CN114609103A - Cas13a system-based biosensor for detecting exosomes - Google Patents

Abstract

The invention belongs to the technical field of biological detection, and provides a biosensor for detecting exosomes based on a Cas13a system, which comprises: EpCAM-Apt with a nucleotide sequence shown as SEQ NO. 1-7, P1 probe, hairpin probe H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13 a/crRNA; the 5 'end and the 3' end of the Reporter probe are respectively connected with a fluorescence Reporter group and a fluorescence quenching group. The sensor has low detection limit, simple construction method, stable performance and low process cost, and is suitable for the requirements of industrial production and detection.

Description

Cas13a system-based biosensor for detecting exosomes

Technical Field

The invention belongs to the technical field of biological detection, and particularly relates to a biosensor for detecting exosomes based on a Cas13a system.

Background

Exosomes refer to small membrane vesicles (30-150nm) containing complex RNAs and proteins, which today refer specifically to discoidal vesicles with diameters between 40-100 nm. In 1983, exosomes were first found in sheep reticulocytes, which was named "exosomes" by Johnstone in 1987. Many cells secrete exosomes under both normal and pathological conditions. It is mainly from the multivesicular body formed by the invagination of intracellular lysosome particles, and is released into extracellular matrix after the fusion of the outer membrane of the multivesicular body and cell membrane. Exosomes are widely present in various body fluids, can carry a variety of important biological functional molecules such as lipids, proteins, messenger RNAs, non-coding RNAs and the like, and can participate in substance exchange and information exchange between cells.

The exosome has wide application prospect in medicine, can be applied as trauma or beauty purpose, and the effect depends on the content of the exosome. Methods for detecting exosomes reported so far include mass spectrometry and immunoassay, including western blot and enzyme-linked immunoassay (ELISA), but these methods require cumbersome pretreatment of samples, thus limiting their application to rapid detection of exosomes. Therefore, a rapid, accurate, simple and trace analysis method is urgently needed to detect exosomes. In recent years, DNA biosensing detection technology and Cas system have gained wide attention and application by virtue of their high sensitivity and specificity. Among them, the fundamental theory of fluorescence technology is becoming mature, and its role in biology, medicine and other fields is becoming more and more important. Compared with other detection means, the fluorescence technology has the advantages of obvious advantages, high sensitivity, strong specificity and low price.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides the biosensor for detecting the exosome based on the Cas13a system, which has the advantages of high detection speed, simple operation, low price, low detection limit and high specificity.

In order to achieve the purpose, the invention adopts the following technical scheme.

A Cas13a system-based biosensor for detecting exosomes, comprising:

EpCAM-Apt with a nucleotide sequence shown as SEQ NO. 1-7, P1 probe, hairpin probe H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13 a/crRNA;

the 5 'end and the 3' end of the Reporter probe are respectively connected with a fluorescence Reporter group and a fluorescence quenching group;

the nucleotide sequence of the crRNA is shown as SEQ NO. 8.

Preferably, the EpCAM-Apt and P1 probes are replaced by Apt-P1 probes, and the Apt-P1 probe is a double strand obtained by hybridization of the EpCAM-Apt and P1 probes.

A kit for detecting exosomes comprising the above biosensor.

The kit also comprises an exosome standard and a buffer solution.

A method for detecting exosomes by adopting the biosensor or the kit comprises the following steps:

(1) artificially synthesizing an EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, a Reporter probe and crRNA; and obtaining an Apt-P1 probe and Cas13 a/crRNA;

(2) mixing a sample to be detected or an exosome standard substance with an Apt-P1 probe in a buffer solution, and reacting for 30 min; then adding H1, H2, H3 and H4 to react for 30-130 min; then adding T7 RNA polymerase and Cas13a/crRNA to react for 30 min at 37 ℃; then adding a Reporter probe, and reacting for 60 min; setting the excitation wavelength to be 485nm and the emission wavelength to be 520nm, and detecting a fluorescence signal;

(3) and calculating the content of exosomes in the sample to be detected according to the fluorescence signal of the exosome standard product.

The detection principle of the invention is as follows:

the following sequences were used for the biosensor:

EpCAM-Apt：

CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG

P1：

TCTCCAACGGTCTGTCCCTGCAACAGT

H1：

GGTTGCCAGACAGGGTAGACTACCGTAGCCCTGTCTGGACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG

H2：

GTCTGTCCCATCTGATGGCATCGACTGCTACGGCTGCAGACAGACTCAAG

H3：

CTTGAGTCTGTCTGCAGCCGTAGCAGTGCTACGGTAGTCTACCCTGTCTGGACCACCCCAAAAAUGAAGGGGACUAAAACCUACCUGCACUGUAAGCACUUUG

H4：

GGTTGCCAGACAGGGCAGACTGGGTAGACTACCGTAGC

reporter probe:

FAM-TTAAAATT-BHQ1；

crRNA：

GACCACCCCAAAAAUGAAGGGGACUAAAACGUGGUAACCGUCCCCCUUGC

partial sequences of the EpCAM-Apt probe and the P1 probe are complementary, and an arch probe Apt-P1 can be formed; when the target exists, the target is specifically bound with an Apt-P1 probe to release P1, P1 is complementary with the exposed part of H1, H1 is opened, the exposed part is complementary with H2, H2 is opened, the exposed end H3 is complementary, H3 is opened to form a polymer structure, a hairpin H4 is complementary with the end of the polymer to form a cross-shaped polymer structure, P1 is replaced at the same time, P1 circulation is realized, and the amplification effect is realized through HCR reaction;

after adding T7 RNA polymerase, the cross-shaped polymer is cut and a plurality of RNAs are released, the RNA is combined with Cas13a/crRNA, and the cutting activity of Cas13a is excited; upon addition of the Reporter probe, activated Cas13a cleaves the Reporter probe, resulting in separation of the quencher and fluorophore, resulting in fluorescence, which allows quantitative detection of exosome content by measuring fluorescence intensity.

The invention has the following advantages:

the biosensor realizes high specificity detection on a target by utilizing the specific combination of the aptamer and the exosome; by utilizing HCR reaction, a cross-shaped polymer structure is formed, and meanwhile, under the cyclic utilization of P1, exponential amplification and detection signal amplification are realized, the detection sensitivity is improved, and the ultra-sensitive detection of a target exosome is realized; the detection limit can reach 1 mu g/mL, and the detection limit is low. The sensor is simple to construct, effectively avoids pollution possibly caused by adding samples in multiple steps, and avoids a complicated sample pretreatment process, and has the advantages of simplicity in operation, high reaction speed and the like; the main processes of the detection principle are realized in a homogeneous phase, so that the reaction speed is improved, the complexity of operation is reduced, and the rapid, simple and sensitive detection of a target object is realized; the process for manufacturing the biosensor is low in cost and is suitable for low-cost requirements in industrialization; is suitable for the actual requirements of detection of exosomes in medicine.

Drawings

FIG. 1 is a schematic diagram of the present invention;

FIG. 2 is a graph of the results of H1 concentration optimization tests;

FIG. 3 is a graph of the results of the concentration optimization assay of H2;

FIG. 4 is a graph of the results of H3 concentration-optimized assays;

FIG. 5 is a graph showing the results of the reaction time optimization assay;

FIG. 6 is a graph showing the results of exosome concentration detection.

Detailed Description

The present invention will be further described with reference to the following examples and the accompanying drawings, but the present invention is not limited by the following examples.

Example 1 screening of H1-H3 concentrations

(1) Separating exosomes of the CCRF-CEM cells by differential centrifugation, and then resuspending with PBS buffer;

(2) artificially synthesizing an EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, a Reporter probe and crRNA;

the solution of the EpCAM-Apt, P1 probe is denatured at high temperature and renatured at room temperature to form an Apt-P1 probe solution;

mixing Cas13a with crRNA in 5 x PBS buffer to form Cas13a/crRNA complex with cleavage activity;

(3) mixing 4. mu.L of exosome with Apt-P1 (1. mu.L, 5. mu.M) and 5 XPBS buffer, and reacting for 30 min;

then, H1 (1. mu.L, final concentrations of 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1. mu.M, 1.2. mu.M, 1.4. mu.M), H2 (1. mu.L, 1. mu.M), H3 (1. mu.L, 1. mu.M), H4 (1. mu.L, 1. mu.M) were added and reacted for 90 min;

then adding T7 RNA polymerase (1 uL, 1 uM), Cas13a/crRNA (1 uL, 100 nM) to react at 37 ℃ for 30 min;

then adding a Reporter probe (1 mu L, 1 mu M) and reacting for 60 min;

setting the excitation wavelength to be 485nm and the emission wavelength to be 520nm, and detecting a fluorescence signal.

As a result, as shown in FIG. 2, it can be seen that the peak of the detected fluorescence intensity increases with the increase of the concentration of H1, and when the concentration exceeds 1.0. mu.M, the chemiluminescence intensity tends to stabilize, so that the optimum concentration of H1 is 1.0. mu.M.

The same method screens the concentrations of the H2 and H3 probes, and the results are shown in FIG. 3 and FIG. 4, respectively, and it can be seen from the graphs that the peak value of fluorescence intensity increases with the increase of the concentration of H2 or H3, and when the concentration exceeds 1.0. mu.M, the chemiluminescence intensity tends to be stable, so the optimal concentrations of H2 and H3 are both 1.0. mu.M.

Example 2 screening of reaction time

The procedure is as in example 1, except that:

(3) mixing 4. mu.L of exosome with Apt-P1 (1. mu.L, 5. mu.M) and 5 XPBS buffer, and reacting for 30 min;

adding H1(1 μ L, 1 μ M), H2(1 μ L, 1 μ M), H3(1 μ L, 1 μ M) and H4(1 μ L, 1 μ M), and reacting for 30 min, 50 min, 70 min, 90min, 110 min and 130 min;

then adding T7 RNA polymerase (1 uL, 1 uM), Cas13a/crRNA (1 uL, 100 nM) to react at 37 ℃ for 30 min;

then adding a Reporter probe (1 mu L, 1 mu M) and reacting for 60 min;

setting the excitation wavelength to be 485nm and the emission wavelength to be 520nm, and detecting a fluorescence signal.

As a result, as shown in FIG. 5, it can be seen that the peak of the detected fluorescence intensity increases with the lapse of time, and the chemiluminescence intensity tends to be stable after the time exceeds 90min, so that the optimal reaction time is 90 min.

Example 3 detection of exosomes by optimized sensor

(1) Separating exosomes of the CCRF-CEM cells by differential centrifugation, and then resuspending with PBS buffer; exosome samples (0. mu.g/mL, 1. mu.g/mL, 2. mu.g/mL, 3. mu.g/mL, 4. mu.g/mL, 5. mu.g/mL, 6. mu.g/mL) diluted to different concentrations;

(2) artificially synthesizing an EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, a Reporter probe and crRNA;

the solution of the EpCAM-Apt, P1 probe is denatured at high temperature and renatured at room temperature to form an Apt-P1 probe solution;

mixing Cas13a with crRNA in 5 x PBS buffer to form Cas13a/crRNA complex with cleavage activity;

(3) mu.L of exosome (0. mu.g/mL, 1. mu.g/mL, 2. mu.g/mL, 3. mu.g/mL, 4. mu.g/mL, 5. mu.g/mL, 6. mu.g/mL) was mixed with Apt-P1 (1. mu.L, 5. mu.M) and 5 XPBS buffer and reacted for 30 min;

then adding H1(1 μ L, 1 μ M), H2(1 μ L, 1 μ M), H3(1 μ L, 1 μ M) and H4(1 μ L, 1 μ M), and reacting for 90 min;

then adding T7 RNA polymerase (1 uL, 1 uM), Cas13a/crRNA (1 uL, 100 nM) to react at 37 ℃ for 30 min;

then adding a Reporter probe (1 mu L, 1 mu M) and reacting for 60 min;

setting the excitation wavelength to be 485nm and the emission wavelength to be 520nm, and detecting a fluorescence signal;

(4) the results are shown in FIG. 6, from which it can be seen that when the exosome concentration is from 0 to 6. mu.g/mL, an increase in the fluorescence signal is detected with increasing target concentration. Calculating regression equation y =186.325+108.456x, R²=0.994, therebyThe limit of detection for this protocol was calculated to be 1. mu.g/mL.

Sequence listing

<110> university of Jinan

<120> a biosensor for detecting exosomes based on Cas13a system

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cactacagag gttgcgtctg tcccacgttg tcatgggggg ttggcctg 48

<210> 2

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tctccaacgg tctgtccctg caacagt 27

<210> 3

<211> 90

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggttgccaga cagggtagac taccgtagcc ctgtctggac caccccaaaa augaagggga 60

cuaaaaccua ccugcacugu aagcacuuug 90

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtctgtccca tctgatggca tcgactgcta cggctgcaga cagactcaag 50

<210> 5

<211> 103

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cttgagtctg tctgcagccg tagcagtgct acggtagtct accctgtctg gaccacccca 60

aaaaugaagg ggacuaaaac cuaccugcac uguaagcacu uug 103

<210> 6

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggttgccaga cagggcagac tgggtagact accgtagc 38

<210> 7

<211> 8

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttaaaatt 8

<210> 8

<211> 50

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaccacccca aaaaugaagg ggacuaaaac gugguaaccg ucccccuugc 50

Claims (5)

1. A Cas13a system-based biosensor for detecting exosomes, comprising:

EpCAM-Apt with a nucleotide sequence shown as SEQ NO. 1-7, P1 probe, hairpin probe H1, H2, H3, H4, Reporter probe and T7 RNA polymerase, Cas13 a/crRNA;

the 5 'end and the 3' end of the Reporter probe are respectively connected with a fluorescence Reporter group and a fluorescence quenching group;

the nucleotide sequence of the crRNA is shown as SEQ NO. 8.

2. The biosensor of claim 1, wherein said EpCAM-Apt and P1 probes are replaced by an Apt-P1 probe and said Apt-P1 probe is a double strand obtained by hybridization of the EpCAM-Apt and P1 probes.

3. A kit for detecting exosomes comprising the biosensor of claim 1 or 2.

4. The kit according to claim 3, further comprising exosome standard and buffer solution.

5. A method for detecting exosomes using the biosensor of claim 1 or 2 or the kit of claim 3 or 4, comprising the steps of:

(1) artificially synthesizing an EpCAM-Apt, P1 probe, hairpin probes H1, H2, H3, H4, a Reporter probe and crRNA; and obtaining an Apt-P1 probe and Cas13 a/crRNA;

(2) mixing a sample to be detected or an exosome standard substance with an Apt-P1 probe in a buffer solution, and reacting for 30 min; then adding H1, H2, H3 and H4 to react for 30-130 min; then adding T7 RNA polymerase and Cas13a/crRNA to react for 30 min at 37 ℃; then adding a Reporter probe, and reacting for 60 min; setting the excitation wavelength to be 485nm and the emission wavelength to be 520nm, and detecting a fluorescence signal;

(3) and calculating the content of exosomes in the sample to be detected according to the fluorescence signal of the exosome standard product.

Images