CN114606232B

CN114606232B - Cow mastitis related lncRNA and application thereof

Info

Publication number: CN114606232B
Application number: CN202111300489.0A
Authority: CN
Inventors: 孙雨佳; 赵天奇; 马瑶瑶; 储双凤; 崔春雨; 杨章平
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2021-11-04
Filing date: 2021-11-04
Publication date: 2023-12-08
Anticipated expiration: 2041-11-04
Also published as: CN114606232A

Abstract

The invention belongs to the technical field of molecular biology, and provides lncRNA related to dairy cow mastitis and application thereof. The invention utilizes the technology of removing ribosomal RNA to analyze and compare the difference of gene expression profiles in normal mammary tissue and inflammatory mammary tissue of Holstein cows, and identifies and screens out the key differential expression lncRNA BMNCR related to the mastitis of the cows. The lncRNA BMNCR is induced to be expressed in inflammatory mammary tissues, eliminates inflammatory reaction to a certain extent and participates in an autologous protection mechanism in the occurrence and development processes of dairy cow mastitis. Therefore, the discovery of the lncRNA BMNCR is helpful for understanding the molecular regulation mechanism of the occurrence and development of the dairy cow mastitis, lays an experimental foundation for developing the dairy cow mastitis targeting drugs and developing the resistance breeding, and has important application prospect.

Description

Cow mastitis related lncRNA and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a novel lncRNA BMNCR extracted from dairy cow mammary tissue and application thereof, and more particularly relates to application of the novel lncRNA BMNCR in preventing and treating dairy cow mastitis and developing resistance breeding and developing targeted drugs.

Background

The mammary gland is a main place for synthesizing milk, and the dairy cow mastitis affects the health of dairy cows and restricts the development of dairy cow industry. For a long time, the dairy cow mastitis causes difficult-to-estimate economic loss for the global dairy cow breeding industry, and as a common disease, the pathogenesis of the dairy cow mastitis is thoroughly researched, but the treatment of the dairy cow mastitis at home and abroad still looks rich and insufficient, so that the problem of high mastitis morbidity and low cure rate puzzles the existing technology. Clinical mastitis cows can lead to the reduction of cow milk quality, the rapid reduction of cow milk yield, the reduction of cow milk nutritive value, the rapid increase of veterinary diagnosis and treatment cost, medical cost and labor capacity of the breeding industry, and recessive mastitis is valued due to high infection rate, and particularly has great influence on milk yield. Thus, the problem of cow mastitis is urgent.

The occurrence and development of mastitis are the result of sequential expression and closure of a series of related genes, the phenotype of which has a special regulatory mechanism and a complex genetic basis. Specific immune signaling pathway activation is a determinant of mastitis occurrence, but this process relies on a close match of coding and non-coding genes. At present, research on the pathogenesis of dairy cow mastitis is mainly focused on gene structure analysis, key gene expression profile research and functional analysis, and the molecular regulation mechanism of the occurrence of dairy cow mastitis, especially the effect of long non-coding RNA (lncRNA) in the occurrence process of the dairy cow mastitis is still unclear, and the complex network connection and action mode between the non-coding RNA and the functional genes are still unclear.

The function of lncRNA is more difficult to determine than that of miRNA and protein, but its range of action is broad, and it is an important function in inflammatory response as a regulatory non-coding RNA. Many studies have shown that different types of lncRNA can play important roles in inflammatory reactions through various mechanisms, but there are few studies on the specific mechanisms of regulation of immune responses and gene expression in the function of lncRNA in the development and progression of mastitis and in the self-protection of the body against inflammation.

Disclosure of Invention

The invention aims to provide a novel lncRNA BMNCR related to dairy cow mastitis, which can obviously up-regulate the expression in staphylococcus aureus-induced mastitis and can obviously up-regulate the expression of inflammation related factors IL2, IL6 and IL8 by reducing the expression of the lncRNA BMNCR, so that the lncRNA BMNCR is induced to be expressed in inflammatory mammary tissues, and eliminates inflammatory reaction to a certain extent and participates in an autologous protection mechanism in the occurrence and development processes of the dairy cow mastitis. The discovery of the lncRNA BMNCR is helpful for understanding the molecular regulation mechanism of the occurrence and the development of the dairy cow mastitis, lays an experimental foundation for developing the dairy cow mastitis targeting drugs and developing the resistance breeding, and has important application prospect.

The technical scheme provided by the invention is as follows:

a lncRNA associated with bovine mastitis, the lncRNA predicted sequence is SEQ ID No.1.

Furthermore, the full-length sequence of the lncRNA is SEQ ID NO.2 by the RACE cloning technology.

The invention also provides application of the lncRNA related to the dairy cow mastitis in preparation of medicaments for detecting, preventing or treating the dairy cow mastitis or in breeding of dairy cow mastitis with disease resistance.

The invention also provides a preparation method of the lncRNA related to the dairy cow mastitis, which takes Total RNA of normal breast tissues of the dairy cow as a template, and carries out 3'RACE and 5' RACE amplification of the lncRNA BMNCR.

Further, the 3' RACE amplification primer sequences were as follows:

P1-F1 GTCATGAAGTAGCCCCACAACAAC；

P1-F2 CTGTTAATGGGATCAGCTCTGAAG。

further, the 5' RACE amplification primer sequences were as follows:

the invention also provides a detection amplification primer of the lncRNA related to the dairy cow mastitis, and the primer sequence is as follows:

P3-F：TGATGTGGGTGTCTGAGTTTC；

P3-R：GCGAGTTTGCCTTTGGTTG。

the invention also provides siRNA of lncRNA related to dairy cow mastitis, which has the following sequence:

P4:GCCAUAAAGCUUGAUAGUATT UACUAUCAAGCUUUAUGGCTT。

the invention also provides the lncRNA related to the dairy cow mastitis, and the method comprises the steps of primary culturing, purifying and subculturing the dairy cow mammary gland epithelial tissue to obtain primary dairy cow mammary gland epithelial cells, transfecting siRNA into the primary dairy cow mammary gland epithelial cells, extracting cell RNA, and obtaining the knockdown lncRNA related to the dairy cow mastitis.

Further, the real-time fluorescent quantitative PCR primer pair sequences of the inflammation-related factors IL1A, IL, IL6, IL8 and IL12 are P5, P6, P7, P8 and P9 respectively:

P5-F:GCTCAAAATGAAGACGAACCC；

P5-R:CAACTTTGGATGGGCAACTG；

P6-F:GCACCTACTTCAAGCTCTACG；

P6-R:GGGCGCGTAAAAGTCAAATG；

P7-F:AGAACGAGTATGAGGGAAAT；

P7-R:TGGCTGGAGTGGTTATTAG；

P8-F:AAGAATTGAGAGTTATTGAGAGT；

P8-R:CAGACCTCGTTTCCATTG；

P9-F:CACCAAAGATAAAACCAGCACAG；

P9-R:GGCACAGGGTTGTCATAAAAG。

the invention provides lncRNA related to the occurrence of dairy cow mastitis, and a ribosome RNA removal technology is used for obtaining the lncRNA with a predicted sequence shown as SEQ ID NO.1.

The invention provides a true full-length sequence of lncRNA, and the sequence is shown as SEQ ID NO.2. Wherein the primer pair sequence of the 3'RACE cloning experiment is P1, and the primer pair sequence of the 5' RACE cloning experiment is P2.

Preferably, the sample detected by the reagent is normal breast tissue of the dairy cow.

More preferably, this lncRNA is designated BMNCR.

The invention detects the expression level of the lncRNA BMNCR, and the primer pair sequence of the real-time fluorescent quantitative PCR amplification is P3.

Preferably, the samples detected by the reagent are normal breast tissue and inflammatory breast tissue of the dairy cows.

The invention provides an interference siRNA of lncRNA BMNCR, which has a sequence of P4 and detects the self-protection function of the lncRNA BMNCR in the occurrence and development processes of dairy cow mastitis.

The invention detects the expression level of inflammation related factors IL1A, IL, IL6, IL8 and IL12, and the primer pair sequences of the real-time fluorescence quantitative PCR amplification are P5, P6, P7, P8 and P9 respectively.

Preferably, the sample to be tested by the reagent is primary mammary epithelial cells of a cow.

More preferably, the siRNA transfected with lncRNA BMNCR is delivered to primary mammary epithelial cells of the cow for 48 hours.

Advantageous effects

The research establishes a staphylococcus aureus-induced cow mastitis model, and utilizes a high-throughput sequencing technology (ribosome RNA removal technology) to identify and screen a key lncRNA which obviously up-regulates expression in staphylococcus aureus-induced mastitis, and a real-time fluorescent quantitative PCR experiment further verifies that the lncRNA obviously up-regulates expression in inflammatory mammary tissue. The invention utilizes the technology of removing ribosomal RNA to analyze and compare the difference of gene expression profiles in normal mammary tissue and inflammatory mammary tissue of Holstein cows, and identifies and screens out the key differential expression lncRNA BMNCR related to the mastitis of the cows. The RACE technique cloned the full-length sequence of lncRNA and for this purpose lncRNA was designated BMNCR (Bovine Mastitis Related lncRNA). Then, the research further synthesizes lncRNA BMNCR siRNA interference sequences, transfects primary mammary epithelial cells of dairy cows, detects the expression changes of inflammatory related factors IL1A, IL2, IL6, IL8 and IL12, and discovers that the interference lncRNA BMNCR can obviously up-regulate the expression changes of the inflammatory factors IL2, IL6 and IL 8. The lncRNABMNCR is expressed in an induction way in inflammatory mammary tissues, eliminates inflammatory reaction to a certain extent and participates in an autologous protection mechanism in the occurrence and development processes of dairy cow mastitis. Therefore, the implementation of the research is helpful for understanding the molecular regulation mechanism of the occurrence and development of the dairy cow mastitis, lays an experimental foundation for developing the dairy cow mastitis targeting drugs and developing the resistance breeding, and has important application prospect.

Drawings

FIG. 1 is a model of normal mammary tissue and staphylococcus aureus successfully induced bovine mastitis tissue in cows;

FIG. 2 is a graph showing the distribution of the differential expression lncRNA of bovine mastitis screened by the technique of removing ribosomal RNA;

FIG. 3 is a gel electrophoresis chart of lncRNA 3' RACE results;

FIG. 4 is a gel electrophoresis chart of lncRNA 5' RACE results;

FIG. 5 shows the expression levels of lncRNA BMNCR in normal and inflammatory mammary gland tissue of cows;

FIG. 6 shows the expression levels of inflammatory-related factors IL1A, IL, IL6, IL8, IL12 in primary mammary epithelial cells of cows after interference with lncRNA BMNCR.

Detailed Description

The invention will now be described in further detail with reference to the drawings and examples. The following examples are only for illustrating the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, all experimental techniques involved in the examples are conventional techniques for cell biology or molecular biology, and are carried out under conventional conditions.

The dairy cow mastitis tissue model successfully induced by normal dairy cow mammary tissue and staphylococcus aureus is successfully constructed and stored in the early stage of the laboratory.

EXAMPLE 1 extraction of Total RNA from samples

After the experimental dairy cows are slaughtered, the mammary tissue is rapidly collected, cut into small pieces, filled into 5mL freezing tubes, put into liquid nitrogen for freezing, and then transferred to a refrigerator at-80 ℃ for long-term storage for extracting total RNA, the lncRNA in the dairy cow mastitis tissue induced by staphylococcus aureus is identified, the mammary tissue gene expression profile is analyzed, and 3 repetitions are set for each sample.

And (3) RNA extraction:

1. thawing frozen tissue samples at 4 ℃;

2. cutting off a 50ug tissue sample to a 1.5mL EP tube, adding 1000mL Trizol, grinding and mixing uniformly, and standing for 5min;

3. adding 200ml chloroform (volume ratio of chloroform to Trizol is 1:5), mixing, standing at 4deg.C for 15min;

centrifuging at 12000rpm at 4.4 ℃ for 15min;

5. carefully draw the supernatant to a new EP tube;

6. adding a proper amount of isopropanol (the volume ratio of the isopropanol to the Trizo1 is 1:1), reversing and mixing uniformly, and standing for 10min;

centrifuging at 12000rpm at 7.4 ℃ for 10min;

8. removing the upper layer centrifugate, and adding 75% ethanol (RNase inactivation);

centrifuging at 8000rpm at 9.4 ℃ for 5min;

10. reserving sediment, discarding upper layer centrifugate, standing for 5-10 min at room temperature;

11. dissolving and precipitating a proper amount of DEPC water, taking a proper amount of RNA solution to measure concentration and observing the extraction condition of RNA;

12. tag name, concentration and date, -80 ℃ for storage.

EXAMPLE 2 lncRNA BMNCR full-length RACE clone

3'RACE and 5' RACE of the lncRNA BMNCR were amplified from normal mammary tissue Total RNA of cows as a template.

(one) 3' RACE

1. Primer design and Synthesis

2. Reverse transcription

cDNA was synthesized using 3' -Full RACE Core Set with PrimeScript Rtase (Code No. 6106).

The reaction system:

reaction conditions: 42 ℃,60min to 70 ℃ and 15min

PCR amplification

PCR amplification was performed using TaKaRa Tks Gflex DNA Polymerase (Code No. R060A).

Outer PCR reaction system:

reaction conditions:

inner PCR reaction system:

reaction conditions:

the PCR product was subjected to 1 agarose gel electrophoresis at 5ul, and the result is shown in FIG. 3

(II) 5' RACE

1. Primer design and Synthesis

2.First-Strand cDNA Synthesis

UsingThe cDNA was synthesized by reverse transcription of RACE 5'/3' kit (Cat. No. 634860).

The reaction system:

1ul SMARTer II A oligo (24 uM) is added

Reaction conditions: 72 ℃,3min to 42 ℃ and 2min

The following components were then added:

adding 90ul Tricine-EDTA buffer, mixing

Reaction conditions: 42 ℃,90min to 70 ℃ for 10min

PCR amplification

Outer PCR reaction system:

reaction conditions:

inner PCR reaction system:

reaction conditions:

the PCR product was subjected to 1 agarose gel electrophoresis at 5ul, and the result is shown in FIG. 4

EXAMPLE 3 expression level of lncRNA BMNCR

1. The total RNA samples were taken out and stored in a refrigerator at-80℃and thawed at room temperature, and a reverse transcription system was prepared in a 0.2mL PCR tube as follows.

Reverse transcription System 20.0. Mu.L: total RNA,1.0 μg;4 XgDNA wind Mix, 4.0. Mu.L; nuclear-free H2O was added to 16.0. Mu.L.

Reaction conditions: 42 ℃ for 2min.

5X No RT Control Mix, 4.0. Mu.L was added

Reaction conditions: 15min at 50℃and 2min at 85 ℃.

Component and volume System in qRT-PCR System

Total reaction system 20.0 μl: 2X AceQ Universal SYBR qPCR Master Mix 10.0.0. Mu.L; each of the upstream and downstream primers was 0.4. Mu.L, cDNA was 2.0. Mu.L, and 7.2. Mu.L of enzyme-free water was added.

Reaction conditions: pre-deformation at 95 ℃ for 5min, cyclic reaction (10 s at 95 ℃, 30s at 60 ℃) x 40 cycles.

The primer pair P3 of the reaction lncRNA BMNCR has the sequence of (5 '-3'):

P3-F：TGATGTGGGTGTCTGAGTTTC

P3-R：GCGAGTTTGCCTTTGGTTG

3. SYBR Green is used as a fluorescent marker, PCR reaction is carried out on a Light Cycler fluorescent real-time quantitative PCR instrument, and a target band is determined through melting curve analysis and electrophoresis, 2 ^-ΔΔ(CT) The method is used for relative quantitative analysis.

4. Statistical method

Experiments were performed in 3 replicates, and the data obtained were expressed as mean ± standard error, statistically analyzed using SPSS 18.0 statistical software, and the differences between the two were t-tested, which was considered statistically significant when P < 0.05.

5. Results

lncRNA BMNCR very significantly upregulates expression in inflammatory breast tissue.

Example 4 Synthesis and transfection of 4 lncRNA BMNCR siRNA

1. According to the full-length sequence of lncRNA BMNCR, lncRNA BMNCR siRNA sequence was designed, nucleotide sequence P4 was (5 '-3'):

P4:GCCAUAAAGCUUGAUAGUATT UACUAUCAAGCUUUAUGGCTT

2. primary culture of cow mammary epithelial cells

2.1 test animal draws: selecting dairy cows with lactation period and no recessive mastitis, and aseptically acquiring mammary tissue of the dairy cows by adopting a surgical operation method. The method comprises the following steps: health examination is carried out one week before operation, clinical observation is free of abnormality, detection of mastitis is carried out by CMT (California Mastitis Test), and dairy cows without mastitis can be adopted every 2 days. Conventional anesthesia, an incision of about 5cm in length was made at the center of the line from the base of the breast to the nipple, and about 5g of mammary tissue was collected, placed in a complete culture medium of DMEM/F12 (30% fetal bovine serum, 300U/mL penicillin, 300U/mL streptomycin) prepared in advance, and brought back to the laboratory for further treatment.

2.2 primary culture of mammary epithelial cells: the breast tissue was repeatedly rinsed with PBS and the remaining milk and blood were rinsed clean until the rinse was clear. The acinus was carefully picked up with sterile forceps, collected in a beaker, and minced with scissors (1X 1 mm) ³ ) Proper amount of pancreatin was added, mammary tissue was coarsely digested at 37 ℃, then tissue pieces were precipitated, and the supernatant was removed. Repeatedly washing tissue blocks with PBS, adding collagenase, shaking and digesting at 37deg.C for 2 hr, filtering, and collecting cells and cell clusters. Inoculating into 6-hole culture plate according to density, and adding 5% CO ₂ Culturing in a saturated humidity cell incubator, and changing liquid every other day.

2.3 purification of mammary epithelial cells: according to the difference of sensitivity degree of mammary epithelial cells and fibroblasts to digestive juice, the differential time digestion method is adopted to remove the fibroblasts and enrich the mammary epithelial cells.

2.4 subculturing of mammary epithelial cells: after purification, when the mammary epithelial cells reach 80% confluence, the culture solution is discarded, and Ca-free mammary epithelial cells are used ²⁺ 、Mg ²⁺ Is washed with PBS. Then adding pancreatin and EDTA mixed digestive liquid to digest the cells. The cells were continuously observed under an inverted microscope, and after most of the cells were retracted, rounded, and the cell gap was enlarged, digestion was stopped, the cells were repeatedly blown, collected and counted at 1×10 ⁵ Inoculating the culture plate with one/mL solution, adding 5% CO ₂ Culturing in a saturated humidity cell incubator, and changing liquid every other day.

3. Transfection experiment of primary mammary gland epithelial cells of dairy cows

3.1 cow primary mammary epithelial cells were cultured to a density of about 70% with 6-well plates.

3.2 20pmol siRNA was dissolved in 50. Mu.LSerum-free medium (pre-warmed at 37 ℃ before use).

3.3 1. Mu.L lipo2000 was dissolved in 50. Mu.LIn serum-free medium (preheated at 37 ℃ before use), the mixture was left at room temperature for 5min.

3.4 mixing the diluted siRNA of the 2 tubes with lipo2000, and standing at room temperature for 20min.

3.5 during transfection, the medium in the 6-well plate was changed to serum-free medium, and the above mixture was added dropwise.

3.6 after 4-6 hours of incubation, the complete medium containing serum was changed.

Example 5 expression level of inflammation-related factor

According to example 4, after lncRNA BMNCR siRNA-36 hours of transfection of primary mammary epithelial cells of cows, cellular RNA was extracted with Trizol, by the method referred to example 1. Further, reverse transcription of RNA into cDNA was performed for a fluorescent quantitative PCR experiment, and the specific method was described in example 3. Wherein, the primer pairs of the inflammation-related factors IL1A, IL, IL6, IL8 and IL12 are P5, P6, P7, P8 and P9 respectively, and the specific sequences are as follows (5 '-3').

P5-F:GCTCAAAATGAAGACGAACCC

P5-R:CAACTTTGGATGGGCAACTG

P6-F:GCACCTACTTCAAGCTCTACG

P6-R:GGGCGCGTAAAAGTCAAATG

P7-F:AGAACGAGTATGAGGGAAAT

P7-R:TGGCTGGAGTGGTTATTAG

P8-F:AAGAATTGAGAGTTATTGAGAGT

P8-R:CAGACCTCGTTTCCATTG

P9-F:CACCAAAGATAAAACCAGCACAG

P9-R:GGCACAGGGTTGTCATAAAAG

The results show that:

after decreasing the expression of lncRNA BMNCR relative to control NC (Negative Control), the expression levels of inflammatory factors IL2, IL6, IL8 were significantly or very significantly up-regulated.

Sequence listing

<110> university of Yangzhou

<120> a dairy cow mastitis related lncRNA and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4206

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gaacgtaaag aattaaggag tatcattaaa tgggcttatg atgaataata cattatctca 60

agaataatgc tttaattgct ggagacgcca taaagcttga tagtaataat tttattttaa 120

aatgacaaag atttctacat catgttaatt tagcctttga tacagtaata gaaacggctt 180

ttaaaaagat tcaaatacag aaaagcatta aggcgagagg tctggttaag cagatgggag 240

gtgatagaac tgcaaatatt agaattgtgg taacatttgt atatactaaa gataagaata 300

ctgtttctgt attaaagttg ataggaaaaa ctagttttac atttcttttt ccctcctgcc 360

aaatgagaat atgggatttg gtggccgaaa ttccagttag gtttgaaatt cttattaagg 420

acttggttat tagagctttt gcatcttctt tgatccaaag ttatttgctt ttcagctgaa 480

actgtttgct actaggttga acaaataaat aagcagcatc ttgaattcat tttagaactt 540

ggaatccagc atttaaagga caccaagagg ggcctattca ttggggtttt atttagctgg 600

gcagcaactt ctctttctgc ctggtgaaaa atggatgttt tctcctcgct caaacaacat 660

aatcctttct aatacaaaag atttagacct tggagtgtga agggttaatg gtggtccttc 720

cccgctgtcc tcccaccccc cagcttcacc cctgactgtt ttgacaacac ttttcaaagt 780

gtgacattcc aagcccctac ataacaatgt aatattactg taattacaca ggtcattaca 840

ttttaaatag agaacaataa aatgcttatc gccctgaaaa agaacaggtg ttcttgccct 900

tctttggtat ttatgctaat tgtttttcat ctccttgaga aatatttatg gcaaacatgt 960

ttagatttca atctcaaggc agcagtatta attccgtgct aatctttcta ggttggggtt 1020

taatgtctgc agtttggatt atgggctcaa cattcaccca ataagtcata ttttaatgat 1080

tataaattta atatgccagc gcttccacag tttgttgaaa tgaaagcctt gtgaaaaccc 1140

cagaaacaaa actatgaggc attcgggagc ctagagtgtt tatctggaag aagtgttttt 1200

ggaaacttga ctgctgaagg aaagtagctt tcattgatgc acccctatct gattgagaaa 1260

agatttggag aaaaacaatc ccccattctg gctgggagtt ttccaccttg attttaattt 1320

tactgatacg gatttcattt agagtccctg ctggaaactg gtcagctttc tgtttcttag 1380

caagctgtga aaaagttaca ggaaggtttc cgggggctgg cagatcaaga atgctgttct 1440

gttagcagtt caggataact gcagttctgc acgccattaa aaaaatattt gctttagaaa 1500

accagcattt taatagttgc accagaggct gtgcttttaa agattacagt agaagtcttt 1560

ccaggttttg aatgtttcct cacatgccac gaggtgcctg tgtgcatacg aaaagcaccc 1620

agacttcttg gtggagaaat gttggtgcaa cttctcttac acaggctcag tgggtaaact 1680

ggaaggtatg taagaggatt ttacattttg tcagatgttt cacaacaggg gcccccgaat 1740

cacattaaaa atgcactgca gagacaggac agctgcaaat ttttgtgcgg acgcgtgttt 1800

ctggaccatg actaaaactc cggggacctt ttccccagct gtctggaagt tctgtggaag 1860

ttggtttatt ggcagttaag tctgagacaa cctggattta gcaaagactc tcctacacag 1920

gaagtagatg acattatatt gggggaaggg acttcaggca aggagtgatt tactcctttt 1980

ttgttttttt ttttaaaccg tggcgttgcc aaataaataa gcactttcca aggaagtagg 2040

tgtaagcttt ttagtcttgg tgagtggaaa tagataatat ctttaaccgc atttataact 2100

gtttcgaggt gacacatttc agaagtttgg agaaggaggg gggtgaatca aattcttgag 2160

gcttttcttt ttgaaagggg tgtgtgatgt gggtgtctga gtttcttctg ggagtggata 2220

ttggcaaccg tgtaagtcaa tcttcaactc tgacttataa ttgagcacat ttgtgaagga 2280

aatggttaat tttacaacca aaggcaaact cgcacctcga caggtctgct gaaagaaatg 2340

tgccctagtc ctttgctggc aagcaccacc gggtcataaa tccacaggct ttatttacag 2400

cccataacac ttatgaatgt taagatattt gacgccacgt tggccttata atattcaagg 2460

tctgcagaca ctggcagtag ctcaaatttc tctcactaat tataagcaat gagatggggg 2520

ggggtggaga cagcccatcg ccaaagctgc cctctccccc gcctctgacc cccaccctta 2580

caatctgagc caaccgagac agacaccccc tcctcctctg gcagctgact tgtacttttc 2640

ctccaggcta ttgttataca catttataaa gagcactttc aggaatggaa attcagtggg 2700

ggctctgcac gaatgttttt caaaagcaaa gttgctttag gtgtttgcat cttttttcct 2760

tttcttctgg tttatccctt tttcctttct ttcttgactt tttttttttt ttttggagac 2820

cctgttttct atattgtgct tatttcccag aatacttaaa gaaacctaat atgggaggct 2880

gcccttcaat ttacatgatg tttcactgag ctggaaggga aaacgtacgc attgcatagt 2940

gcgctagcta acgtgagggt taaaagaaaa gtgacgtgga gtgaggagaa ttgattaaaa 3000

gaattaatag atgaggaaaa aaaagccaag tttgctttgg gaatgggaag gccattcatt 3060

tgggaaatgt gcagtggtgt cttggtggag gacatagaaa tgtaacagag aaggcagaat 3120

aaatgcttgg ctaagaaagg ttagaaaggc ataaaaagat gcggcagaga tttgggctgg 3180

acaaaaatgg cttcattgaa attaggagtt agaagtttct gatgagaggt gaaaatacca 3240

tgactggggg ctggggtggg ggatggtatt aacaaccata ttgatttgct cagtaaaaac 3300

tggttccaat ctagttttca cccaaagagc tctgtgcagc agataataat ttcatgtgag 3360

ttaccgtgca agagtctggg gaaggggcat ctgtggtgaa gacccccgat gtgagagaga 3420

tggccagtta ccctgtggat tgtaatttat tcttaaaaaa ggagtgggct gtcctggtgt 3480

ttgtgtgacc acatggcaaa gggggagtgg gattccgagg tgtgtgggaa actgtggcaa 3540

agaggggcgg ggctgatggc tgtgtcattt ctggccgggt ccttcgctcc atccaaccca 3600

aacttaaaga ctgaggctga acggttttat tttctaatca atggaatgca gaaacttact 3660

agccctctgg gacagatagg aatcccttaa cagctcatta caaagatggg gctgtgggat 3720

ctttgaacgg gttatcagcc ctggtgttct ttggttttcc taggataggc tgttttcttc 3780

cttaggcata tctgatttgg ggctggtaat ttggtctctt atattttatc cttttttttt 3840

tttggtcatg aagtagcccc acaacaactc cttctgcagg gaaaagggat ggctgttaat 3900

gggatcagct ctgaaggagt taaaatggct tgctaaagtt tggcatcatg aaaataaatt 3960

tgaggcctgg taggcattag taaggcacag cacatttaca gagcttaatt agtacgaact 4020

gtaattgttc atggtctgcc agaagaagta atgttcagga aaagtggagt ccttctcttg 4080

cagtctttag tttgaaaccg ataaatcact tgcatatttg tgtagtgatt caaatggagc 4140

taagacctct cccatcccaa catgtggtaa attgtaaagt caatgaattg cagatgtagg 4200

ctacag 4206

<210> 2

<211> 6058

<212> DNA/RNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gagtgtacct gtaagcagtt gcatcctttc aaaagcaagc tctttggatt cctggtttct 60

gcttttctat ttaagaacgt aaagaattaa ggagtatcat taaatgggct tatgatgaat 120

aatacattat ctcaagaata atgctttaat tgctggagac gccataaagc ttgatagtaa 180

taattttatt ttaaaatgac aaagatttct acatcatgtt aatttagcct ttgatacagt 240

aatagaaacg gcttttaaaa agattcaaat acagaaaagc attaaggcga gaggtctggt 300

taagcagatg ggaggtgata gaactgcaaa tattagaatt gtggtaacat ttgtatatac 360

taaagataag aatactgttt ctgtattaaa gttgatagga aaaactagtt ttacatttct 420

ttttccctcc tgccaaatga gaatatggga tttggtggcc gaaattccag ttaggtttga 480

aattcttatt aaggacttgg ttattagagc ttttgcatct tctttgatcc aaagttattt 540

gcttttcagc tgaaactgtt tgctactagg ttgaacaaat aaataagcag catcttgaat 600

tcattttaga acttggaatc cagcatttaa aggacaccaa gaggggccta ttcattgggg 660

ttttatttag ctgggcagca acttctcttt ctgcctggtg aaaaatggat gttttctcct 720

cgctcaaaca acataatcct ttctaataca aaagatttag accttggagt gtgaagggtt 780

aatggtggtc cttccccgct gtcctcccac cccccagctt cacccctgac tgttttgaca 840

acacttttca aagtgtgaca ttccaagccc ctacataaca atgtaatatt actgtaatta 900

cacaggtcat tacattttaa atagagaaca ataaaatgct tatcgccctg aaaaagaaca 960

ggtgttcttg cccttctttg gtatttatgc taattgtttt tcatctcctt gagaaatatt 1020

tatggcaaac atgtttagat ttcaatctca aggcagcagt attaattccg tgctaatctt 1080

tctaggttgg ggtttaatgt ctgcagtttg gattatgggc tcaacattca cccaataagt 1140

catattttaa tgattataaa tttaatatgc cagcgcttcc acagtttgtt gaaatgaaag 1200

ccttgtgaaa accccagaaa caaaactatg aggcattcgg gagcctagag tgtttatctg 1260

gaagaagtgt ttttggaaac ttgactgctg aaggaaagta gctttcattg atgcacccct 1320

atctgattga gaaaagattt ggagaaaaac aatcccccat tctggctggg agttttccac 1380

cttgatttta attttactga tacggatttc atttagagtc cctgctggaa actggtcagc 1440

tttctgtttc ttagcaagct gtgaaaaagt tacaggaagg tttccggggg ctggcagatc 1500

aagaatgctg ttctgttagc agttcaggat aactgcagtt ctgcacgcca ttaaaaaaat 1560

atttgcttta gaaaaccagc attttaatag ttgcaccaga ggctgtgctt ttaaagatta 1620

cagtagaagt ctttccaggt tttgaatgtt tcctcacatg ccacgaggtg cctgtgtgca 1680

tacgaaaagc acccagactt cttggtggag aaatgttggt gcaacttctc ttacacaggc 1740

tcagtgggta aactggaagg tatgtaagag gattttacat tttgtcagat gtttcacaac 1800

aggggccccc gaatcacatt aaaaatgcac tgcagagaca ggacagctgc aaatttttgt 1860

gcggacgcgt gtttctggac catgactaaa actccgggga ccttttcccc agctgtctgg 1920

aagttctgtg gaagttggtt tattggcagt taagtctgag acaacctgga tttagcaaag 1980

actctcctac acaggaagta gatgacatta tattggggga agggacttca ggcaaggagt 2040

gatttactcc ttttttgttt ttttttttaa accgtggcgt tgccaaataa ataagcactt 2100

tccaaggaag taggtgtaag ctttttagtc ttggtgagtg gaaatagata atatctttaa 2160

ccgcatttat aactgtttcg aggtgacaca tttcagaagt ttggagaagg aggggggtga 2220

atcaaattct tgaggctttt ctttttgaaa ggggtgtgtg atgtgggtgt ctgagtttct 2280

tctgggagtg gatattggca accgtgtaag tcaatcttca actctgactt ataattgagc 2340

acatttgtga aggaaatggt taattttaca accaaaggca aactcgcacc tcgacaggtc 2400

tgctgaaaga aatgtgccct agtcctttgc tggcaagcac caccgggtca taaatccaca 2460

ggctttattt acagcccata acacttatga atgttaagat atttgacgcc acgttggcct 2520

tataatattc aaggtctgca gacactggca gtagctcaaa tttctctcac taattataag 2580

caatgagatg ggggggggtg gagacagccc atcgccaaag ctgccctctc ccccgcctct 2640

gacccccacc cttacaatct gagccaaccg agacagacac cccctcctcc tctggcagct 2700

gacttgtact tttcctccag gctattgtta tacacattta taaagagcac tttcaggaat 2760

ggaaattcag tgggggctct gcacgaatgt ttttcaaaag caaagttgct ttaggtgttt 2820

gcatcttttt tccttttctt ctggtttatc cctttttcct ttctttcttg actttttttt 2880

ttttttttgg agaccctgtt ttctatattg tgcttatttc ccagaatact taaagaaacc 2940

taatatggga ggctgccctt caatttacat gatgtttcac tgagctggaa gggaaaacgt 3000

acgcattgca tagtgcgcta gctaacgtga gggttaaaag aaaagtgacg tggagtgagg 3060

agaattgatt aaaagaatta atagatgagg aaaaaaaagc caagtttgct ttgggaatgg 3120

gaaggccatt catttgggaa atgtgcagtg gtgtcttggt ggaggacata gaaatgtaac 3180

agagaaggca gaataaatgc ttggctaaga aaggttagaa aggcataaaa agatgcggca 3240

gagatttggg ctggacaaaa atggcttcat tgaaattagg agttagaagt ttctgatgag 3300

aggtgaaaat accatgactg ggggctgggg tgggggatgg tattaacaac catattgatt 3360

tgctcagtaa aaactggttc caatctagtt ttcacccaaa gagctctgtg cagcagataa 3420

taatttcatg tgagttaccg tgcaagagtc tggggaaggg gcatctgtgg tgaagacccc 3480

cgatgtgaga gagatggcca gttaccctgt ggattgtaat ttattcttaa aaaaggagtg 3540

ggctgtcctg gtgtttgtgt gaccacatgg caaaggggga gtgggattcc gaggtgtgtg 3600

ggaaactgtg gcaaagaggg gcggggctga tggctgtgtc atttctggcc gggtccttcg 3660

ctccatccaa cccaaactta aagactgagg ctgaacggtt ttattttcta atcaatggaa 3720

tgcagaaact tactagccct ctgggacaga taggaatccc ttaacagctc attacaaaga 3780

tggggctgtg ggatctttga acgggttatc agccctggtg ttctttggtt ttcctaggat 3840

aggctgtttt cttccttagg catatctgat ttggggctgg taatttggtc tcttatattt 3900

tatccttttt tttttttggt catgaagtag ccccacaaca actccttctg cagggaaaag 3960

ggatggctgt taatgggatc agctctgaag gagttaaaat ggcttgctaa agtttggcat 4020

catgaaaata aatttgaggc ctggtaggca ttagtaaggc acagcacatt tacagagctt 4080

aattagtacg aactgtaatt gttcatggtc tgccagaaga agtaatgttc aggaaaagtg 4140

gagtccttct cttgcagtct ttagtttgaa accgataaat cacttgcata tttgtgtagt 4200

gattcaaatg gagctaagac ctctcccatc ccaacatgtg gtaaattgta aagtcaatga 4260

attgcagatg taggctacag tgagattctc taagaaaatg cagaatgaat gggaaagagt 4320

gatgctataa atatttactg agaagataac taggttcttg cgtgctgggc caattatgat 4380

gtactaagta tattagcaaa atgcttaaaa aaattgagag gatttgtatg ggtctttggg 4440

tgggttggtt tatttgggaa agtgaagtaa aaggcactat gttattgccc tgtcagtttt 4500

attaagcctg aatcacaatg gcatacccag ggaaggacac atgaaaccca cattaatgca 4560

aattaattcg ttgtgagttg cagcactgtg actgctaagt ggagtaatga tggggcatta 4620

ttttaagagt gttagtgtag caacttttaa tgaaaaatgc tgtgttagga acatgtctca 4680

gcactttagc ccacgtgttt ttatatgctg gaaatgtgtt ttggacaaga gcaggaaact 4740

tgcttcactt tattcttctc tctcccaaac agtttaagaa ctgtaattat ggtttgatgt 4800

ttaaagaaaa tcatctaatt ttccctcaaa aaacaaatcc agaaatgccc atcaccataa 4860

ccaagttcaa ctgtaacttt ttgcagtgac tgcaccacaa aatggaaaaa aaaaaatgta 4920

gctcccccca cgcccgccat aaacctatag atataacttt ctcaaagtga ttttctcttt 4980

tttttttttt ttttccttag agaattttgg tctcaggcag tgttgcaagt caatacttct 5040

ttccctcaat gtgagtaggt ggatgtgtat gaaagctgta aaagttaatg atcgttctct 5100

gactcatagc tgatggtttc aggttgagga aaagaaaaga aaaaattaat gagggtaaat 5160

agacatttga tggaacatcg agacagtagg agagattgtt cctgtgtcta aaggcgtgtg 5220

ttttgttgtg gcacaatttc tggagaaagc caggaaggga aaaggggttg cctttgttaa 5280

gttgttgttt taggagggta cagatgttct gtgtctggat ctttgcagga atgcttaagc 5340

ctccatccct accagtctgt gctggttttg ccttccctgt aggagttaga agcccccttg 5400

gcacttttta aaggggtagg gagacagaca cccagaggcc tggtcagaag tttatttccc 5460

agtaaatgta agaggctccc aacatagggc ttgggggtgc tgtcactgtc ctgaaaaatg 5520

acttgtgacc taagaaaagg tcttagatat acttgggccc ctattttgtc ttttatgcta 5580

atgacatgta aattaaactt aaagtgcctc ttggtggtag ctacagtggt gaggaaggtg 5640

aaccaagaat tcccccaaac cagaaccttt taggaaatga atctggattt cttcttcttt 5700

tttttttaaa tagaaagcta ggtgattcat aaaaatggaa ataaagcaaa tgctccccct 5760

cttctcagtt tagtggagtg agtaggcata cgaaattaat cttcatccta caggaagttc 5820

acttaagtgt tggaaaaccc aatggaaggt ttcaagtttt ttgagttgcc tttgaggatg 5880

agatctctgt ggctgaaaaa gctgcattgc ttttcttcca tctctgggta tctctgatgt 5940

cttgtatcgg aaacattgca tttaggtgcc attgccttct ccggtgactt tgggttaggt 6000

gcaatgattg cttcagacac aaaaaaggct caaaaaatgc tgataaactg gacttact 6058

Claims

1. The dairy cow mastitis related lncRNA is characterized in that the sequence of the dairy cow mastitis related lncRNA is shown as SEQ ID NO.2.

2. The method for preparing lncRNA related to bovine mastitis according to claim 1, wherein the 3'race and 5' race amplification of lncRNA BMNCR is performed using Total RNA of normal mammary tissue of dairy cows as a template.

3. The method for preparing the lncRNA related to bovine mastitis according to claim 2, wherein the 3' race amplification primer sequence is as follows:

P1-F1 GTCATGAAGTAGCCCCACAACAAC ；

P1-F2 CTGTTAATGGGATCAGCTCTGAAG。

4. the method for preparing the lncRNA related to bovine mastitis according to claim 2, wherein the 5' race amplification primer sequence is as follows:

P2-RT1 TTTCTCAATCAGATAGGGGTGCAT；

P2-RT2 CTTCCAGATAAACACTCTAGGCTC；

P2-R3 TTTCAAACCTAACTGGAATTTCGG；

P2-R4 AAATCCCATATTCTCATTTGGCAG。

5. the method for preparing the lncRNA related to the dairy cow mastitis according to claim 2, wherein the primary mammary gland epithelial cells of the dairy cows are obtained after primary culture, purification and subculture of the mammary gland epithelial tissues of the dairy cows, siRNA is transfected into the primary mammary gland epithelial cells of the dairy cows, cellular RNA is extracted, and the knockdown lncRNA related to the dairy cow mastitis is obtained.