CN114606235B

CN114606235B - Cyclic RNA SIRT5 and application thereof in diagnosis and treatment of non-alcoholic fatty liver disease

Info

Publication number: CN114606235B
Application number: CN202210305595.6A
Authority: CN
Inventors: 郑道峰
Original assignee: West China Hospital of Sichuan University
Current assignee: West China Hospital of Sichuan University
Priority date: 2022-03-25
Filing date: 2022-03-25
Publication date: 2023-04-07
Anticipated expiration: 2042-03-25
Also published as: CN114606235A

Abstract

The invention relates to a circular RNA SIRT5 and application thereof in diagnosis and treatment of non-alcoholic fatty liver diseases. The invention discloses the action and mechanism of c i rcRNA SIRT5 in the occurrence and development of NAFLD, provides theoretical basis for enriching the pathogenesis and clinical treatment of NAFLD, and is beneficial to the development of molecular markers of NAFLD diseases and the research and development of clinical drugs.

Description

Cyclic RNA SIRT5 and application thereof in diagnosis and treatment of non-alcoholic fatty liver disease

Technical Field

The invention relates to the technical field of medicines, in particular to a circular RNA SIRT5 and application thereof in diagnosis and treatment of non-alcoholic fatty liver diseases.

Background

With the improvement of economy, the improvement of living standard and life span of people and the change of living habits, the incidence rate of non-alcoholic fatty liver disease (NAFLD) is in a trend of rapid increase, NAFLD is expected to replace chronic viral hepatitis in the future, becomes the most important chronic liver disease, and seriously threatens the life health of people. At present, with the improvement of diagnostic level and the deepening of mechanism research, people have certain understanding on the generation and development of fatty liver, but at present, no effective targeted therapeutic medicine or means is applied to clinic at home and abroad for the treatment of NAFLD, so that clearing the generation mechanism of fatty liver and finding effective prevention and treatment measures are still important subjects facing people for a long time.

NAFLD is usually a component of Metabolic syndrome, the manifestation of Metabolic syndrome in the liver, whereby scholars from 22 different countries of the world, including chinese scholars, agree that NAFLD is suggested to be renamed to Metabolic-disorder-associated fatty liver disease (MAFLD). NAFLD is involved in a wide range of clinical conditions, from benign liver disease steatosis, characterized by fat accumulation in hepatocytes, to Nonalcoholic steatohepatitis (NASH), characterized by inflammation, hepatocellular injury and liver fibrosis, which can further progress to cirrhosis and hepatocellular carcinoma. Although it is now clear that excessive accumulation of fatty acids in the liver due to obesity is the main cause of fatty liver development, not all obese patients are clinically complicated with NAFLD, nor are all patients with NAFLD obese, a phenomenon that is more pronounced in asian populations; in addition, only about 20-30% of patients with simple fatty liver develop further NASH and hepatic necrosis after fatty acids accumulate in the liver. Furthermore, the relationship between the development of steatosis, inflammation and fibrosis, as well as the key clinical outcomes, appears to vary greatly between individuals. This suggests that excessive accumulation of liver lipids is merely an indication of what causes abnormal deposition of lipids in the liver? How does excessive accumulation of liver lipids in turn cause NAFLD to develop? These important issues remain to be further elucidated.

Mitochondria are key organelles in cells, not only provide energy for cells, but also are important places for generating free radicals in cells, and even participate in regulating and controlling apoptosis. Under physiological conditions, mitochondria in cells are in dynamic changes, including changes in the morphology and structure of mitochondria, mitosis, regeneration and fusion of mitochondria, and mitophagy. Mitochondria maintain metabolic homeostasis in the body through their own homeostasis. During the pathogenesis of NAFLD, mitochondria first deal with excessive lipid overload in hepatocytes by balancing NAD +/NADH redox status and increasing mitochondrial elongation. With the progress of the disease, the adaptability and flexibility of mitochondria are reduced, the generation of Reactive Oxygen Species (ROS) is increased, and further, oxidative damage of Mitochondrial DNA (mtDNA), mitochondrial structural abnormality (expressed as giant mitochondria, mitochondrial crest loss and Mitochondrial particle turbidity), imbalance phenomena of Mitochondrial metabolic homeostasis such as lipid peroxidation and the like are caused, and the disease process is worsened. It is thus seen that liver mitochondrial damage is not only an early initiating event of NAFLD, but is continuously aggravated as NAFLD progresses, and rather throughout the course of NAFLD, since NAFLD is a mitochondrial disease in view of both fatty acid beta-oxidation and oxidative stress affecting the development and progression of NAFLD occurring primarily in mitochondria, and even researchers have proposed that NAFLD is a mitochondrial disease, mitochondrial damage has been the focus of the field of research on the pathogenesis of NAFLD. If the dynamic equilibrium of mitochondria is disrupted, the function of mitochondria and even the survival of cells will be affected. Mitochondrial energy metabolism disorders are the major cause of cellular oxidative stress, manifested by the formation of ROS. Therefore, an imbalance in mitochondrial metabolic homeostasis may be the key factor affecting abnormal accumulation of liver lipids and development of NAFLD. What is again what causes an imbalance in mitochondrial metabolic homeostasis?

Circular RNAs (Circular RNAs) are newly discovered endogenous non-coding RNAs with closed loop structures, have the characteristics of stability, universality, conservation, tissue specificity and the like, and play an important role in gene expression regulation. The circRNAs are not influenced by RNA exonuclease, are more stable in expression and not easy to degrade, and are widely expressed in a eukaryotic cell transcriptome. It has been found that circRNAs are aberrantly expressed in a number of human diseases, including cancer, neurodegenerative changes, cardiovascular disease, and the like. Although a great amount of circRNAs have been identified at present, only a few of the circRNAs have been revealed to date, and the functions involved in the circRNAs are mainly focused on miRNA sponges, cis-regulation of parental genes, competitive binding of RNA-binding proteins (RBPs), and translation of short peptides.

In the field of NAFLD research, due to the limited clinical liver tissue specimen acquisition and other factors, most of the past researches are only limited to the establishment of an in vitro model of NAFLD by using palmitic acid or oleic acid to intervene a human hepatoma cell strain or a normal hepatoma cell strain, or to use a high-fat diet to induce a mouse NAFLD model, and then to perform in vitro research and discussion through means of sequencing, silencing and overexpression, and there are few research reports related to the expression spectrum of circRNAs in the liver tissue of a NAFLD patient and further to discuss potential molecular mechanisms and molecular targets. Recently we focused on a study published in CELL by the professor group Su Shicheng, university of mountains in 2020, suggesting that hsa _ circ _0089762 was found to be low expressed in hepatic tissue of NASH cirrhosis by extracting primary fibroblasts from human hepatic tissue and was named as the Steatohepatitis-associated circRNA ATP5B regulator (SCAR). Further phenotypic and mechanistic studies found that circRNA SCARs can bind directly to ATP5B of mPTP complex ATP synthase and block CypD interaction with mPTP in resting state, among others. The research firstly focuses on the expression condition of circRNAs in hepatic stellate cells of patients with NASH accompanied with liver cirrhosis, and further discloses an important molecular mechanism for the development of the NASH to the occurrence of hepatic fibrosis and liver cirrhosis. The development of NASH to liver cirrhosis belongs to a relatively late stage of the progression of NAFLD diseases, and the research on the action and mechanism of circRNAs in early NAFLD patients is reported in relevant documents at home and abroad at present, and corresponding molecular markers and medicines are also lacked.

Disclosure of Invention

The purpose of the present invention is to provide a cyclic RNA that can be used for diagnosis, treatment, or disease monitoring of non-alcoholic fatty liver disease.

The invention provides a circular RNA SIRT5, and the nucleotide sequence of the circular RNA SIRT5 is shown in SEQ ID NO. 1.

The invention also provides a DNA fragment, which codes the circular RNA SIRT5 and is shown as SEQ ID NO. 2.

The invention also provides a recombinant expression vector which contains the DNA segment.

In some embodiments, the recombinant expression vector is a lentiviral vector.

The invention also provides a host cell containing the recombinant expression vector.

In some embodiments, the host cell is a HepG2 cell.

The invention also provides application of the circular RNA SIRT5, the DNA segment, the recombinant expression vector or the host cell in preparation of products for diagnosing, treating or monitoring the non-alcoholic fatty liver disease.

In some embodiments, the product is a reagent, kit, medicament, or device.

The invention also provides a medicament for treating non-alcoholic fatty liver disease, which comprises the circular RNA SIRT5, a DNA segment, a recombinant expression vector or a host cell and medicinal auxiliary materials.

The invention also provides application of the circular RNA SIRT5, the DNA segment, the recombinant expression vector or the host cell in preparation of products for inhibiting expression of hsa-miR-150-5P or improving expression of SIRT5 protein.

The invention firstly proves the relevance of unbalanced mitochondrial metabolism steady state and the development of circRNA SIRT5 and NAFLD in normal liver and NAFLD liver tissue samples, and then observes the dynamic process of the circRNA SIRT5 for regulating and controlling unbalanced mitochondrial metabolism steady state in liver cells in a mouse NAFLD model, discusses whether the SIRT5 can be used as an epigenetic regulation target point for interfering the NAFLD process, and reasonably regulates and controls whether the expression of the circRNA SIRT5 in the liver cells is beneficial to maintaining the balance of the mitochondrial metabolism steady state, thereby improving the prognosis of NAFLD patients. The invention discloses the action and mechanism of circRNA SIRT5 in the occurrence and development of NAFLD, provides theoretical basis for enriching the pathogenesis and clinical treatment of NAFLD, and is beneficial to the development of molecular markers of NAFLD diseases and the research and development of clinical drugs.

Drawings

FIG. 1 is a schematic diagram of the involvement of circRNA SIRT5 in the generation and development of NAFLD according to one embodiment of the present invention;

FIG. 2 shows the results of the second generation sequencing and analysis of CIRCRNA in NAFLD patient liver tissue according to one embodiment of the present invention; wherein, A: human liver tissue HE staining; b: second generation sequencing heatmap of circRNA of human liver tissue; c: wien analysis; d: verifying the expression of the circRNAs in a differential manner; e: human liver tissue mitochondria ECAR; f: human liver tissue mitochondria OCR; g: and (5) verifying the circularity of RNA.

FIG. 3 shows the results of circRNA SIRT5 reduction of fat deposition, ROS and inflammatory factor release in liver tissue of NAFLD mice in accordance with one embodiment of the present invention; wherein A: detecting the ROS expression level in mouse liver tissue cells and mitochondria; b: the amount of inflammatory factor expressed in the plasma of the mouse; c: body shape of normal mouse and NAFLD mouse; d: gross appearance of mouse liver tissue and oil red staining to observe steatosis.

FIG. 4 is a graph showing the results of circRNA SIRT5 inhibition of fat deposition and inflammatory factor release in a HepG2 cell lipotoxicity model in accordance with an embodiment of the present invention; wherein, A: circRNA expression after palmitic acid treatment; b: circRNA expression after palmitic acid treatment; c: liver enzyme levels in cells after palmitic acid treatment; d: observing the influence of circRNA SIRT5 on the steatosis of PA-treated hepG2 cells under a light microscope; e: detecting the ROS expression quantity in hepG2 cells and mitochondria; f: intracellular SIRT5 mRNA expression levels.

FIG. 5 shows the results of the detection of the correlation between the potential mechanism of action of circRNA SIRT5 and the prediction of target spots in accordance with one embodiment of the present invention; wherein, A: expression level of has-miR-150-5P in human liver tissue; b: the expression level of has-miR-150-5P in mouse liver tissues; c: expression level of has-miR-150-5P in hepG2 cells; d: expression levels of SIRT5 in human liver tissue; e: (ii) the expression level of SIRT5 in mouse liver tissue; f: the level of SIRT5 expression in hepG2 cells; g: the circRNA SIRT5 and hsa-miR-150-5P predict the situation of the binding site.

FIG. 6 shows the results of the circRNA SIRT 5-regulated SIRT5 and its downstream signal pathway protein expression according to one embodiment of the present invention; wherein, A: expression of SIRT5, ECH1, VLCAD and SOD1 in mouse liver tissue; b: expression of SIRT5, ECH1, VLCAD, and SOD1 in hepG2 cells; .

Detailed Description

In order to more concisely and clearly show the technical scheme, the purpose and the advantages of the invention, the invention is further described in detail by combining the specific embodiment and the attached drawings. It is understood that one skilled in the art can, in view of the present disclosure, modify the process parameters appropriately to achieve this. It is specifically noted that all such substitutions and modifications will be apparent to those skilled in the art and are intended to be included herein. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The invention selects 5 cases of liver tissues of normal liver tissue, mild NAFLD (5-10% of large-vesicular steatosis), moderate NAFLD (30-60% of large-vesicular steatosis) and severe NAFLD (60% of large-vesicular steatosis) of human to carry out second-generation sequencing of circRNAs, and the result indicates that 10 circRNAs which are expressed in correlation with the severity of diseases exist along with the aggravation of the severity of lesions compared with normal liver, thereby indicating that the circRNAs possibly play an important role in the occurrence and development of NAFLD. Wherein the expression level of 3 circRNAs is reduced, and the expression level of 7 circRNAs is increased. Then, the related data are subjected to differential expression analysis, venn analysis, gene function analysis, signal path analysis and expression verification experiments, and we find that expression change amplitude of novel _ circ _0029917 in the 10 differential genes is the largest and the correlation with the severity of diseases is the strongest. We further analyzed the parent gene to find that novel _ circ _0029917 is derived from reverse splicing of exons of the SIRT5 gene, and for ease of understanding we named novel _ circ _0029917 as circRNA SIRT5.

Sirtuins are a class of Nicotinamide adenine dinucleotide (NAD +) dependent protein deacylases and/or ADP ribosyltransferases, comprising 7 members, SIRT1-SIRT7. Different Sirtuin members have different subcellular localization and function. SIRT1, 6 and 7 are mainly localized in the nucleus, and SIRT3, 4 and 5 are distributed in mitochondria. Sirtuins are currently known to regulate a variety of biological processes: DNA repair, gene expression, cell survival, metabolism, aging, and the like. In mitochondrial sirtuins, SIRT5 shows unique affinity for negatively charged acyl lysine modifications and carries out protein desuccinylation, demalonylation and deglutarylation reactions. SIRT5 is widely distributed in the body, and has the highest content in brain, heart, liver, kidney, muscle and testis. SIRT5 can maintain mitochondrial metabolism and cellular homeostasis by regulating biological processes such as glucose oxidation, ketone body formation, fatty acid oxidation, ammonia and ROS detoxification. SIRT5 knockouts result in β oxidation impairment and accumulation of medium and long chain acylcarnitines in the liver and muscle of mice. SIRT5 can directly combine and activate copper/zinc superoxide dismutase through polysuccinylation, thereby enhancing the ROS detoxification function mediated by SOD 1. SIRT5 knockdown or knocked-out cells show reduced NADPH and GSH levels, resulting in impaired ability to scavenge ROS and increased sensitivity to oxidative stress. The Sirtuins family has been a focus of research in the field of metabolic disease for a long time. In the field of NAFLD, studies have shown that SIRT5 can reduce hepatic steatosis by modulating the deacetylation of metabolic-related proteins in ob/ob mice. In addition, SIRT5 knockout can impair the mitochondrial medium-chain fatty acid oxidation ability of liver of high-fat-fed mice, and aggravate fatty liver. Thus, SIRT5 is believed to play an important role as a metabolic receptor protein in maintaining mitochondrial metabolic homeostasis in the development and progression of NAFLD. In addition, we also found that changes in SIRT5 protein expression in human liver tissue are closely related to hepatocyte fat accumulation and the progression of NAFLD. These studies show that: simple obesity and insulin resistance are not determinants of hepatocyte fat accumulation and NAFLD, and SIRT 5-mediated imbalance in mitochondrial metabolic homeostasis may play a more important role in the development and progression of NAFLD. What are the promoters and intrinsic kinetics of SIRT5 protein expression abnormalities? Whether circRNA SIRT5 formed by reverse splicing of SIRT5 plays an important role in this process?

To this end, we initially investigated the effect of circRNA SIRT5 on SIRT 5-mediated imbalance in mitochondrial metabolic homeostasis. Lentiviruses were overexpressed by synthesis of circRNA SIRT5 and transfected into HepG2 cells. In an in vitro lipotoxicity model established by using palmitic acid, we find that the over-expression of circRNA SIRT5 can obviously promote the beta-oxidation of long-chain fatty acid and inhibit the generation of mitochondrial ROS, thereby reducing the release of inflammatory factors and relieving the lipotoxicity of cells. We therefore speculate that circRNA SIRT5 may regulate the development of NAFLD by regulating hepatocyte mitochondrial metabolic homeostasis, but the specific mechanism by which it participates in regulating NAFLD is not clear. We further found by bioinformatic analysis that SIRT5 is targeted and regulated by hsa-miR-150-5p, and the binding site of hsa-miR-150-5p is just present on the circRNA SIRT5. We also found that although circRNA SIRT5 is less homologous between human and mouse, SIRT5 and hsa-miR-150-5p are highly conserved in sequence between human and mouse, plus previous studies have reported precedent intervention in mouse disease progression with human non-coding RNA, which lays a solid foundation for our subsequent in vivo model validation of the phenotype and function of circRNA SIRT5. Meanwhile, we also found that the expression of circRNA SIRT5 in human NAFLD liver tissues and a HepG2 in vitro lipotoxicity model is in negative correlation with hsa-miR-150-5p, and is in positive correlation with the expression of SIRT5. We further speculate that circRNA SIRT5 may be involved in generation, development and regulation of NAFLD by adsorbing hsa-miR-150-5p and then up-regulating the expression of SIRT5, as shown in FIG. 1.

In conclusion, the invention firstly proves whether the correlation of the unbalanced mitochondrial metabolism steady state and the generation and development of the circRNA SIRT5 and NAFLD exists in normal liver and NAFLD liver tissue samples, and then observes the dynamic process of the circRNA SIRT5 for regulating and controlling the unbalanced mitochondrial metabolism steady state in the liver cells in a mouse NAFLD model, discusses whether the SIRT5 can be used as an epigenetic regulation target for interfering the NAFLD process, reasonably regulates and controls whether the expression of the circRNA SIRT5 in the liver cells is beneficial to maintaining the balanced mitochondrial metabolism steady state, and further improves the prognosis of NAFLD patients. The invention discloses the action and mechanism of circRNA SIRT5 in the occurrence and development of NAFLD, provides theoretical basis for enriching the pathogenesis and clinical treatment of NAFLD, and is beneficial to the development of molecular markers of NAFLD diseases and the research and development of clinical drugs.

circRNA SIRT5 sequence:

UAAAUGGAAAUGUUUUCUAACAUAUAAAAACCUACAGAAGAAGAAAAUAAUUUUCUGGAUCAAAUUAGAAGUCUGUAUUAUAUUGAUGUCUCCAGAUUCAAAUAUAUUAGAAAGCAGCCGUGGAGACAACCAUCUUCAUUUUGGGAGAAAUAACUAAAGUAGCUUAUUUAAAACUCGAUGUACCUCUUGUGGAGUUGUGGCUGAGAAUUACAAGAGUCCAAUUUGUCCAGCUUUAUCAGGAAAAGGGCUCCAGAACCUGGAACUCAAGAUGCCAGCAUCCCAGUUGAGAAACUUCCCCG

circRNA SIRT5 cDNA Gene sequence:

TAAATGGAAATGTTTTCTAACATATAAAAACCTACAGAAGAAGAAAATAATTTTCTGGATCAAATTAGAAGTCTGTATTATATTGATGTCTCCAGATTCAAATATATTAGAAAGCAGCCGTGGAGACAACCATCTTCATTTTGGGAGAAATAACTAAAGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATTTGTCCAGCTTTATCAGGAAAAGGGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTGAGAAACTTCCCCG

the specific research method is as follows:

1. analyzing the correlation of circRNA SIRT5, hsa-miR-150-5p and mitochondrial metabolic homeostasis related protein in liver tissues of NAFLD patients and healthy people

a. And (3) determination of biochemical indexes: cytokines (IL-1. Beta., TNF-. Alpha., IL-6, etc.) in peripheral blood or liver tissue reflect inflammatory activation states; detecting liver function indicators (ALT, AST);

detection of relevant indexes of NAFLD: the liver lipid aggregation and the morphological change are observed by using oil red O, HE for staining; mRNA and protein levels of liver tissue inflammation mediators (TNF-alpha, IL-1 and IL-6) are detected and detected by using a qRT-PCR (quantitative reverse transcription-polymerase chain reaction), western Blotting or immunohistochemical method;

c. detecting related indexes of mitochondrial metabolism steady state: seahorse detects the metabolic phenotype of liver mitochondria; detecting SOD1, ECH1, VLCAD and SIRT5 by Western Blotting; detecting ROS in cytoplasm and mitochondria respectively by a DCFH-DA method and a mitoSOX method; detecting the energy metabolism change of the mitochondria of the liver cells by using Seahorse;

expression and localization of circrna SIRT5 in liver tissues of NAFLD patients: detecting the expression of circRNA SIRT5 by methods such as qRT-PCR and the like; rnaseR digestion tolerance experiment verifies the cyclization condition of circRNA SIRT5; and analyzing the correlation among the circRNA SIRT5, the hsa-miR-150-5p and related indexes of mitochondrial metabolic stability by combining the indexes;

2. validation of the role of circRNA SIRT5 in the NAFLD mouse model

a. Constructing an animal model: NAFLD mouse models were established by feeding wild type C57BL/6J mice with a High-fat diet (HFD), and CD-fed wild type C57BL/6J mice were used as a control group. AAV8 liver specific virus vector transfection to establish mouse circRNA SIRT5 overexpression model;

b. biochemical detection: animal blood was drawn before the experiment, 1,8 weeks, 16 weeks after the start of the experiment. Reflecting the inflammatory activation state of the experimental animal by detecting serum cytokines (IL-1 beta, TNF alpha, IL-6 and the like); detecting liver function indicators (ALT, AST);

c. morphology of lipid accumulation by examination of the degree of hepatic steatosis on cryosections by oil red O staining;

d. detecting related indexes of mitochondrial metabolic homeostasis: detecting SOD1, ECH1, VLCAD and SIRT5 by Western Blotting; detecting ROS in cytoplasm and mitochondria respectively by a DCFH-DA method and a mitoSOX method;

expression and localization of circrna SIRT5 in liver tissue of NAFLD mice: qRT-PCR detects the expression levels of circRNA SIRT5, hsa-miR-150-5p and related indexes of mitochondrial metabolic homeostasis, and analyzes the correlation among the three indexes by combining the indexes;

3. validation of the role of circRNA SIRT5 in NAFLD hepatocyte in vitro models at the cellular level

NAFLD in vitro model construction: adopting palmitic acid to induce a HepG2 liver cell strain lipotoxicity model and circRNA SIRT5 overexpression lentivirus transfected cells so as to confirm the function of the circRNA SIRT5 in the NAFLD in-vitro model;

b. and (3) determination of biochemical indexes: liver function index and cytokine (IL-1 beta, TNF alpha, IL-6, etc.) in supernatant and cell homogenate;

d. morphology of lipid accumulation by oil red O staining to detect the degree of cell steatosis;

e. detecting related indexes of mitochondrial metabolism steady state: detecting SOD1, ECH1, VLCAD and SIRT5 by Western Blotting;

expression and identification of circrna SIRT5 in NAFLD in vitro model: qRT-PCR detects the expression level of the circRNA SIRT5, and analyzes the correlation among the circRNA SIRT5, hsa-miR-150-5p and related indexes of mitochondrial metabolic homeostasis by combining the indexes;

key technical description:

seahorse assay: to observe the association of altered mitochondrial function with NAFLD, we performed Seahorse assays on samples of liver tissue from patients with NAFLD and normal persons. The Seahorse XFp analyzer is an ideal tool for routine testing of metabolic phenotypes in vitro and in other limited samples, and is currently widely used in basic experimental research. We first performed linear purification using the sucrose method and these compounds (oligomycin, FCCP and a mixture of rotenone and antimycin a) were injected sequentially to measure ATP production, maximal respiration and non-mitochondrial respiration, respectively. The proton leak and basal respiratory volume are then calculated using these parameters and the basal breath.

The experimental results are as follows:

1. sequencing circRNAs on 5 samples of liver tissues of healthy people, NAFLD (5-10% of vesicular fatty liver), NAFLD (30-60% of vesicular fatty liver) and NAFLD (60% of vesicular fatty liver) respectively to obtain hundreds of potential pathogenic circRNAs. And (3) taking each group of NAFLD to perform difference analysis with healthy people respectively, then performing Venn analysis to search potential common pathogenic circRNAs, and the result indicates that 10 common difference circRNAs are found, wherein 3 common differences are low in expression, and 7 common differences are high in expression. Then, gene function analysis, signal path analysis and expression verification experiments are carried out on the 10 circRNAs, and we find that the variation range of novel _ circ _0029917 is the largest in the 10 different genes, and the correlation between the expression variation and the severity of diseases is the strongest. We further identified the circRNA SIRT5 cyclization property using RNase R digestion experiments, which suggested that circRNA SIRT5 is circular and resistant to RNase R digestion, see FIG. 2.

2. After constructing a wild type C57BL/6J mouse NAFLD model fed by high-fat diet and using circRNA SIRT5 to overexpress slow virus for transfection, the result indicates that the circRNA SIRT5 can obviously relieve the fatty lesion of mouse liver tissues, reduce the expression of mROS and cROS, and simultaneously can inhibit the release of hepatocyte inflammatory factors caused by NAFLD, and indicates that the circRNA SIRT5 can correct the mitochondrial metabolic homeostasis imbalance caused by NAFLD, which is shown in figure 3.

3. We synthesized circRNA SIRT5 overexpressing lentiviruses and transfected HepG2 cells. In the in vitro lipotoxicity model established by using palmitic acid, we find that overexpression of circRNA SIRT5 can significantly promote beta-oxidation of long-chain fatty acid and inhibit the generation of mitochondrial ROS, thereby reducing the release of inflammatory factors and relieving the lipotoxicity of cells, and see figure 4.

4. To investigate the potential mechanism of action of circRNA SIRT5, we analyzed whether it has protein coding potential by using three common protein potential prediction software, CPC, CNCI and PFAM, and the results suggest that the IRES score of circRNA SIRT5 is 0.728266 and none has protein translation potential. Further, the potential sites of mutual combination between circRNA/miR/mRNA are analyzed by using prediction software such as mirDB, target Scan, RNA Hydrid and the like, and the result shows that 3 sites capable of combining with hsa-miR-150-5p exist in the circRNA SIRT5, and the hsa-miR-150-5p can be combined with SIRT5 mRNA in a targeted mode. Subsequently, we found that the expression of hsa-miR-150-5P is increased and the mRNA expression of SIRT5 is reduced in human and mouse NAFLD liver tissues and HepG2 cell lipotoxicity models. In a HepG2 cell lipotoxicity model with circRNA SIRT5 over-expressed, the circRNA SIRT5 can obviously inhibit the expression of hsa-miR-150-5P and simultaneously can relieve the inhibition effect of hsa-miR-150-5P on SIRT5 mRNA, as shown in figure 5.

5. Subsequently, we observed the effect of circRNA SIRT5 on SIRT5 protein and related indicators of mitochondrial metabolic homeostasis in the mouse NAFLD model and HepG2 cytotoxicity model of circRNA SIRT5 overexpression. The results suggest that circRNA SIRT5 can up-regulate SIRT5 protein expression in mouse liver and HepG2 cells, and further up-regulate the expression of mitochondrial metabolic homeostasis-related proteins (ECH 1, VLCAD and SOD 1) downstream of the signaling pathway, as shown in fig. 6.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Sichuan university Hospital in western China

<120> circular RNA SIRT5 and application thereof in diagnosis and treatment of non-alcoholic fatty liver disease

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 299

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

uaaauggaaa uguuuucuaa cauauaaaaa ccuacagaag aagaaaauaa uuuucuggau 60

caaauuagaa gucuguauua uauugauguc uccagauuca aauauauuag aaagcagccg 120

uggagacaac caucuucauu uugggagaaa uaacuaaagu agcuuauuua aaacucgaug 180

uaccucuugu ggaguugugg cugagaauua caagagucca auuuguccag cuuuaucagg 240

aaaagggcuc cagaaccugg aacucaagau gccagcaucc caguugagaa acuuccccg 299

<210> 2

<211> 299

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

taaatggaaa tgttttctaa catataaaaa cctacagaag aagaaaataa ttttctggat 60

caaattagaa gtctgtatta tattgatgtc tccagattca aatatattag aaagcagccg 120

tggagacaac catcttcatt ttgggagaaa taactaaagt agcttattta aaactcgatg 180

tacctcttgt ggagttgtgg ctgagaatta caagagtcca atttgtccag ctttatcagg 240

aaaagggctc cagaacctgg aactcaagat gccagcatcc cagttgagaa acttccccg 299

Claims

1. A circular RNA SIRT5, characterized in that the nucleotide sequence of the circular RNA SIRT5 is shown as SEQ ID NO. 1.

2. A DNA fragment encoding the circular RNA SIRT5 of claim 1.

3. A recombinant expression vector comprising the DNA fragment of claim 2.

4. The recombinant expression vector of claim 3, wherein the recombinant expression vector is a lentiviral vector.

5. A host cell comprising the recombinant expression vector of claim 3 or 4.

6. The host cell of claim 4, wherein the host cell is a HepG2 cell.

7. Use of the circular RNA SIRT5 of claim 1, the DNA fragment of claim 2, the recombinant expression vector of any one of claims 3 to 4 or the host cell of any one of claims 5 to 6 in the preparation of a product for the diagnosis, treatment or monitoring of non-alcoholic fatty liver disease.

8. Use according to claim 7, wherein the product is a reagent, kit, medicament or device.

9. A medicament for treating non-alcoholic fatty liver disease, comprising the cyclic RNA SIRT5 of claim 1, the DNA fragment of claim 2, the recombinant expression vector of any one of claims 3 to 4, or the host cell of any one of claims 5 to 6, and a pharmaceutically acceptable excipient.

10. Use of the circular RNA SIRT5 of claim 1, the DNA fragment of claim 2, the recombinant expression vector of any one of claims 3 to 4, or the host cell of any one of claims 5 to 6 in the preparation of a product for inhibiting the expression of hsa-miR-150-5P or increasing the expression of a SIRT5 protein.