CN114617980A

CN114617980A - Ionizable lipid nanoparticles and uses thereof

Info

Publication number: CN114617980A
Application number: CN202210232631.0A
Authority: CN
Inventors: 孟舒; 张廷虹; 王耀锋; 刘巧媛; 方建文
Original assignee: Bioisland Laboratory; Guangzhou National Laboratory
Current assignee: Bioisland Laboratory; Guangzhou National Laboratory
Priority date: 2022-03-09
Filing date: 2022-03-09
Publication date: 2022-06-14

Abstract

The invention provides an ionizable lipid nanoparticle and application thereof. The ionizable lipid nanoparticle comprises Dlin-MC3-DMA, cholesterol, helper lipid comprising DOPE or DSPC, and DMG-PEG 2000. The ionizable lipid nanoparticles of the invention have high nucleic acid (mRNA, siRNA, rRNA, tRNA, snRNA, miRNA, plasmids, and combinations thereof) delivery capability and can be used to deliver mRNA expressed proteins for disease treatment, such as delivering vegfr mRNA to promote angiogenesis, for ischemic disease treatment (such as skin injury repair); or for delivering siRNA to modulate gene expression, such as to deliver Lmo2siRNA, inhibiting angiogenesis for the treatment of proliferative vascular disease.

Description

Ionizable lipid nanoparticles and uses thereof

Technical Field

The invention relates to the field of medicines, and in particular relates to ionizable lipid nanoparticles, a pharmaceutical composition and application thereof in medicine preparation and disease treatment.

Background

mRNA therapy has many advantages over other treatment modalities: firstly, safety, since mRNA can be translated directly into the cytoplasm without entering the nucleus, it does not pose the risk of chromosomal insertions; secondly, the efficiency is high, the mRNA synthesis is simple and convenient, the target protein is expressed by directly utilizing living cells, and the target protein can be modified after translation, so the natural conformation and the characteristic of the target protein are more similar.

However, mRNA has a relatively large molecular weight and is negatively charged, and thus it is difficult to pass through the anionic lipid bilayer of the cell membrane. In addition, naked mRNA is susceptible to degradation by rnases or phagocytosis by immune cells. Therefore, the use of mRNA delivery vectors is desirable. The existing mRNA carriers include lipids, lipid materials, cationic polymers, protamine, and the like. Ionizable Lipid Nanoparticles (LNPs) are well-established relatively advanced mRNA carriers. LNP mainly completes the construction of particles through ionizable phospholipid materials and other auxiliary phospholipids, and is combined with mRNA with negative electricity in an acid buffer solution, so that the mRNA molecules are efficiently encapsulated. LNP is nearly electrically neutral in physiological states, but turns strongly electropositive under the acidic conditions of endocytosomes, and thus can rapidly release mRNA into the cytoplasm through the proton sponge effect. Meanwhile, the LNP also has the advantages of simple preparation, large-scale production, high biocompatibility and the like. LNPs typically comprise four components: ionizable lipids, helper phospholipids, cholesterol, and pegylated lipids, which together encapsulate and protect mRNA.

Ionizable lipids can interact with negatively charged nucleic acids, thereby encapsulating the nucleic acid molecule. Currently used ionizable lipids in clinical applications are DLin-MC3-DMA (RNAi drug Onpattro by Alylam), SM-102 (New crown vaccine mRNA-1273 by Moderna) and ALC-0315 (Peurent vaccine BNT162b 2). Helper lipids accelerate mRNA release by facilitating fusion that helps promote phospholipids to endocytic lysosomal membrane. Currently used helper lipids include saturated lipids (e.g., DSPC) and unsaturated lipids (e.g., DOPE), suitable for delivery of short-chain RNAs (e.g., siRNA) and long-chain RNAs (e.g., mRNA), respectively. Cholesterol is a naturally occurring lipid that enhances nanoparticle stability by filling the voids between lipids and mediates cellular endocytosis of LNP by low density lipoproteins. The pegylated lipid covers the positive particles to form a hydrophilic surface, so that the strong positive electricity on the particle surface can be covered, the adsorption of non-specific proteins is reduced, and the particles are prevented from being eliminated by immune cells, so that the stability of the particles is improved, and the in vivo half-life of the particles is prolonged. Commonly used pegylated lipids include 2- [ (polyethylene glycol) -2000] -N, N-tetracosyl acetamide (ALC-0159) and dimyristoyl glycerol-polyethylene glycol 2000(DMG-PEG 2000).

Currently the helper lipid chosen for the marketed LNP is DSPC, which is well suited for the delivery of short-chain RNA. Whereas long stretches of RNA, such as mRNA, are more difficult to dissociate from. And the current efficiency of LNP delivery of RNA is to be improved.

Disclosure of Invention

The invention aims to provide ionizable lipid nanoparticles with high-efficiency nucleic acid delivery capacity, and the ionizable lipid nanoparticles are used for delivering VEGF mRNA to promote angiogenesis and accelerate skin injury repair, or delivering Lmo2siRNA to knock down Lmo2, inhibit angiogenesis and treat proliferative vascular diseases: such as inhibiting tumor growth or treating diabetic retinopathy.

In a first aspect, the present invention provides an ionizable lipid nanoparticle comprising Dlin-MC3-DMA, cholesterol, a helper lipid comprising DOPE or DSPC, and DMG-PEG 2000.

Dlin-MC3-DMA is referred to in the Chinese name of 4- (N, N-dimethylamino) butanoic acid (dilinoleyl) methyl ester), DOPE is referred to in the Chinese name of dioleoylphosphatidylethanolamine, and DSPC is referred to in the Chinese name of distearoylphosphatidylcholine. DMG-PEG2000 is referred to herein as dimyristoyl glycerol-polyethylene glycol 2000.

In some embodiments, the helper lipid comprises DOPE. In some embodiments, the helper lipid is DOPE.

In some embodiments, the helper lipid comprises DSPC. In some embodiments, the helper lipid is DSPC.

In some embodiments, the molar ratio of dilin-MC 3-DMA is 20% to 65%, preferably 30% to 50%, more preferably 30% to 40%, and even more preferably 33% to 37%, based on the total moles of dilin-MC 3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

In some embodiments, the molar proportion of helper lipid is 10% to 40%, preferably 15% to 30%, more preferably 15% to 18%, based on the total moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

In some embodiments, the molar ratio of cholesterol is 20% to 50%, preferably 25% to 50%, more preferably 44.5% to 48.5%, based on the total moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

In some embodiments, the mole fraction of DMG-PEG2000 is from 1% to 10%, preferably from 1% to 5%, more preferably from 1.5% to 3.0%, based on the total moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

In some embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (20-65): (20-50): (10-40): (1-10).

In some preferred embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (30-50): (25-50): (15-30): (1-5).

In some preferred embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (30-45): (25-50): (15-30): (1-5).

In some preferred embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (30-40): (40-50): (15-18): (1-5).

. In some preferred embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (33-37): (44.5-48.5): (15-17): (1.5-3.0).

In some preferred embodiments, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (34-36): (46-47): (15-16.5): (2.0-3.0).

In a preferred embodiment, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid (preferably DOPE) and DMG-PEG2000 is 35: 46.5: 16: 2.5. in another preferred embodiment, the molar ratio of dilin-MC 3-DMA, cholesterol, helper lipid (preferably DOPE) and DMG-PEG2000 is 40: 30: 25: 5.

in some embodiments, the ionizable lipid nanoparticle has an average particle size of 80 nm to 100nm, preferably 95 nm to 100 nm.

In some embodiments, the surface potential of the ionizable lipid nanoparticle is between-10 mv and-15 mv.

In a second aspect, the invention also provides a pharmaceutical composition comprising an ionizable lipid nanoparticle according to the first aspect of the invention and a nucleic acid.

In some embodiments, the nucleic acid comprises a nucleic acid selected from the group consisting of mRNA, siRNA, rRNA, tRNA, snRNA, miRNA, plasmid, and combinations thereof.

In some embodiments, the nucleic acid comprises a nucleic acid selected from the group consisting of mRNA, siRNA, plasmid, and combinations thereof.

In some embodiments, the mass ratio of Dlin-MC3-DMA to nucleic acid can be 5-10: 1 (e.g., 5:1, 6:1, 7:1, 8:1, 9:1, or 10: 1).

In some embodiments, the nucleic acid is used to express a protein or to regulate gene expression.

In some embodiments, the nucleic acid expresses a protein. Preferably the nucleic acid expresses a protein that promotes cell proliferation. Preferably, the nucleic acid expresses a protein that promotes endothelial cell proliferation, migration, and/or angiogenesis. Preferably, the nucleic acid is selected from VEGF mRNA. Further, VEGF mRNA can include the ORF shown in SEQ ID NO. 1.

In some embodiments, the nucleic acid is selected from a nucleic acid or a combination thereof for promoting and/or inhibiting gene expression. Preferably the nucleic acid is selected from nucleic acids or combinations thereof for promoting and/or inhibiting expression of a cell proliferation gene. Preferably, the nucleic acid is selected from nucleic acids or combinations thereof for promoting and/or inhibiting endothelial cell proliferation, migration and/or angiogenesis gene expression. Preferably, the nucleic acid is selected from siRNA or a combination thereof. More preferably, the siRNA comprises two sirnas of Lmo 2.

In a third aspect, the present invention provides the use of an ionizable lipid nanoparticle of the first aspect or a pharmaceutical composition of the second aspect in the manufacture of a medicament for promoting or inhibiting cell proliferation, and/or promoting endothelial cell proliferation, migration and/or angiogenesis and/or accelerating skin damage repair, and/or treating ischemic diseases, and/or inhibiting endothelial cell proliferation, inhibiting angiogenesis and/or inhibiting tumor growth, and/or treating peripheral arterial disease, and/or treating diabetic retinopathy.

The ionizable lipid nanoparticles of the invention have high nucleic acid (mRNA, siRNA, rRNA, tRNA, snRNA, miRNA, plasmid, combinations thereof, and the like) delivery capacity, and can be used to deliver mRNA expressed proteins for disease treatment, such as delivering VEGF mRNA to promote angiogenesis and accelerate skin injury repair; or for delivering siRNA to modulate gene expression, such as delivery of Lmo2siRNA, to inhibit angiogenesis for the treatment of proliferative vascular disease.

Drawings

FIG. 1 shows LNP preparation and characterization, (a) LNP preparation flowsheet; (b) the particle size and surface potential of LNP with different molar ratios; (c) LNP particle size and surface potential of two different components;

figure 2 shows the LNP ability to deliver mCherry mRNA, (a) flow cytometry detects mCherry positive cell number and mean fluorescence intensity for LNP @ mCherry treated groups at different molar ratio configurations; (b) detecting the number of mCherry positive cells and the average fluorescence intensity of LNP @ mCherry treatment groups with different compositions by flow cytometry; (c) flow cytometry is used for detecting the number of mCherry positive cells and the average fluorescence intensity of LNP @ mCherry processing at different time points.

Figure 3 shows LNP cytotoxicity assay results.

Figure 4 particle size at different time points for LNP @ VEGF.

FIG. 5 shows the ability of LNP to deliver VEGF mRNA, (a) RT-PCR and ELISA to detect the expression levels of VEGF mRNA and VEGF protein, respectively; (b) in a, the 12h cell supernatant promotes the proliferation capacity of HUVEC cells; (c) the 12h cell supernatant in a promoted the angiogenic ability of HUVEC cells.

FIG. 6 shows the results of an assay of the ability of LNP to deliver VEGF mRNA to promote angiogenesis, (a) a procedure for the construction of a model for skin injury repair; (b) comparing the healing rates of the back skin of the two groups of mice; (c) the ratio of the blood perfusion quantity at the two sides of the back of the mouse after modeling to the blood perfusion quantity at the 0 th day on the same side; (d) VEGF mRNA levels were detected by RT-PCR on

days

2 and 4.

Figure 7 shows the ability of different groups of LNP @ siRNA to knock down Lmo2 mRNA.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For numerical ranges, each range between its endpoints and individual point values, and each individual point value can be combined with each other to give one or more new numerical ranges, and such numerical ranges should be construed as specifically disclosed herein.

The present invention is described in detail below with reference to the drawings and examples, it should be understood that the examples described herein are only for illustrating and explaining the present invention, and the scope of the present invention is not limited to the examples described below.

The materials used in the examples are commercially available unless otherwise specified.

Dlin-MC3-DMA(HY-112251，MedChemExpress)

Cholesterol (700000P-1g, Avanti Polar Lipids)

DOPE(850725P，Avanti Polar Lipids)

DSPC(850365P，Avanti Polar Lipids)

DMG-PEG 2000(880151P，Sigma-Aldrich)

VEGF mRNA(EZ Cap^TM VEGF mRNA(5mCTP,ψUTP)，APExBIO Technology)，

The ORF is shown as SEQ ID NO. 1:

ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAATCCCTGTGGGCCTTGCTCAGAGCGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCGAGGCGGTGA。

siRNA (Guangzhou Ruibo biotechnology limited)

1：CTGACATAGTGTGCGAACA(SEQ ID NO.2)；

2：TGACAATGCGGGTGAAAGA(SEQ ID NO.3)。

mCherry mRNA(EZ Cap^TM mCherry mRNA(5mCTP,ψUTP)，R1017，APExBIO Technology)

Example 1LNP preparation:

the preparation method comprises the following specific steps: Dlin-MC3-DMA, cholesterol, helper lipids (DOPE or DSPC) and DMG-PEG2000 were dissolved in absolute ethanol and mRNA was dissolved in 10mM citrate buffer. The volume ratio of the water phase to the oil phase is 3: 1 and LNP was prepared (as in the preparation scheme of fig. 1 a). The water phase without mRNA is named as LNP, if mCherry mRNA is dissolved in the water phase, the constructed product is named as LNP @ mCherry. If VEGF mRNA is dissolved in the aqueous phase, the constructed product is named LNP @ VEGF. The product was dialyzed overnight at 4 ℃ in PBS buffer. Dlin-MC3-DMA, cholesterol, DOPE or DSPC and DMG-PEG2000 are mixed into absolute ethyl alcohol according to the molar ratio in table 1 or table 2 respectively, and mCherry mRNA is added into the water phase to prepare LNP @ mCherry. Lipid nanoparticle size, dispersibility and potential were examined using a nanometer particle sizer. The results shown in FIGS. 1b and c show that several LNPs have uniform particle size (PDI <0.2), a size of about 100nm, and a potential of < -20mV in PBS solution.

In example 1, the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid and DMG-PEG2000 is shown in tables 1 and 2:

TABLE 1 molar ratio of the components

Dlin-MC3-DMA	Cholesterol	DOPE	DMG-PEG2000
				20	50	20	10
35	46.5	16	2.5
				40	30	25	5
50	25	24	1
				65	20	10	5

TABLE 2 molar ratio of the components

Dlin-MC3-DMA	Cholesterol	DSPC	DMG-PEG2000
				20	50	20	10
35	46.5	16	2.5
				65	20	10	5

Example 2 endocytosis capacity assay of LNP:

to analyze LNP mRNA delivery and expression capacity, several LNP @ mCherry (mRNA final amount of 1 μ g) were incubated with Human Umbilical Vein Endothelial Cells (HUVEC) cells, with an equal amount of free mCherry mRNA as a control. After 24h, the mCherry positive cell proportion and the mCherry Mean Fluorescence Intensity (MFI) were measured by flow cytometry. The results show that several kinds of LNPs can improve the expression of mCherry compared with the free mCherry group, wherein the mCherry positive cell ratio and the mCherry mean fluorescence intensity of the second group of LNP @ mCherry (Dlin-MC3-DMA, cholesterol, DOPE and DMG-PEG2000 molar ratio is 35: 46.5: 16: 2.5) treatment group are the highest (fig. 2 a).

Example 3 mRNA delivery and expression Capacity of LNP

To compare the mRNA delivery and expression capacity of two helper lipid (DSPC and DOPE) assembled LNPs, different LNPs @ mCherry (final amount of mRNA of 1 μ g) were incubated with HUVEC cells. After 6h, the ratio of mCherry positive cells and the mean fluorescence intensity of MCherry (MFI) were detected by flow cytometry, and the results showed that the ratio of mCherry positive cells and the mean fluorescence intensity of mCherry were higher in the LNP-treated group composed of DOPE than in the LNP composed of DSPC (fig. 2 b). The composition of the subsequent LNP was therefore Dlin-MC3-DMA, cholesterol, DOPE and DMG-PEG2000 in a molar ratio of 35: 46.5: 16: 2.5.

LNP @ mCherry (mRNA final 1. mu.g) was incubated with HUVEC cells, and mCherry mRNA (messenger MAX @ mCherry) was included as a control with an equal amount of free mCherry mRNA and a commercial transfection reagent (Lipofectamine messenger MAX). Cells processed for 6h and 18h were collected respectively, and mCherry positive cell ratio and mCherry Mean Fluorescence Intensity (MFI) were detected by flow cytometry, and the results showed that LNP significantly increased mCherry positive cell ratio and mCherry mean fluorescence intensity compared to free mCherry group (fig. 2 c).

Example 4 cytotoxicity assay of LNP:

to test the cytotoxicity of LNP, different concentrations (12.5, 25, 50 and 100 μ g/mL) of LNP were incubated with HUVEC in 96-well plates, respectively. Cell activity was detected by CCK-8 kit. The results show that the activity of HUVEC cells was not significantly altered at all concentrations, indicating that LNP has lower cytotoxicity (figure 3).

Example 5 stability analysis of LNP:

Dlin-MC3-DMA, cholesterol, DOPE and DMG-PEG2000 in a molar ratio of 35: 46.5: 16: 2.5 oil phase is prepared, VEGF mRNA is added to water phase, and LNP @ VEGF is prepared. LNP @ VEGF was taken at 4 ℃, over 15, 30 and 60 days, respectively, and particle size was measured. The results show that at these several time points, the particle size remains unchanged, demonstrating good stability (fig. 4).

Example 6 LNP @ VEGF in vitro VEGF expression and in vitro tube formation ability analysis:

to examine the ability of expressing mRNA in lipid nanomaterial cells, LNP @ VEGF was incubated with HUVEC cells for 12h or 24h, and equal amounts of free VEGF mRNA and transfection reagent (Lipofectamine messenger max) were premixed with mRNA as controls. Cells and cell supernatants were collected for RT-PCR (VEGF mRNA) and ELISA (VEGF protein) analysis to determine the ability of LNPs to deliver VEGF mRNA in vitro and the ability to express VEGF mRNA in vitro. As shown in figure 5a, LNP was able to increase VEGF mRNA levels and protein expression capacity in endothelial cells compared to the free VEGF group.

To further examine the in vitro expression capacity of LNP-delivered VEGF mRNA, 12h cell supernatants collected in the previous step were incubated with HUVEC cells for 24 h. Endothelial cell proliferation was detected using the CCK-8 kit. The results show that LNP significantly increased endothelial cell proliferation capacity compared to the free VEGF group, which was close to Lipofectamine MessengerMAX (fig. 5 b).

To test the in vitro angiogenesis promoting capacity of LNP @ VEGF, 24-well plates were pre-plated with matrigel, and 12h cell supernatants collected in the previous step were combined with 7X 10⁴HUVEC cells were incubated for 16 h. And tube formation was quantified by Angiotool. As shown in fig. 5c, LNP significantly increased the angiogenic capacity of endothelial cells compared to the free mRNA control group, which was close to Lipofectamine MessengerMAX: the vessel length and vessel junction of the LNP @ VEGF treated group were close to those of the messenger max @ VEGF treated group and significantly higher than those of the free mRNA treated group.

Example 7 LNP @ VEGF in vivo pro-angiogenic ability assay:

a mouse skin injury model was first constructed (FIG. 6a), 10-week-old male BALB/c mice were anesthetized with isoflurane, then wounds of approximately similar size (about 0.7cm in diameter) were punched on both sides of their backs, and the skin at the wounds was sutured with a silicone ring as day 0. On the 0 th day and the 3 rd day, LNP or LNP @ VEGF with the same quantity is respectively dripped into the wounds on the two sides, and the wound areas are measured on the 2 nd, 4 th, 7 th and 9 th days to judge the wound healing condition. The results show that LNP was able to significantly accelerate skin healing at the mouse wound on

days

2, 4 and 7 (fig. 6 b). As shown in fig. 6c, LNP @ VEGF significantly increased the amount of blood perfusion at the wound site, promoting angiogenesis. And collecting skin samples of 2 nd and 4 th days respectively, extracting RNA, and detecting the expression condition of VEGF. As shown in fig. 6d, LNP @ VEGF was able to increase VEGF mRNA levels at the wound.

Example 8 LNP @ sillmo 2 knockdown of Lmo2 expression assay:

Dlin-MC3-DMA, cholesterol, helper lipids (DOPE or DSPC) and DMG-PEG2000 were mixed in the molar ratios in tables 3 and 4. Two Lmo2 sirnas were dissolved in equal amounts in 10mM citrate buffer. The volume ratio of the water phase to the oil phase is 3: 1, and preparing LNP @ siRNA. Several component LNPs were incubated with HUVEC cells and after 72h, the cells were harvested. Total RNA was extracted and Lmo2 mRNA levels were detected by RT-PCR.

As shown by the results in FIG. 7, Dlin-MC3-DMA, cholesterol, DOPE and DMG-PEG2000 were measured according to a 35: 46.5: 16: LNP @ siLmo2 prepared at a 2.5 molar ratio gave the best knockdown of Lmo 2; Dlin-MC3-DMA, cholesterol, DOPE and DMG-PEG2000 were mixed according to 40: 30: 25: the 5 molar ratio prepared LNP @ siLmo2 knockdown Lmo2 was suboptimal.

TABLE 3 molar ratio of the components

Dlin-MC3-DMA	Cholesterol	DOPE	DMG-PEG2000
				20	50	20	10
30	20	40	10
				35	46.5	16	2.5
40	30	25	5
				65	20	10	5

TABLE 4 molar ratio of the components

Dlin-MC3-DMA	Cholesterol	DSPC	DMG-PEG2000
				20	50	20	10
30	20	40	10
				35	46.5	16	2.5
40	30	25	5
				65	20	10	5

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> Guangzhou national laboratory

Biological Island Laboratory

<120> ionizable lipid nanoparticles and uses thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 576

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaactttc tgctgtcttg ggtgcattgg agccttgcct tgctgctcta cctccaccat 60

gccaagtggt cccaggctgc acccatggca gaaggaggag ggcagaatca tcacgaagtg 120

gtgaagttca tggatgtcta tcagcgcagc tactgccatc caatcgagac cctggtggac 180

atcttccagg agtaccctga tgagatcgag tacatcttca agccatcctg tgtgcccctg 240

atgcgatgcg ggggctgctg caatgacgag ggcctggagt gtgtgcccac tgaggagtcc 300

aacatcacca tgcagattat gcggatcaaa cctcaccaag gccagcacat aggagagatg 360

agcttcctac agcacaacaa atgtgaatgc agaccaaaga aagatagagc aagacaagaa 420

aatccctgtg ggccttgctc agagcggaga aagcatttgt ttgtacaaga tccgcagacg 480

tgtaaatgtt cctgcaaaaa cacagactcg cgttgcaagg cgaggcagct tgagttaaac 540

gaacgtactt gcagatgtga caagccgagg cggtga 576

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctgacatagt gtgcgaaca 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tgacaatgcg ggtgaaaga 19

Claims

1. An ionizable lipid nanoparticle comprising Dlin-MC3-DMA, cholesterol, a helper lipid comprising DOPE or DSPC, and DMG-PEG 2000.

2. The ionizable lipid nanoparticle of claim 1, wherein the molar ratio of dilin-MC 3-DMA is between 20% and 65%, preferably between 30% and 50%, more preferably between 30% and 40%, and even more preferably between 33% and 37%, based on the total number of moles of dilin-MC 3-DMA, helper lipid, cholesterol, and DMG-PEG 2000.

3. The ionizable lipid nanoparticle of claim 1 or 2, wherein the molar proportion of helper lipid is 10% to 40%, preferably 15% to 30%, more preferably 15% to 18%, based on the total number of moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

4. The ionizable lipid nanoparticle of any one of claims 1-3, wherein the molar fraction of cholesterol is 20% -50%, preferably 25% -50%, more preferably 44.5% -48.5%, based on the total number of moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

5. The ionizable lipid nanoparticle of any one of claims 1 to 4, wherein the molar proportion of DMG-PEG2000 is between 1% and 10%, preferably between 1% and 5%, more preferably between 1.5% and 3.0%, based on the total number of moles of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG 2000.

6. The ionizable lipid nanoparticle of any one of claims 1-5, wherein the molar ratio of Dlin-MC3-DMA, cholesterol, helper lipid, and DMG-PEG2000 is (20-65): (20-50): (10-40): (1-10), preferably (30-50): (25-50): (15-30): (1-5), more preferably (30-40): (40-50): (15-18): (1-5), more preferably (33-37): (44.5-48.5): (15-17): (1.5-3.0), most preferably (34-36): (46-47): (15-16.5): (2.0-3.0), preferably the helper lipid is DOPE.

7. The ionizable lipid nanoparticle according to any of claims 1-6, wherein said ionizable lipid nanoparticle has an average particle size of 80-100 nm, preferably 95-100 nm; and/or the surface potential of the ionizable lipid nanoparticles in PBS buffer is less than-25 mv, e.g., between-10 mv and-15 mv.

8. A pharmaceutical composition comprising the ionizable lipid nanoparticle of any one of claims 1-7 and a nucleic acid.

9. The pharmaceutical composition of claim 8, wherein the nucleic acid comprises a nucleic acid selected from the group consisting of mRNA, siRNA, rRNA, tRNA, snRNA, miRNA, plasmid, and combinations thereof, and/or

The mass ratio of Dlin-MC3-DMA to nucleic acid is 5-10: 1.

10. The pharmaceutical composition of claim 9, wherein the nucleic acid expresses a protein, preferably wherein the nucleic acid expresses a protein that promotes cell proliferation; preferably said nucleic acid expresses a protein that promotes endothelial cell proliferation, migration and/or angiogenesis; preferably, the nucleic acid is selected from VEGF mRNA.

11. The pharmaceutical composition according to claim 9, wherein the nucleic acid is selected from nucleic acids or combinations thereof for promoting and/or inhibiting gene expression; preferably the nucleic acid is selected from a nucleic acid or a combination thereof for promoting and/or inhibiting expression of a cell proliferation gene; preferably, the nucleic acid is selected from a nucleic acid or a combination thereof for promoting and/or inhibiting endothelial cell proliferation, migration and/or angiogenesis gene expression; preferably, the nucleic acid is selected from siRNA or a combination thereof; more preferably, the siRNA comprises two sirnas of Lmo 2.

12. Use of the ionizable lipid nanoparticle of any one of claims 1 to 7 or the pharmaceutical composition of any one of claims 8 to 11 for the manufacture of a medicament for promoting or inhibiting cell proliferation, and/or promoting endothelial cell proliferation, migration and/or angiogenesis and/or accelerating skin damage repair, and/or ischemic disease treatment, and/or inhibiting endothelial cell proliferation, inhibiting angiogenesis and/or inhibiting tumor growth, and/or treating peripheral arterial disease, and/or treating diabetic retinopathy.