 25, wherein the agrobacterium tumefaciens comprises EHA105.

28. Use of the wheat stem rust resistance protein of claim 1, or the wheat stem rust resistance gene of any one of claims 2 to 8, or the expression cassette of any one of claims 9 to 11, or the recombinant vector of any one of claims 12 to 23, or the host cell of any one of claims 24 to 27, for modulating wheat resistance to stem rust or cultivating transgenic wheat with increased or decreased resistance to stem rust.

29. The use of claim 28, wherein said modulating wheat resistance to stem rust comprises increasing or decreasing wheat resistance to stem rust.

30. A method for preparing a transgenic plant, characterized in that

The wheat stem rust resistance gene of any one of claims 2-8,

Or the expression cassette of any one of claims 9 to 11,

Or the recombinant vector according to any one of claims 12 to 23,

Or the host cell of claim 24, to a plant of interest, to obtain said transgenic plant resistant to stem rust;

the target plant is wheat.

31. The method of claim 30, wherein the recombinant vector is introduced into the plant of interest by means of a gene gun or agrobacterium infection.

32. The method of claim 30 wherein the wheat is Fielder wheat.

33. The method of claim 30, wherein the wheat stem rust resistance gene is driven by a constitutive promoter.

34. A method of increasing or decreasing stem rust resistance in a plant, the method comprising:

increasing or decreasing the activity or amount of the wheat stem rust resistance protein of claim 1 in a plant of interest such that the plant has increased or decreased resistance to stem rust;

the target plant is wheat.

35. The method of claim 34, wherein the method is used in plant breeding.

36. The method of claim 34 wherein the wheat is Fielder wheat.

37. The method of claim 34, wherein the stem rust is stem rust caused by a physiological race of puccinia striolata.

38. The method of claim 37, wherein the rust physiological race is a foreign rust epidemic or a chinese rust epidemic, the foreign rust epidemic including TRTTF and/or BCCBC, the chinese rust epidemic including any one or more of RTJRM, 21C3CTTTM, 34MKGQM, 34MTGSM, and 34C3RTGQM.

Images