CN114621941A

CN114621941A - Protein with lysophospholipase and phospholipase activity

Info

Publication number: CN114621941A
Application number: CN202011434650.9A
Authority: CN
Inventors: 宣姚吉; 徐正军; 牛其文; 王圣南
Original assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Current assignee: Wilmar Shanghai Biotechnology Research and Development Center Co Ltd
Priority date: 2020-12-10
Filing date: 2020-12-10
Publication date: 2022-06-14

Abstract

The invention provides a protein with lysophospholipase and/or phospholipase activity. The protein provided by the invention has the amino acid sequence similar to SEQ ID NO: 3.4, 5, 6 or 19, or a sequence substantially identical to SEQ ID NO: 3.4, 5, 6 or 19, and the protein is derived from aspergillus niger. The protein of the present invention can be used not only as phospholipase and/or lysophospholipase, but also in applications requiring both phospholipase and lysophospholipase, for example, in the preparation of L-alpha-glycerophosphocholine.

Description

Protein with lysophospholipase and phospholipase activity

Technical Field

The application relates to the field of phospholipase, in particular to a protein with lysophospholipase and phospholipase activity.

Background

Two lipases have been reported in A.niger, known as Lipase A and Lipase B, or as Lipase1 and Lipase 2. The property of the lipaseB is special, the Zhu Shu-sen clones and expresses the lipaseB from Aspergillus niger A733, the optimum temperature of the lipaseB is 15 ℃, the optimum pH is 3.5-4.0, the temperature higher than 40 ℃ cannot be tolerated, and the substrate with the chain length of pNPC4-pNPC18 can be hydrolyzed, wherein the pNPC12 is the optimum substrate. However, the specific enzyme activity of the lipB is extremely low, and the specific enzyme activity of the purified lipB is only 6.8U/mg.

Jiangke Yang et al cloned and expressed lipase2 from Aspergillus niger CICC 4009, although this lipase2 and Zhu Shu-sen cloned lipase B is highly homologous, only has two amino acid differences, but the nature has a certain degree of difference, the most suitable substrates are pNPC8 and pNPC10, the most suitable pH is less than 6.5, the most suitable temperature is 50 ℃, can not tolerate the temperature over 40 ℃.

As described above, lipse 2 or lipaseB derived from Aspergillus niger is not highly practical, and is at first extremely low in specific enzyme activity and temperature tolerance, and is suitable for triglycerides of short-chain fatty acids which are the most suitable substrate. The lipase TL and RML which are not used widely have the specific enzyme activity of 12000 or 8000U/mg, the TL can endure the temperature of 60 ℃ for 20 hours without inactivation, and the RML can hydrolyze the triglyceride of various long-chain fatty acids.

In order to solve the above problems, a new protein sequence having lysophospholipase and phospholipase activities is required.

Summary of The Invention

The present invention provides in a first aspect a protein having lysophospholipase and/or phospholipase activity.

The protein provided by the invention has the amino acid sequence shown in SEQ ID NO: 3.4, 5, 6 or 19, or a sequence substantially identical to SEQ ID NO: 3.4, 5, 6 or 19, and the protein is derived from aspergillus niger.

In some embodiments of the invention, the protein has a sequence identical to SEQ ID NO: 3.4, 5, 6 or 19, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

In a second aspect, the invention also provides a polynucleotide sequence.

The polynucleotide sequences provided by the invention are selected from: (1) a polynucleotide encoding a polypeptide of the first aspect; (2) a polynucleotide complementary to the polynucleotide sequence of (1); and (3) a fragment of the polynucleotide of (1) or (2) which is 10 to 40 bases in length. In some embodiments of the invention, the polynucleotide has a sequence as set forth in SEQ ID NO: 7. 8, 9, 10 or 20.

In a third aspect, the invention also provides a polynucleotide construct.

The present invention provides a polynucleotide construct comprising the polynucleotide sequence of the second aspect.

In some embodiments of the invention, the polynucleotide construct is an expression vector or a cloning vector.

In a fourth aspect, the invention also provides a host cell.

The host cell provided by the invention: (1) expressing the polypeptide of the first aspect; and/or (2) a polynucleotide construct comprising a polynucleotide sequence of the second aspect or of the third aspect.

In some embodiments of the invention, the host cell is selected from prokaryotic or eukaryotic microorganisms.

In some embodiments of the invention, the host cell is preferably selected from Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus, Trichoderma reesei, and/or Aspergillus oryzae.

In a fifth aspect, the present invention also provides a composition comprising the protein of the first aspect.

In some embodiments of the invention, the composition is an enzyme composition. In some embodiments of the invention, the enzyme composition further comprises one or more of phospholipase a1, phospholipase a2, phospholipase B, phospholipase C, amylase, lipase, protease, cellulase.

In some embodiments of the invention, the composition is a fermentation expression of the host cell of the fourth aspect, e.g., a fermentation broth, a fermentation concentrate, a fermentation supernatant, an enzyme preparation made from a fermentation broth.

In a sixth aspect, the present invention also provides a composition comprising a protein of the first aspect and optionally an adjuvant.

In some embodiments of the invention, the adjunct is an adsorbent material selected from the group consisting of activated carbon, alumina, diatomaceous earth, porous ceramics, porous glass.

In a seventh aspect, the present invention provides a method of producing a protein of the first aspect, comprising the step of fermenting a host cell of the fourth aspect.

In an eighth aspect, the invention also provides the use of a polypeptide of the first aspect, a polynucleotide sequence of the second aspect, a nucleic acid construct of the third aspect, a host cell of the fourth aspect, a composition of the fifth aspect or a composition of the sixth aspect in vegetable oil degumming, bread dough modification, starch hydrolysate treatment, lysophospholipase preparation and/or L- α -glycerophosphocholine.

Drawings

FIG. 1 shows the specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL, CBS-LipaseB phospholipase A1.

FIG. 2 shows the specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL, CBS-LipaseB lysophospholipase.

FIG. 3 shows the specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB lipase.

FIG. 4 shows the results of AN02-LPL, AN05-LPL, AN08-LPL, CBS-LipaseB degumming tests.

Detailed Description

While this application contains many specifics, these should not be construed as limitations on the scope of the invention or of what may be claimed, but rather as descriptions of features that may be specific to particular embodiments of particular inventions. Certain features that are described in the context of separate embodiments in this application can also be implemented in combination in a single embodiment. Conversely, various features that are described in the context of a single embodiment can also be implemented in multiple embodiments separately or in any suitable subcombination. Moreover, although features may be described above as acting in certain combinations and even initially claimed as such, one or more features from a claimed combination can in some cases be excised from the combination, and the claimed combination may be directed to a subcombination or variation of a subcombination.

Unless otherwise indicated, the terms herein have the same meaning as commonly understood by one of ordinary skill in the art, e.g., in reference to the starting materials and products, operating steps, process parameters, equipment and tools used, and units of values.

As used herein, the terms "comprises" and "comprising" mean either open or closed. For example, the term "comprises" or "comprising" may mean that other elements or steps or other elements not listed may also be included or included, or that only the listed elements or steps or other elements may be included or included.

Herein, the term "about" (e.g., in component amounts and processing parameters) is to be interpreted in a sense that is generally understood by those skilled in the art. In general, the term "about" may be understood as any value within plus or minus 5% of a given value, for example, about X may represent any value in the range of 95% X to 105% X.

It should also be understood that the specific values given herein (e.g., in component amounts, temperatures, and processing times) are not to be construed as individual values, but are to be construed to provide endpoints of a range and combinations of other ranges. For example, while it is disclosed that the treatment may be performed for 30 minutes or 180 minutes, it is also correspondingly disclosed that the treatment may be performed for 30 minutes to 180 minutes. Further, particular numerical values given herein are also to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical values set forth herein are approximations that may vary depending upon the requirements. For example, a treatment time of 30 minutes may be understood as a treatment time of about 30 minutes, and a treatment time of 30 minutes to 180 minutes may be understood as a treatment time of about 30 minutes to about 180 minutes or about 30 minutes to 180 minutes.

In a first aspect, the present invention provides a protein having lysophospholipase and/or phospholipase activity, and thus, being useful as a phospholipase and/or lysophospholipase alone, and also useful in applications requiring both phospholipase and lysophospholipase, for example, in the preparation of L- α -glycerophosphocholine.

In some embodiments of the invention, the protein has a sequence identical to SEQ ID NO: 3.4, 5, 6 or 19, or a sequence thereof, which is at least 91%, 92%, 93%, 94%, 95% homologous thereto.

In some embodiments of the invention, a portion of the protein has higher thermostability, and in these embodiments of the invention, the protein used is a polypeptide having the sequence of SEQ ID NO:19, or a sequence corresponding to SEQ ID NO:19, and the protein is derived from aspergillus niger.

In the present invention, the protein may be an "isolated" protein. Herein, "isolated" means a form or substance that does not occur in nature. Non-limiting examples of isolated substances include any non-naturally occurring substance and any substance that is at least partially removed from one or more or all of the naturally occurring components with which it is associated in nature, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor.

The invention also includes the nucleic acid sequences set forth in SEQ ID NO: 3.4, 5, 6 or 19, while retaining the enzymatic activity of the amino acid sequence shown in SEQ ID No. 3, 4, 5, 6 or 19, with one or more (typically 1-10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid mutations (deletions, insertions and/or substitutions). In certain embodiments, the amino acid mutation is a polypeptide having one or more (typically up to 20, preferably up to 10, more preferably up to 8) amino acids added to the C-terminus and/or N-terminus of SEQ ID NO 3, 4, 5, 6 or 19.

It is well known to those skilled in the art that in gene cloning procedures, it is often necessary to design appropriate cleavage sites, which necessitate the introduction of one or more irrelevant residues at the end of the expressed protein, without affecting the activity of the protein of interest. Also, for example, to construct a fusion protein, to facilitate expression of a recombinant protein, to obtain a recombinant protein that is automatically secreted outside of a host cell, or to facilitate purification of a recombinant protein, it is often necessary to add amino acid sequences to the N-terminus, C-terminus, or other suitable regions within the recombinant protein, such amino acid sequences including, but not limited to, linker peptides, signal peptides, leader peptides, terminal extensions, glutathione S-transferase (GST), maltose E binding protein, protein a, tags (e.g., 6His or Flag), or suitable proteolytic enzyme sites, and the like. It is understood that the presence of these amino acid sequences does not affect the activity of the resulting polypeptide. Thus, the invention also includes polypeptides having one or more amino acids at the C-terminus and/or N-terminus of the polypeptide of the invention or a suitable region within its protein that facilitates construction of an expression vector for the polypeptide, expression of the polypeptide and/or purification of the polypeptide, which polypeptides still have the enzymatic activity described herein.

In the present invention, sequence homology is used to describe the correlation between two amino acid sequences or between two nucleotide sequences. Sequence identity can be calculated using methods well known in the art. For example, the sequence homology between two amino acid sequences can be determined using the Needman-Wunsch algorithm (Needleman and Wunsch, 1970, J. mol. biol., 48: 443) -453) implemented in the Needle (Needle) program of the EMBOSS package (EMBOSS: European molecular biology open software suite, Rice et al, 2000, trends in genetics, 16: 276-.

In a second aspect, the invention also provides a polynucleotide sequence.

The polynucleotide sequences provided by the invention are selected from: (1) a polynucleotide encoding a polypeptide of the first aspect; (2) a polynucleotide complementary to the polynucleotide sequence of (1); and (3) a fragment of the polynucleotide of (1) or (2) which is 10 to 40 bases in length.

In some embodiments of the invention, the polynucleotide has a sequence as set forth in SEQ ID NO: 7. 8, 9, 10 or 20.

In some embodiments of the invention, one skilled in the art may optimize the codon preference of the polynucleotide sequence depending on the expression plasmid and/or host used.

In the present invention, the sequence encoding the polypeptide of the present invention includes: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide. It will be appreciated that due to the nature of eukaryotes, it is also possible to add intron sequences to the polynucleotide sequences of the invention, provided that the enzyme expressed by the eukaryotes is an enzyme of the first aspect of the invention.

In a third aspect, the invention also provides a polynucleotide construct.

The present invention also relates to nucleic acid constructs comprising an isolated polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences. The term "operably linked" refers to regulatory sequences positioned at appropriate locations so as to control and direct the expression of a polynucleotide sequence of interest. Polynucleotides encoding the polypeptides of the invention may be manipulated in a variety of ways to ensure expression of the polypeptides.

The control sequence may be an appropriate promoter sequence, a nucleotide sequence recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter sequence comprises transcriptional regulatory sequences linked to the expression of the polypeptide. The promoter may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

Examples of suitable promoters for directing transcription of the nucleic acid constructs of the invention, particularly in bacterial host cells, are promoter sequences obtained from the bacteriophage T7 promoter, the E.coli lac operon, the Streptomyces coelicolor agarase gene, the Bacillus subtilis levansucrase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens alpha-amylase gene, the Bacillus licheniformis penicillinase gene, and the like.

Examples of suitable promoters for directing the transcription of the nucleic acid construct of the invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Trichoderma reesei endoglucanase and the like, as well as mutated, truncated, and hybrid (hybrid) promoters thereof.

In a yeast host, useful promoters may be obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase, glyceraldehyde 3-phosphate dehydrogenase, Saccharomyces cerevisiae triose phosphate isomerase, Saccharomyces cerevisiae 3-phosphoglycerate kinase, Pichia pastoris alcohol oxidase. Other useful promoters for Yeast host cells are described by Romanos et al, 1992, Yeast8: 423-488.

The control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

A preferred terminator for use in a bacterial host may be the terminator from the T7 bacteriophage.

Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase.

Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C, Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase, Pichia pastoris alcohol oxidase, and the like.

The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The check-in sequence is operably linked to the 5' terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino acid terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may comprise a signal peptide coding region foreign to the coding region. Where the coding sequence does not naturally contain a signal peptide coding region, a foreign signal peptide coding region may be required. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region that directs the expressed polypeptide into the secretory pathway of a host cell of choice, i.e., into the culture medium, may be used in the present invention.

In certain embodiments, the nucleic acid construct of the invention is an expression cassette. The term "expression cassette" refers to the complete elements required for expression of a gene, including the promoter, gene coding sequence, PolyA tailing signal sequence.

The expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleotide sequence of interest. Cloning vectors are generally capable of being propagated in large numbers in a host cell after introduction into the host cell.

The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may comprise any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids, or a transposon, which together contain the total DNA to be introduced into the genome of the host cell, may be used.

The vectors of the invention preferably comprise one or more selectable markers that allow for easy selection of transformed, transfected, transduced, or the like cells. Selectable markers are genes whose products provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophy to auxotrophs, and the like.

The vectors of the present invention preferably contain elements that permit integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome.

More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase the yield of the gene product. An increase in the copy number of a polynucleotide can be obtained by integrating at least one additional copy of the sequence into the genome of the host cell or by including an amplifiable selectable marker gene with the polynucleotide, wherein cells containing amplified copies of the selectable marker gene and, thus, additional copies of the polynucleotide can be screened for by culturing the cells in the presence of the appropriate selectable agent.

The vectors of the present invention preferably comprise a synthetic sequence containing multiple restriction enzyme recognition sites to provide multiple sites or insertion schemes for foreign DNA.

In a fourth aspect, the invention also provides a host cell.

In some embodiments of the invention, the host cell is selected from a prokaryotic or eukaryotic microorganism.

The host cell may be a unicellular microorganism or a non-unicellular microorganism. Unicellular microorganisms such as gram-positive bacteria, including but not limited to bacillus cells, e.g., bacillus alkalophilus, bacillus amyloliquefaciens, bacillus brevis, bacillus megaterium, bacillus subtilis, bacillus licheniformis, bacillus coagulans, bacillus stearothermophilus, bacillus thuringiensis, and the like; or a streptomyces cell, such as streptomyces lividans; or gram-negative bacteria such as E.coli and Pseudomonas. In a preferred aspect, the bacterial host is a Bacillus subtilis, Escherichia coli, Bacillus licheniformis, Bacillus stearothermophilus, and Escherichia coli cell.

The host cell may also be a eukaryote, such as a mammalian, insect, plant, yeast, or fungal cell. In a preferred aspect, the host cell is a eukaryotic cell, and as used herein, "eukaryotic" includes Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, Oomycota, and others.

In a more preferred aspect, the host cell is a cell of the phylum Ascomycota, such as Saccharomyces (Saccharomyces), Pichia (Pichia), Yarrowia (Yarrowia), Candida (Candida), and Komagataella, among others.

In some embodiments of the invention, the host cell is selected from Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus, Trichoderma reesei, and/or Aspergillus oryzae.

The phospholipase of the invention can be used for reducing the phospholipid content of edible oil. This process can be used to purify any edible oil containing phospholipids, such as vegetable oils (e.g., soybean oil, rapeseed oil, sunflower seed oil). Typically, the oil contains 50-1000ppm phosphorus in the form of phospholipids at the start of the treatment with phospholipase, which can reduce the phosphorus value to below 5-10 ppm. The phospholipase treatment is done by spreading an aqueous solution of the phospholipase, preferably in the form of droplets having an average diameter below 10 um. Preferably, the amount of water is 0.5 to 5% by weight of the oil. An emulsifier may be added. Mechanical agitation may be used to maintain emulsification. The phospholipase treatment may be performed at a pH range of about 3.5 to 5 to maximize enzyme performance, or a pH range of about 1.5 to 3 (e.g., 2-3) may be used to inhibit alkaline hydrolysis (saponification) of triglycerides. A suitable temperature for pHo may be adjusted by the addition of citric acid, citric acid buffer or hydrochloric acid, typically 30-70 deg.C (especially 30-45 deg.C, such as 35-40 deg.C) and the reaction time typically 1-12 hours (such as 2-6 hours). Suitable enzyme dosages will generally be in the range of 0.1 to 10mg per liter (e.g. 0.5 to 5mg per liter). The phospholipase treatment may be carried out batchwise (e.g. in a stirred vessel) or it may be carried out continuously (e.g. in a series of stirred reaction vessels). The phospholipase treatment is followed by separation of the aqueous and oil phases. This separation can be accomplished by conventional means (e.g., centrifugation). The aqueous phase contains phospholipases and these enzymes can be recycled to improve the economics of the process. This treatment can be accomplished using various methods known in the art.

Baked products are made from a dough, which is typically made from the basic ingredients flour, water and optionally salt. Other optional ingredients include sugars, flavors, and the like, depending on the baked product. For fermentation products, baker's yeast is used mainly after a chemical fermentation system, such as a combination of an acid (acid generating compound) and bicarbonate. In order to improve the handling characteristics of the dough and the final properties of the baked product, efforts have been made to develop means to help improve the properties. Dough properties that need to be improved include processability, gas retention, and the like. Properties of baked products that can be improved include: bread volume, crust crispness, crumb texture and softness, taste and aroma, and shelf life. The processing aids currently available can be divided into two groups: chemical additives and enzymes.

Chemical additives that improve properties include oxidizing agents (such as ascorbic acid, salts of australic acid, and azocarbonates), reducing agents (such as L-cysteine and glutathione), emulsifiers as dough conditioners (such as diacetyl tartaric acid esters of mono/Diglycerides (DATEM), Sodium Stearoyl Lactylate (SSL) or Calcium Stearoyl Lactylate (CSL)), or emulsifiers as crumb softeners (such as Glycerol Monostearate (GMS) and the like), fatty materials (such as triglycerides (fats) or lecithin, among others).

There is a current trend to replace chemical additives with enzymes. The latter are considered to be more natural compounds and are therefore more acceptable to consumers. Suitable enzymes may be selected from amylases, arabinoxylans and other hemicellulose degrading enzymes, cellulose degrading enzymes, oxidases, lipolytic enzymes and proteinases.

The present invention also relates to a method of preparing a dough or a baked product, the method comprising incorporating into the dough an effective amount of a phospholipase of the invention that improves one or more properties of the dough or a baked product derived from the dough, relative to the dough or baked product without added polypeptide.

The phospholipase of the invention can be used for degumming of aqueous sugar solutions or slurries to improve filterability, especially starch hydrolysates, especially wheat starch hydrolysates which are difficult to filter and give cloudy filtrates. This treatment can be accomplished using methods well known in the art.

The phospholipase of the invention can be used in any application where it is desired to hydrolyze a phospholipid or obtain a specific cleavage product thereof. For example, lysophospholipids, diacylglycerols, choline-or ethanolamine-phosphate, lysophosphatidylcholine, lysophosphatidylethanolamine and various phosphatidic acids can be produced using the phospholipases of the present invention. The phospholipase of the invention is preferably used for optimal activity pH.

Examples

The present application is further illustrated with reference to specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present application. Experimental procedures without specific conditions noted in the examples below are generally carried out under conventional conditions or under conditions recommended by the manufacturer. Percentages are by mass unless otherwise indicated. Unless defined otherwise, all terms of art or science used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the present application. The preferred methods and materials described herein are exemplary only.

Examples of the present application, use

Aspergillus niger strains GIM 3.24(AN02), GIM 3.150(AN03), GIM3.488(AN04), GIM 3.452(AN07), GIM3.564(AN05) were purchased from Guangdong province culture Collection,

CICC40273(AN08) is purchased from China center for culture Collection of Industrial microorganisms;

the A.niger AS3.795 strain was purchased from the institute of microorganisms of the Chinese academy of sciences.

The pAOP-Eno vector was constructed by the inventors in accordance with the method described in molecular cloning, A Laboratory Manual (third edition, New York, Cold Spring Harbor Laboratory Press, New York: Cold Spring Harbor Laboratory Press, 1989) as follows:

the RML gene (SEQ ID NO:23, with Aspergillus oryzae. alpha. -amylase signal peptide (NCBI SEQ ID NO: XM-001821384.2, sequence 1-63 bp)) obtained by whole gene synthesis from Biotechnology engineering (Shanghai) was inserted into the expression cassette of the Aspergillus oryzae enolase promoter (NCBI SEQ ID NO: D63941.1, 215-734 bp; containing 12 copies of the enhancer sequence (SEQ ID NO:24)) and the Aspergillus niger glucoamylase terminator (NCBI SEQ ID NO: AF214480.1, part of the terminator sequence), using SphI and HindIII enzyme sites, the entire expression cassette was inserted into the multiple cloning site of the cloning vector pSP72 as BglII and XhoI, and finally the Aspergillus oryzae-derived PyrG expression gene (NCBI SEQ ID NO: AB017705.1) was inserted into the vector as XhoI cleavage site, thereby constructing the vector pAOP-Eno.

mini-labeater from Biospec, usa;

DNA Polymerase was purchased from Takara, cat No.: R010A;

Mighty TA-cloning Reagent Set for

kits were purchased from Takara, cat No.: 6019;

in the present invention, the amount of the solvent used,

the Aspergillus niger fermentation medium comprises the following components:

2% glucose, 10% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% Tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements (KI 0.83g/L, H)₃BO₃ 6.2g/L，MnSO₄·4H₂O 22.3g/L，ZnSO₄·7H₂O 8.6g/L，Na₂MoO₄·2H₂O 0.25g/L，CuSO₄·5H₂O 0.025g/L，CoCl₂·6H₂O0.025 g/L is added according to the proportion of 1/1000; FeSO₄·7H₂O 2.78g/L，Na₂EDTA 3.73g/L added in 1/100 ratio).

The lysine buffer formula is as follows: 100mM Tris-HCl pH 8.0; 50mM Na. EDTA; 1% SDS.

BMMY-soy phospholipid medium:

component a, BMMY solid medium: 1% yeast extract, 2% peptone, 100mM citrate-sodium citrate buffer, pH 6.6, 1.34% YNB, 4X 10-5% biotin (add before plate inversion), 2% methanol (add before plate inversion), 2% agar in 250ml deionized water.

Component B, soybean lecithin substrate solution 250 ml: mixing with 4% soybean phospholipid, emulsifying with high speed homogenizer at 8000rpm for 3min, suspending for 1min, emulsifying for 3min, and preparing substrate solution.

After sterilization, the A and B components were mixed, 10ml of methanol was added and the mixture was poured on a plate.

glass beads were purchased from: biospec, usa.

Example 1: cloning of Aspergillus niger lipaseB gene

Aspergillus niger strains GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM3.488(AN04), GIM3.564(AN05) and CICC40273(AN08) were cultured in AN Aspergillus niger fermentation medium at 30 ℃ for 24 hours. Taking the fermentation culture, centrifuging at 4000rpm for 5min, and taking the thallus. Resuspending with 700ul lysi buffer, transferring to a cryopreservation tube, adding 300ul of glass beads, vibrating with AN upper mini bead scraper for 40s, centrifuging at 12000rpm for 10min, adding 600ul of supernatant into 275ul of 7M ammonium acetate, water bathing at 65 ℃ for 10min, ice bathing for 5min, adding AN equal volume of phenol chloroform isoamyl alcohol (volume ratio, phenol: chloroform: isoamyl alcohol: 24:25:1), vortexing thoroughly, centrifuging at 12000rpm for 5min, adding supernatant into AN equal volume of chloroform, vortexing thoroughly, centrifuging at 12000rpm for 5min, adding supernatant into 2 times volume of anhydrous ethanol, standing at 80 ℃ for 20min, centrifuging at 12000rpm for 10min to obtain a white DNA precipitate, washing with 70% ethanol for 2 times, adding sterile water after ethanol is sufficiently volatilized, dissolving DNA, respectively obtaining GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM3.488(AN04), GIM3.564, and CIM 05) genome (CICC) 08 (CICC) 24 CC 3673).

The primer LPL-1/LPL-2 is designed according to the gene sequence of lipaseB of Aspergillus niger CBS513.88 in NCBI, and the sequence is as follows:

LPL-1：5’-atgtttctccgcagggaatt-3’(SEQ ID NO:1)；

LPL-2：5’-ctacgagcattcactaatgt-3’(SEQ ID NO:2)。

using LPL-1/LPL-2 as a primer pair

DNA Polymerase cloning of LPL DNA from Aspergillus niger strains GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM3.488(AN04), GIM3.564(AN05), CICC40273(AN08) using Mighty TA-cloning Reagent Set for

The kit is subjected to TA cloning, then DH5a Escherichia coli is transformed, DNA sequencing is carried out by Biotechnology GmbH, and finally the LPL DNA sequences of GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM3.488(AN04), GIM3.564(AN05) and CICC40273(AN08) are obtained, and the results show that the sequences of GIM 3.24(AN02) LPL, GIM 3.150(AN03) LPL and GIM 3.452(AN07) LPL are completely identical and have the sequence shown in SEQ ID NO:3, the sequence of GIM3.564(AN05) LPL is shown in SEQ ID NO:4, and the sequence of CICC 73 (402 08) LPL is shown in SEQ ID NO: 5. The DNA sequence of LPL of GIM3.488(AN04) is identical to that of lipaseB of CBS513.88, and the sequence is shown in SEQ ID NO: 6.

The intron sequences of GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM3.564(AN05), and CICC40273(AN08) were found from the intron sequence of the DNA sequence of LipaseB of CBS513.88, and the removal and translation into the amino acid sequence were as follows:

the sequences of GIM 3.24(AN02) LPL, GIM 3.150(AN03) LPL and GIM 3.452(AN07) LPL are shown as SEQ ID NO:7, the sequence of GIM3.564(AN05) LPL is shown as SEQ ID NO:8, the sequence of CICC40273(AN08) LPL is shown as SEQ ID NO:9, and the amino acid sequence of GIM3.488(AN04) LPL, i.e., lipaseB of CBS513.88 is shown as SEQ ID NO: 10.

Example 2: phospholipase A1 activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-lipaseB

Primers LPL-11C, LPL-12C and LPL-2C were designed and synthesized:

LPL-11C：

CCCAAGCTTTTTCCAACTCAATTTACCTCTATCCACACTTCTCTTCCTTCCTCAATCCTCTATATACACAACTGGGGATCCTTCACCATGATGGTCGCGTGGTGGTCT(SEQ ID NO:11)；

LPL-12C:

ATGATGGTCGCGTGGTGGTCTCTATTTCTGTACGGCCTTCAGGTCGCGGCACCTGCTTTGGCTGCTCCCGCACCTGCTCCGAT(SEQ ID NO:12)；

LPL-2C:ACATgcatgcctaGGAGCACTCGGAG(SEQ ID NO:13)。

the genome of AN02, AN04, AN05 and AN08 is used AS a template, LPL-12C and LPL-2C are used AS primer pairs for PCR, then the PCR product is used AS a template, and LPL-11C and LPL-2C are used for PCR to obtain DNA sequences of AN02-LPL, AN04LPL (namely CBS-lipaseB), AN05-LPL and AN08-LPL (TPI 5 '-UTR (SEQ ID NO:14) sequences are added at the 5' end of the gene sequences) and the PCR product of the amino ase signal peptide (SEQ ID NO:15) sequence is subjected to enzyme digestion by HindIII and SphI and is connected into a pAOP-Eno vector through HindIII and SphI enzyme digestion sites to sequence correct cloning and transform AN Aspergillus niger AS3.795 strain, and the obtained strains are respectively named AN02L, AN04L, AN05-L and AN 08-L.

The transformation method comprises the following steps:

spores of Aspergillus niger strain cultured on PDA solid medium (purchased from BD company, product No. BD 213400) were eluted with a spore-washing solution, and the eluted spores were collectedAfter the seeds are vortexed and vibrated for 1min, uniform spore suspension is prepared by mircloth filtration; inoculation of 1X 10⁷Spore suspension to fermentation medium (2% glucose, 6% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% Tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, microelements (KI 0.83g/L, H)₃BO₃ 6.2g/L,MnSO₄.4H₂O 22.3g/L,ZnSO₄.7H₂O 8.6g/L,Na₂MoO₄.2H₂O 0.25g/L,CuSO₄.5H₂O 0.025g/L,CoCl₂.6H₂O0.025 g/L is added according to the proportion of 1/1000; FeSO₄.7H₂O 2.78g/L,Na₂EDTA 3.73g/L added according to the proportion of 1/100)) at 28 ℃ for 42-48h at 200 rpm; the grown hyphae were collected by filtration using sterile Mircloth (purchased from Milliproe); the collected mycelia were washed three times with sterilized osmotic pressure stabilizer (0.6mol/L MgSO4) and press-dried; transferring mycelium into 100mL triangular flask, resuspending in 10mL enzymolysis solution (1% cellulase (from sigma, cat # C1184-25KU), 1% lywallzyme (from sigma, cat # L1412-25G), 0.1% snailase (from Biotech, cat # A600870-0005)) per 0.8G mycelium, and dispersing; 30 deg.C, 60rpm, 60-90min (observed every 10min after 30 min); filtering the enzyme-hydrolyzed mycelium with Mircloth, washing with 0.6mol/L MgSO4, and collecting the filtrate; centrifuging at 4 deg.C for 10min at 1000g, and removing supernatant; 5mL of precooled 1.0mol/L sorbitol solution is used for resuspending the protoplast precipitate, 800g of the protoplast precipitate is centrifuged for 10min at 4 ℃, and the supernatant is discarded; the protoplasts were resuspended in 1mL of pre-cooled 1.0mol/L sorbitol and ice-cooled for use. Protoplasts were centrifuged and washed with pre-cooled STC (1.0M Sorbitol, 50mM CaCl)₂50mM Tris-HCl, pH 7.5) to 1X 10⁷Per mL; to 200. mu.L of protoplast suspension, 5. mu.g of DNA and 50. mu.L of PTC (40% PEG4000, 50mM CaCl) were added₂50mM Tris-HCl, pH 7.5), gently beating and mixing, and carrying out ice bath for 30 min; adding 0.2mL of PTC solution, mixing, adding 0.8mL of PTC solution, mixing, and keeping at room temperature for 30 min; the mixture was added to 5ml of regeneration medium (0.2% KH)₂PO₄，0.1％KCl，0.05％MgSO₄·7H₂O，0.005％FeSO₄·7H₂O, 1M sucrose,10mM acetamide, 20mM cesium chloride, 0.6% agar) and mixing; spreading on regeneration medium (with the same components as above, 1.5% agar), and culturing at 28 deg.C for more than 3 days.

Coating the positive clones growing on the regeneration medium on a 3% PDA solid medium (purchased from BD company, product number BD 213400), culturing at 28 deg.C for about 3 days with a large amount of spore formation, vortex-shaking the eluted spores for 1min, and filtering by mircloth to obtain uniform spore suspension; 1X 107 spore suspensions were inoculated into a fermentation medium (2% glucose, 10% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% Tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements), cultured at 28 ℃ and 200rpm for 8 days, and the enzyme activity was measured.

The enzyme activity determination method comprises the following steps:

9ml of substrate: 5ml of 1% soya lecithin, 1ml of 20% Triton X-100, 2.5ml of 0.1M citric acid-sodium citrate buffer.

10ul of diluted enzyme solution and 90ul of substrate react at 50 ℃ for 10min, the enzyme solution is inactivated at 95 ℃ for 5min, the enzyme solution is centrifuged at 7000rpm for 5min, 1ul of supernatant is taken, a reagent A80 ul in the NEFA kit is added, the reaction is carried out at 37 ℃ for 10min, and a reagent B160 ul is added for 10 min. Absorbance at 550nm was measured.

The phospholipase A1 specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are shown in FIG. 1.

The results in FIG. 1 show that: the phospholipase A1 specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are 20311U/mg,19677U/mg,17765U/mg and 19135U/mg.

Through detection, the DNA sequence of AN02-LPL is SEQ ID NO. 7, the DNA sequence of AN05-LPL is SEQ ID NO. 8, the DNA sequence of AN08-LPL is SEQ ID NO. 9, and the DNA sequence of CBS-Lipase B is SEQ ID NO. 10; AN02-LPL amino acid sequence SEQ ID NO. 3, AN05-LPL amino acid sequence SEQ ID NO. 4, AN08-LPL amino acid sequence SEQ ID NO. 5, CBS-Lipase B amino acid sequence SEQ ID NO. 6.

Example 3: lysophospholipase activity of AN02-LPL, AN05-LPL, AN08-LPL and CBS-lipaseB

Taking shake flask fermentation culture liquids of AN02-LPL, AN04LPL (CBS-lipaseB), AN05-LPL and AN08-LPL, and taking 1-palmitoyl glycerophosphorylcholine (lysophospholipid) as a substrate to measure lysophospholipase activity, wherein the enzyme activity measuring method is as follows:

9ml of substrate: 5ml of 1% lysophospholipid, 1ml of 20% Triton X-100, 2.5ml of 0.1M citric acid-sodium citrate buffer.

The lysophospholipase specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are shown in FIG. 2.

Figure 2 results show that: the specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are 22547U/mg,22134U/mg,21413U/mg and 22263U/mg respectively.

Example 4: lipase activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB

Taking shake flask fermentation culture solution of AN02-LPL, AN05-LPL and AN08-LPL, and determining lipase activity by using olive oil as a substrate, wherein the lipase activity is determined by AN acid-base titration method as follows:

measuring 150ml of 4% PVA solution, adding 50ml of olive oil, emulsifying for 3min at 8000rpm of a high-speed homogenizer, suspending for 1min, and emulsifying for 3min to obtain substrate solution (the solution is ready for use).

Enzyme activity definition and calculation formula

The lipase activity unit is defined as: the amount of enzyme catalyzing the release of 1. mu. mol of fatty acid from the substrate per minute is 1 lipase activity unit (U).

The enzyme activity calculation formula is as follows:

in the formula: v: the volume (ml) of NaOH solution consumed for titration of the sample liquid

V₀: titration of NaOH solution volume (ml) consumed for blank

t: reaction time (min)

n: volume of enzyme solution (ml)

M: concentration of NaOH solution for titration (mmol/L)

The lipase specific activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are shown in FIG. 3.

According to the results shown in FIG. 3, the lipase specific activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-Lipase B were very low.

According to the results shown in FIGS. 1 to 3, lipase specific activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB were 200-fold different from those of lysophospholipase and phospholipase A1. The lipases AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB are obviously not practical.

Example 5: degumming tests of AN02-LPL, AN05-LPL and AN08-LPL

Uniformly shaking 60g of crude oil, stirring and heating the crude oil, and stabilizing the temperature at 55 ℃; adding 50% of CA.H₂0500 ppm, shearing at 20000rpm for 1.5 min; stirring and reacting for 1h at 55 ℃; mixing AN02-LPL, AN05-LPL, AN08-LPL and CBS-Lipase B with water, adding, and shearing for 2000001.5 min; heating to 55 ℃ and timing, after the reaction is finished for 4 hours, heating to 85 ℃ to inactivate enzyme, keeping for more than 8min at least, centrifuging to obtain degummed oil, sampling and sending to an analysis test center for phosphorus content test.

The addition amount of each component is as follows:

60g of crude oil; 3% H₂O1.8 ml; 50ppm of 1% AN02-LPL, AN05-LPL, AN08-LPL, or CBS-LipaseB plus 0.3 ml; 500ppm 50% CA.H2O 0.03ml 5% CA.H2O 0.3 ml; H2O1.2ml

The results of degumming tests for AN02-LPL, AN05-LPL, AN08-LPL, CBS-LipaseB are shown in FIG. 4. According to the results of FIG. 4, AN02-LPL, AN05-LPL, AN08-LPL and CBS-LipaseB can reduce the phosphorus content of crude oil to below 10ppm, realize enzymatic degumming and meet the standard of next physical refining.

Example 5: AN02-LPL expression in Pichia pastoris and random mutation

Selecting mature peptide of AN02-LPL, as shown in SEQ ID NO:16, sending to the engineering bioengineering limited company to synthesize gene sequence (optimized by the engineering bioengineering limited company according to Pichia pastoris codon preference), cloning to pEThe pic-AN02 plasmid was obtained from the T-pAOm-7-9PLC (Shanghai Biotechnology) vector. After linearization with BglII, 500ng of linearized DNA was taken and the vector was transformed into competent cells of Pichia pastoris GS115 strain (purchased from invitrogen) by electrotransformation. Inoculating the transformant to MGYS plate (1.34% yeast nitrogen source alkali (YNB) containing ammonium sulfate without amino acids, 1% glycerol, 1M sorbitol, 4 × 10^-5% D-biotin, 2% agar) and cultured at 30 ℃ for 3 days, a Pichia transformant of pic-AN 02. And (3) selecting a single clone on the plate, putting the single clone on a BMM-soybean lecithin screening plate, selecting a clone with a large white precipitation circle, and respectively naming the single clone as pic-AN 02-LPL.

Error-prone PCR was performed on PLPL-1/PLPL-2 using pic-AN02-LPL as a template and TaKaRa Taq enzyme and primers (0.3 mM MnCl2 was additionally added during PCR) to obtain a pool of mutant amplicon fragments of about 1000bp in size. The resulting fragment was cloned into the pic-AN02 plasmid by cleavage with Sac-II and EcoRI enzymes and the resulting vector was transformed into E.coli DH5 α strain, in which the PLPL-1/PLPL-2 sequences are as follows:

PLPL-1：TCCCCGCGGCGAAACGATGAGATTTCCTTC(SEQ ID NO:17)，

PLPL-2：CCGGAATTCTTAAGAACACTCAGAAATG(SEQ ID NO:18)。

the plate containing pic-AN02 mutant was washed with 2ml of sterile water, and the plasmid was extracted and linearized with SalI to recover AN about 8.5kb fragment. 500ng of the vector is taken, and the vector is transformed into competent cells of the Pichia pastoris GS115 strain by an electrical transformation method. Inoculating the transformed product on a BMM-soybean phospholipid screening plate, and culturing at 30 ℃ for 3 days to obtain a Pichia pastoris mutant library of pic-AN 02-LPL.

46 mutant clones with white circles on BMM-soy phospholipid screening medium plates and 2 wild-type clones of pic-AN02-LPL were picked into 2 24-well deep-well plates. The deep well plate was filled with 2ml of BMGY medium. After 24h of culture, centrifugation is carried out, the liquid culture medium is removed, and 2ml of BMMY culture medium is added for induction culture. After 72h induction culture. Centrifuging and taking fermentation supernatant. Diluting the supernatant with 0.1M citric acid buffer solution (pH4.0) for 10 times, and maintaining in water bath at 60 deg.C for 30 min; then, the enzyme activity was measured by taking 4ul of the resulting solution after diluting the solution 20 times (total dilution 200 times). After the sample is directly diluted by 200 times at 4 ℃, 4ul of the measured enzyme activity is taken as a reference and recorded as 100 percent, and the residual enzyme activity after heat treatment is calculated. The measurement method is as follows:

9.6ml substrate: 5ml of 1% lysophospholipid, 1ml of 20% Triton X-100, 2.5ml of 0.1M citric acid-sodium citrate buffer, and water to 9.6 ml.

Reacting 4ul diluted enzyme solution and 96ul substrate at 50 ℃ for 10min, inactivating at 95 ℃ for 5min, centrifuging at 7000rpm for 5min, adding 4ul supernatant into 80ul reagent A in the NEFA kit, reacting at 37 ℃ for 10min, and adding 160ul reagent B for 10 min. Absorbance at 550nm was measured.

The results of the residual enzyme activities of the 48 samples after heat treatment are shown in Table 1, wherein 6C and 6D are wild type pic-AN02-LPL, and the average residual enzyme activity of the 6C and the 6D is 27.6%. The residual enzyme activity of the mutant 1C is 66.3 percent, which is 2.4 times of that of the wild type, and is improved by 140 percent.

TABLE 1

1

2

3

4

5

6

36.6％

31.3％

27.8％

17.5％

34.9％

30.0％

A

35.4％

31.1％

30.1％

17.7％

2.9％

22.6％

B

66.3％

28.0％

30.2％

14.3％

17.1％

26.8％

C

30.1％

30.6％

33.9％

29.4％

22.7％

28.4％

D

9.9％

23.9％

8.5％

18.4％

2.4％

8.2％

E

12.3％

0.0％

26.5％

27.1％

26.0％

36.5％

F

6.4％

7.3％

37.2％

21.3％

33.3％

38.0％

G

9.1％

0.0％

41.4％

11.9％

28.1％

39.5％

H

The 1C strain was inoculated into 3ml of YPD liquid medium and cultured overnight at 30 ℃ to extract genomic DNA. Using genomic DNA of pic-AN0m1 strain as a template

The DNA polymerase and primer pair AOX-5/3 '-AOX 1 (AOX-5: GACTGGTTCCAATTGACAACG (SEQ ID NO:21), 3' -AOX1: GCAAATGGCATTCTGACATCC (SEQ ID NO:22)) were subjected to PCR amplification to obtain the DNA sequence of the AN02 mutant in pic-AN02m1 strain. The obtained sequence was sent to Shanghai Biotech engineering Co., Ltd using primer pair AOX-5/3' -AOX1 was sequenced. The result of amino acid sequencing of the AN02 mutant of the 1C strain is shown as SEQ ID NO. 19, the mutation site is T255I, and the nucleotide sequence is shown as SEQ ID NO. 20.

The sequence of the invention has the activity of both phospholipase and lysophospholipase, and has wide application in industry.

As phospholipase enzymes, they can be used in vegetable oil degumming processes in the first place. In the enzymatic degumming process, phospholipids in vegetable oil (such as soybean oil, rapeseed oil, linseed oil, sunflower seed oil and the like) are converted into lysophospholipids which can enter a water phase more easily after being acted by phospholipase so as to be removed, and the sequence has good phospholipase activity under the condition of pH4.0, so that alkali is not added in the enzymatic degumming process to adjust the pH value, and the generation of soap is reduced. Another industrial use as a phospholipase is in baking applications, which can improve dough and bread properties, such as dough stickiness and extensibility, bread texture and color. As phospholipases also lysophospholipids with special emulsifying properties can be used.

Can be used as lysophospholipase for improving filterability of hydrolyzed wheat starch syrup. Lysophospholipids have emulsifying properties, which often lead to difficult filtration of hydrolyzed starch syrups, especially wheat-derived syrups. Lysophospholipase is capable of decomposing lysophospholipids to form free fatty acids and water-soluble glycerophosphates. The removal of lysophospholipids improves the filterability and clarity of the hydrolyzed starch syrup. Lysophospholipase also increases the filtration rate of corn starch syrup.

The product has activities of phospholipase and lysophospholipase, and can be used for preparing L-alpha-glycerophosphocholine. Under the catalysis of phospholipase activity, when a substrate is lecithin, products are L-beta-lysophosphatidylcholine and fatty acid, and an acyl group at a sn-2 position in the L-beta-lysophosphatidylcholine is transferred to a sn-1 position under a certain reaction system and catalysis condition and then is hydrolyzed by the enzyme to generate L-alpha-glycerophosphorylcholine and fatty acid. The L-alpha-glycerophosphorylcholine has wide application in the fields of medicines and health-care products.

Finally, it should be understood that while the various aspects of the present specification describe specific embodiments, those skilled in the art will readily appreciate that the disclosed embodiments are merely illustrative of the principles of the subject matter disclosed herein. Accordingly, it is to be understood that the disclosed subject matter is not limited to the specific combinations, methods, and/or formulations, etc., described herein, unless otherwise specified. Moreover, those of ordinary skill in the art will recognize that certain changes, modifications, permutations, variations, additions, subtractions and sub-combinations may be made in accordance with the teachings herein without departing from the spirit of the present specification. It is therefore intended that the following appended claims be interpreted as including all such alterations, modifications, permutations, variations, additions, subtractions and sub-combinations as fall within the true spirit and scope thereof.

Sequence listing

<110> Fengyi (Shanghai) Biotechnology research and development center, Inc

<120> proteins having lysophospholipase and phospholipase activities

<130> 123

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 1

atgtttctcc gcagggaatt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 2

ctacgagcat tcactaatgt 20

<210> 3

<211> 1072

<212> DNA

<213> Aspergillus niger ()

<400> 3

atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60

cccgcacctg ctccgatgca gcgtagaggt aagacacact taccaatttg cagaacaccc 120

gctaacctac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180

cagtgcagca gcttactgct cctcgaacat cgagtccacc ggcacgactc tgacctgcga 240

cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300

gtaagccaat ccaaccccaa catcttcccc cacttggcat ccagctcaca cccccatagc 360

accagcagct acggcgaccc gactgggttc atcgccgttg acccaacgaa cgagttaatt 420

gttctgtctt tccggggtag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480

ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540

tgggaagtca tcgcggacac catcactagc aaggtggagg ctgctgtctc cagctatccg 600

gactacaccc tcgtgttcac tggacacagc tacggcgctg cattggcggc tgtcgcggcc 660

accgtgctcc gcaacgccgg atacactctt gacctggtaa gttcctactc ttttatcctt 720

gtaacgttcc cccatcattc ggatggtcta ctaacacaat caacagtaca acttcggcca 780

gccccgtatt ggcaacctcg ccttagccga ctatatcacc ggccaaaata tgggcagcaa 840

ctaccgcgtc acgcacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900

ccaccacttc agcccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960

ggacgtgacc gaggtcgtgg gggtggattc gacggctggg aatgacggca cgctgcttga 1020

cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072

<210> 4

<211> 1072

<212> DNA

<213> Aspergillus niger ()

<400> 4

atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60

cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaacaccc 120

gctaacatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180

cagtgcagca gcttactgct cctccaacat cgagtccacc ggcacgactc tgacctgcga 240

cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300

gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360

agcagcagct acggcgaccc gacggggttc atcgccgttg acccgacgaa cgagttgatc 420

gttctgtctt tccggggtag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480

ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctatgaggcc 540

tgggaagtca ttgccgacac catcacatcc aaggtggagg ccgctgtctc cagctatccg 600

gactacaccc tcgtgttcac cggacacagc tacggcgctg cattggcggc tgtcgcggcc 660

accgtgctcc gcaacgccgg atacactctt gacctggtag gcccctaccc ttgtattttt 720

gctatgttcc tccatcattt ggatggtcta ctaacacaat cgacagtaca acttcggcca 780

gccccgtatc ggcaacctcg ccttagccga ctacatcacc gaccaaaaca tgggcagcaa 840

ctaccgcgtc acgcacaccg acgacatcgt gcctaagctg cctccggagc tgctgggcta 900

ccaccacttc agtccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960

ggacgtgacc gaggttgtgg gggtggattc gacggatggg aatgacggca cgctgcttga 1020

cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072

<210> 5

<211> 1072

<212> DNA

<213> Aspergillus niger ()

<400> 5

atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60

cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaacaccc 120

gctaacatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180

cagtgcagca gcttactgct cctccaacat tgagtccacc ggcacgactc tgacctgcga 240

cgtaggcaat tgccccctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300

gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360

agcagcagct acggcgatcc gacggggttc atcgccgttg acccgacgaa cgagttaatc 420

gttctgtctt tccggggcag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480

ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540

tgggaagtca ttgccgacac tatcacatcc aaggtggagg ccgccgtctc cagctatccg 600

gactacaccc tcgtgttcac cggacacagc tacggtgctg cattggcggc tgtcgcggcc 660

accgtgctcc gcaacgccgg atacactctt gacctggtag gcccctaccc ttgtattctt 720

gttatgttct tccatccttc ggatagtcta ctaacacaat cgacagtaca acttcggcca 780

gccccgtatc ggcaaccttg ctttagccga ctacatcacc gaccaaaaca tgggcggcaa 840

ctaccgtgtc acacacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900

ccaccacttc agtccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960

ggacgtgacc gaggttgtgg gggtggattc gacggatggg aatgacggca cgctgcttga 1020

cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072

<210> 6

<211> 1072

<212> DNA

<213> Aspergillus niger ()

<400> 6

atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60

cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaaattcc 120

gctaatatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180

cagtgcagca gcttactgct cctccaacat cgagtccacc ggcacgactc tgacctgcga 240

cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300

gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360

agcagcagct acggcgaccc gacggggttc atcgccgttg acccgacgaa cgagttaatc 420

gttctgtctt tccggggcag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480

ctcacatccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540

tgggaagtca ttgccgacac catcacatcc aaggtggagg ccgccgtctc cagctatccg 600

gactacaccc tcgtgttcac cggacacagc tacggcgctg cattggcggc tgtcgcggcc 660

accgtgctcc gcaacgccgg atacactctt gacctggtaa gttcctactc ttttatcctt 720

gtaatgttcc tccgtcattc ggatagtcta ctaaatcaat cgacagtaca acttcggcca 780

gccccgtatt ggcaacctcg ccttagccga ctacatcacc gaccaaaaca tgggcagcaa 840

ctaccgcgtc acgcacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900

ccaccacttc agtccggagt actggatcac cagcggcaat gatgtgacgg tgacaacgtc 960

ggacgtcacc gaggtcgtgg gggtggattc gacggctggg aatgacggca cgctgcttga 1020

cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072

<210> 7

<211> 298

<212> PRT

<213> Aspergillus niger ()

<400> 7

Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu

1 5 10 15

Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser

20 25 30

Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala

35 40 45

Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys

50 55 60

Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile

65 70 75 80

Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile

85 90 95

Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser

100 105 110

Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser

115 120 125

Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu

130 135 140

Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala

145 150 155 160

Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr

165 170 175

Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly

180 185 190

Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu

195 200 205

Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser Asn Tyr Arg

210 215 220

Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu

225 230 235 240

Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp

245 250 255

Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser

260 265 270

Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg

275 280 285

Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

290 295

<210> 8

<211> 298

<212> PRT

<213> Aspergillus niger ()

<400> 8

Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu

1 5 10 15

Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser

20 25 30

Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala

35 40 45

Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys

50 55 60

Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile

65 70 75 80

Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile

85 90 95

Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser

100 105 110

Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser

115 120 125

Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu

130 135 140

Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala

145 150 155 160

Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr

165 170 175

Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly

180 185 190

Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu

195 200 205

Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Ser Asn Tyr Arg

210 215 220

Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu

225 230 235 240

Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp

245 250 255

Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser

260 265 270

Thr Asp Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg

275 280 285

Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

290 295

<210> 9

<211> 298

<212> PRT

<213> Aspergillus niger ()

<400> 9

Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu

1 5 10 15

Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser

20 25 30

Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala

35 40 45

Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys

50 55 60

Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile

65 70 75 80

Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile

85 90 95

Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser

100 105 110

Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser

115 120 125

Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu

130 135 140

Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala

145 150 155 160

Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr

165 170 175

Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly

180 185 190

Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu

195 200 205

Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Gly Asn Tyr Arg

210 215 220

Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu

225 230 235 240

Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp

245 250 255

Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser

260 265 270

Thr Asp Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg

275 280 285

Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

290 295

<210> 10

<211> 298

<212> PRT

<213> Aspergillus niger ()

<400> 10

Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu

1 5 10 15

Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser

20 25 30

Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala

35 40 45

Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys

50 55 60

Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile

65 70 75 80

Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile

85 90 95

Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser

100 105 110

Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser

115 120 125

Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu

130 135 140

Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala

145 150 155 160

Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr

165 170 175

Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly

180 185 190

Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu

195 200 205

Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Ser Asn Tyr Arg

210 215 220

Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu

225 230 235 240

Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp

245 250 255

Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser

260 265 270

Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg

275 280 285

Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

290 295

<210> 11

<211> 108

<212> DNA

<213> Artificial sequence ()

<400> 11

cccaagcttt ttccaactca atttacctct atccacactt ctcttccttc ctcaatcctc 60

tatatacaca actggggatc cttcaccatg atggtcgcgt ggtggtct 108

<210> 12

<211> 83

<212> DNA

<213> Artificial sequence ()

<400> 12

atgatggtcg cgtggtggtc tctatttctg tacggccttc aggtcgcggc acctgctttg 60

gctgctcccg cacctgctcc gat 83

<210> 13

<211> 26

<212> DNA

<213> Artificial sequence ()

<400> 13

acatgcatgc ctaggagcac tcggag 26

<210> 14

<211> 78

<212> DNA

<213> Artificial sequence ()

<400> 14

tttccaactc aatttacctc tatccacact tctcttcctt cctcaatcct ctatatacac 60

aactggggat ccttcacc 78

<210> 15

<211> 63

<212> DNA

<213> Artificial sequence ()

<400> 15

atgatggtcg cgtggtggtc tctatttctg tacggccttc aggtcgcggc acctgctttg 60

gct 63

<210> 16

<211> 269

<212> PRT

<213> Aspergillus niger ()

<400> 16

Asp Ile Ser Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr

1 5 10 15

Ser Ala Ala Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr

20 25 30

Leu Thr Cys Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala

35 40 45

Thr Thr Ile Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr

50 55 60

Gly Phe Ile Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe

65 70 75 80

Arg Gly Ser Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly

85 90 95

Leu Thr Ser Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly

100 105 110

Phe Tyr Glu Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val

115 120 125

Glu Ala Ala Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly

130 135 140

His Ser Tyr Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg

145 150 155 160

Asn Ala Gly Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile

165 170 175

Gly Asn Leu Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser

180 185 190

Asn Tyr Arg Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro

195 200 205

Glu Leu Leu Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser

210 215 220

Gly Asn Asp Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly

225 230 235 240

Val Asp Ser Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr

245 250 255

Ala His Arg Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

260 265

<210> 17

<211> 30

<212> DNA

<213> Artificial sequence ()

<400> 17

tccccgcggc gaaacgatga gatttccttc 30

<210> 18

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 18

ccggaattct taagaacact cagaaatg 28

<210> 19

<211> 269

<212> PRT

<213> Aspergillus niger ()

<400> 19

Asp Ile Ser Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr

1 5 10 15

Ser Ala Ala Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr

20 25 30

Leu Thr Cys Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala

35 40 45

Thr Thr Ile Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr

50 55 60

Gly Phe Ile Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe

65 70 75 80

Arg Gly Ser Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly

85 90 95

Leu Thr Ser Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly

100 105 110

Phe Tyr Glu Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val

115 120 125

Glu Ala Ala Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly

130 135 140

His Ser Tyr Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg

145 150 155 160

Asn Ala Gly Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile

165 170 175

Gly Asn Leu Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser

180 185 190

Asn Tyr Arg Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro

195 200 205

Glu Leu Leu Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser

210 215 220

Gly Asn Asp Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly

225 230 235 240

Val Asp Ser Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Ile Thr

245 250 255

Ala His Arg Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser

260 265

<210> 20

<211> 810

<212> DNA

<213> Aspergillus niger ()

<400> 20

gatatttctt ctaccgtttt ggataacatt gatttgttcg ctcaatactc cgctgctgct 60

tactgttctt ctaacattga gtctactggt accactttga cttgtgacgt tggtaactgt 120

ccattggttg aggctgctgg tgctaccact attgatgagt tcgatgatac ttcctcttac 180

ggtgatccta ctggtttcat tgctgttgac cctactaacg agttgattgt tttgtctttt 240

agaggttctt ctgacttgtc taactggatt gctgatttgg atttcggttt gacttctgtt 300

tcttctattt gtgacggttg tgaaatgcac aagggtttct atgaagcctg ggaagttatt 360

gctgatacta ttacttctaa ggttgaagct gctgtttctt cttacccaga ttacactttg 420

gttttcaccg gtcactctta cggtgctgcc ttggctgctg ttgctgctac tgttttgaga 480

aacgctggtt acactttgga tttgtacaac tttggtcaac caagaattgg taacttggct 540

ttggctgact acattactgg tcaaaacatg ggttctaact acagagttac tcacactgat 600

gatattgttc ctaagttgcc accagagttg ttgggttacc accacttctc cccagagtac 660

tggattactt ctggtaacga tgttactgtt accacttctg atgttactga ggttgttggt 720

gttgattcca ccgctggtaa cgatggtact ttgttggact ctattactgc tcacagatgg 780

tacaccattt acatttctga gtgttcttaa 810

<210> 21

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 21

gactggttcc aattgacaac g 21

<210> 22

<211> 21

<212> DNA

<213> Artificial sequence ()

<400> 22

gcaaatggca ttctgacatc c 21

<210> 23

<211> 1020

<212> DNA

<213> Artificial sequence ()

<400> 23

gtgccaatca agagacaatc aaacagcacg gtggatagtc tgccacccct catcccctct 60

cgaacctcgg caccttcatc atcaccaagc acaaccgacc ctgaagctcc agccatgagt 120

cgcaatggac cgctgccctc ggatgtagag actaaatatg gcatggcttt gaatgctact 180

tcctatccgg attctgtggt ccaagcaatg agcattgatg gtggtatccg cgctgcgacc 240

tcgcaagaaa tcaatgaatt gacttattac actacactat ctgccaactc gtactgccgc 300

actgtcattc ctggagctac ctgggactgt atccactgtg atgcaacgga ggatctcaag 360

attatcaaga cttggagcac gctcatctat gatacaaatg caatggttgc acgtggtgac 420

agcgaaaaaa ctatctatat cgttttccga ggttcgagct ctatccgcaa ctggattgct 480

gatctcacct ttgtgccagt ttcatatcct ccggtcagtg gtacaaaagt acacaaggga 540

ttcctggaca gttacgggga agttcaaaac gagcttgttg ctactgttct tgatcaattc 600

aagcaatatc caagctacaa ggttgctgtt acaggtcact cactcggtgg tgctactgcg 660

ttgctttgcg ccctgggtct ctatcaacga gaagaaggac tctcatccag caacttgttc 720

ctttacactc aaggtcaacc acgggtaggc gaccctgcct ttgccaacta cgttgttagc 780

accggcattc cttacaggcg cacggtcaat gaacgagata tcgttcctca tcttccacct 840

gctgcttttg gttttctcca cgctggcgag gagtattgga ttactgacaa tagcccagag 900

actgttcagg tctgcacaag cgatctggaa acctctgatt gctctaacag cattgttccc 960

ttcacaagtg ttcttgacca tctctcgtac tttggtatca acacaggcct ctgtacttaa 1020

<210> 24

<211> 43

<212> DNA

<213> Artificial sequence ()

<400> 24

gtcgtgtcgg gcatttatcg ggggatggac caatcagcgt agg 43

Claims

1. A protein having lysophospholipase and/or phospholipase activity, wherein the protein has the amino acid sequence of SEQ ID NO: 3.4, 5, 6 or 19, or a sequence substantially identical to SEQ ID NO: 3.4, 5, 6 or 19, and the protein is derived from aspergillus niger.

2. The protein of claim 1, wherein said protein has an amino acid sequence identical to SEQ ID NO: 3.4, 5, 6 or 19, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

3. A polynucleotide sequence selected from the group consisting of: (1) a polynucleotide encoding the polypeptide of claim 1 or 2; (2) a polynucleotide complementary to the polynucleotide sequence of (1); and (3) a fragment of the polynucleotide of (1) or (2) which is 10 to 40 bases in length; preferably, the sequence of the polynucleotide is as set forth in SEQ ID NO: 7. 8, 9, 10 or 20.

4. A polynucleotide construct comprising the polynucleotide sequence of claim 3; preferably, the polynucleotide construct is an expression vector or a cloning vector.

5. A host cell, wherein the host cell: (1) expressing the polypeptide of claim 1 or 2; and/or (2) containing a polynucleotide sequence according to claim 3 or a polynucleotide construct according to claim 4, said host cell preferably being selected from a prokaryotic or eukaryotic microorganism, said host cell preferably being selected from a group comprising Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus sp.

6. A composition comprising the protein of claim 1 or 2, preferably an enzyme composition, preferably further comprising one or more of phospholipase a1, phospholipase a2, phospholipase B, phospholipase C, amylase, lipase, protease and/or cellulase.

7. The composition of claim 6, wherein the composition is a fermentation expression of the host cell of claim 5, e.g., a fermentation broth, a fermentation concentrate, a fermentation supernatant, an enzyme preparation produced from a fermentation broth.

8. A composition comprising the protein of claim 1 or 2 and optionally an adjuvant, preferably an adsorbent material selected from the group consisting of activated carbon, alumina, diatomaceous earth, porous ceramics, porous glass.

9. A method for producing a protein according to claim 1 or 2, comprising the step of fermenting a host cell according to claim 5.

10. Use of the polypeptide of claim 1 or 2, the polynucleotide sequence of claim 3, the nucleic acid construct of claim 4, the host cell of claim 5, or the composition of any one of claims 6-8 in vegetable oil degumming, bread dough modification, starch hydrolysate treatment, lysophospholipase preparation, and/or L- α -glycerophosphocholine.