CN114592090A - Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying African swine fever viruses of genes I and II - Google Patents
Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying African swine fever viruses of genes I and II Download PDFInfo
- Publication number
- CN114592090A CN114592090A CN202210190570.6A CN202210190570A CN114592090A CN 114592090 A CN114592090 A CN 114592090A CN 202210190570 A CN202210190570 A CN 202210190570A CN 114592090 A CN114592090 A CN 114592090A
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- gene
- kit
- asfv
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000701386 African swine fever virus Species 0.000 title claims abstract description 112
- 238000001514 detection method Methods 0.000 title claims abstract description 81
- 238000003753 real-time PCR Methods 0.000 title claims abstract description 79
- 239000000523 sample Substances 0.000 title claims abstract description 75
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 63
- 239000002773 nucleotide Substances 0.000 claims abstract description 6
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 6
- 239000000203 mixture Substances 0.000 claims description 16
- 238000010791 quenching Methods 0.000 claims description 11
- 230000000171 quenching effect Effects 0.000 claims description 11
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 7
- 239000012807 PCR reagent Substances 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 claims 1
- 238000000034 method Methods 0.000 abstract description 33
- 230000009977 dual effect Effects 0.000 abstract description 17
- 230000035945 sensitivity Effects 0.000 abstract description 7
- 241000700605 Viruses Species 0.000 abstract description 5
- 230000002265 prevention Effects 0.000 abstract description 5
- 230000009286 beneficial effect Effects 0.000 abstract description 3
- 238000011002 quantification Methods 0.000 abstract 1
- 230000003321 amplification Effects 0.000 description 29
- 238000003199 nucleic acid amplification method Methods 0.000 description 29
- 108020004707 nucleic acids Proteins 0.000 description 28
- 102000039446 nucleic acids Human genes 0.000 description 28
- 150000007523 nucleic acids Chemical class 0.000 description 28
- 239000013612 plasmid Substances 0.000 description 16
- 108020004414 DNA Proteins 0.000 description 13
- 241000282898 Sus scrofa Species 0.000 description 13
- 208000007407 African swine fever Diseases 0.000 description 12
- 241001135549 Porcine epidemic diarrhea virus Species 0.000 description 10
- 241000701093 Suid alphaherpesvirus 1 Species 0.000 description 9
- 238000000605 extraction Methods 0.000 description 9
- 241000710777 Classical swine fever virus Species 0.000 description 8
- 241001135989 Porcine reproductive and respiratory syndrome virus Species 0.000 description 8
- 238000006243 chemical reaction Methods 0.000 description 8
- 208000015181 infectious disease Diseases 0.000 description 8
- 210000001519 tissue Anatomy 0.000 description 7
- 241000282887 Suidae Species 0.000 description 6
- 238000003752 polymerase chain reaction Methods 0.000 description 6
- 238000010790 dilution Methods 0.000 description 5
- 239000012895 dilution Substances 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 238000012360 testing method Methods 0.000 description 5
- 101150062179 II gene Proteins 0.000 description 4
- 241001465754 Metazoa Species 0.000 description 4
- 210000004369 blood Anatomy 0.000 description 4
- 239000008280 blood Substances 0.000 description 4
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 4
- 238000002474 experimental method Methods 0.000 description 4
- 238000011144 upstream manufacturing Methods 0.000 description 4
- 108091092584 GDNA Proteins 0.000 description 3
- 101150017040 I gene Proteins 0.000 description 3
- 108020005202 Viral DNA Proteins 0.000 description 3
- 108020000999 Viral RNA Proteins 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 210000001124 body fluid Anatomy 0.000 description 3
- 239000010839 body fluid Substances 0.000 description 3
- 238000010805 cDNA synthesis kit Methods 0.000 description 3
- 239000002299 complementary DNA Substances 0.000 description 3
- 201000010099 disease Diseases 0.000 description 3
- 230000008014 freezing Effects 0.000 description 3
- 238000007710 freezing Methods 0.000 description 3
- 238000000227 grinding Methods 0.000 description 3
- 239000004570 mortar (masonry) Substances 0.000 description 3
- 210000000214 mouth Anatomy 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- 238000010257 thawing Methods 0.000 description 3
- 238000005303 weighing Methods 0.000 description 3
- 101710121996 Hexon protein p72 Proteins 0.000 description 2
- 101710125418 Major capsid protein Proteins 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 238000011217 control strategy Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 210000001165 lymph node Anatomy 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000000405 serological effect Effects 0.000 description 2
- 238000011895 specific detection Methods 0.000 description 2
- 229960005486 vaccine Drugs 0.000 description 2
- 241001533384 Circovirus Species 0.000 description 1
- 208000035473 Communicable disease Diseases 0.000 description 1
- 206010011703 Cyanosis Diseases 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 238000012286 ELISA Assay Methods 0.000 description 1
- 241000202347 Porcine circovirus Species 0.000 description 1
- 101710144681 Protein B602L Proteins 0.000 description 1
- 230000001154 acute effect Effects 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 230000000740 bleeding effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 239000012470 diluted sample Substances 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000011841 epidemiological investigation Methods 0.000 description 1
- 230000008029 eradication Effects 0.000 description 1
- 208000021760 high fever Diseases 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 231100000518 lethal Toxicity 0.000 description 1
- 230000001665 lethal effect Effects 0.000 description 1
- 231100000053 low toxicity Toxicity 0.000 description 1
- 230000008520 organization Effects 0.000 description 1
- 210000002741 palatine tonsil Anatomy 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000010839 reverse transcription Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 238000010206 sensitivity analysis Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000003239 susceptibility assay Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
- 210000001835 viscera Anatomy 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a dual fluorescent quantitative PCR detection primer, a probe and a kit for identifying type I and type II African swine fever viruses, wherein the nucleotide sequence of the dual fluorescent quantitative PCR detection primer is shown as SEQ ID NO 1-2 and 4-5. And further establishes a detection method and a detection kit. The method has strong specificity and no cross reaction with other viruses; high sensitivity, and the lowest copy number of detection is 1.07 x 102copies/. mu.L and 3.13X 104copies/. mu.L; the repeatability is good, and the Ct value variation coefficients are all less than 2%; the detection result of the method is consistent with that of the fluorescence quantitative PCR method recommended by OIE. The dual fluorescence quantification established by the inventionPCR provides a rapid detection method for identifying gene type I and gene type II ASFV, and is beneficial to perfecting the high-efficiency prevention and control measures established by China for ASF.
Description
Technical Field
The invention relates to the technical field of detection of African swine fever, in particular to a dual-fluorescence quantitative PCR detection primer, a probe and a kit for identifying genotype I and genotype II African swine fever viruses.
Background
African Swine Fever (ASF) is an acute, lethal, highly contagious disease in pigs caused by African Swine Fever Virus (ASFV). It is clinically characterized by high fever, cyanosis of the skin, severe bleeding of lymph nodes and internal organs, etc., with a mortality rate of up to 100%. In 1921, ASF was first reported in east non-kenyan and ASFV was divided into 24 genotypes according to the 3' end sequence of the B646L gene encoding the major capsid protein p 72. During the first decades, ASFVs of various genotypes have been prevalent in African areas until 1957, genotype I was first discovered in extra-African portugal teeth and was reported successively in Europe, south America, the Caribbean Islands, West Africa, east Africa and south Africa. In 2007, genotype II spread from southeast Africa to the Russian Caucasian region, and then became popular in more than 30 countries and regions of Europe, Asia, and south America, causing enormous economic losses to the swine industry in these countries.
Since 8 months in 2018 the gene II ASFV is introduced into China, large-scale ASFV outbreaks occur in China, in 2020 and 8 months, the laboratory firstly detects and separates the gene I ASFV in a pig in vivo, and then two low-toxicity and high-efficiency spread gene I ASFVs are reported in China, so that the diagnosis, prevention and control of ASF diseases are more challenging. Therefore, it is necessary to differentiate genotype I and genotype II ASFVs before any strict control strategy is established. Since there is no effective vaccine against ASF currently on the market, control of the disease relies on biosafety control, rapid detection and culling of infected animals. Currently, there are a number of molecular and serological methods available for identifying animals infected with an ASFV, serological assays for determining whether an animal has been exposed to an ASFV, molecular assays that detect the presence of an ASFV in pigs before clinical symptoms appear, and PCR and ELISA assays are the most common diagnostic methods for detecting antigens or antibodies (Abad et al, 1998; Fern a. ndez et al, 2013; King et al, 2003; Tignon et al, 2011). The world animal health Organization (OIE) proposed the use of validated fluorogenic quantitative PCR methods for diagnosing ASF (Fern-ndez et al, 2013; King et al, 2003; Ag ü Ero et al, 2003) which are rapid, highly sensitive and specific compared to traditional PCR (Fern-ndez et al, 2013; King et al, 2003). A plurality of fluorescent quantitative PCR diagnosis methods for ASFV detection are developed and verified on the market currently, most of them are directed to B646L gene (Fern & fractional al., 2013; Tignon et al., 2011; Wang et al., 2020; Zsak et al.,2006) and are only used for detection of ASFV positive infection. The genes type I and type II African swine fever virus cannot be effectively distinguished.
It has been shown that, in addition to the B646L gene encoding protein p72, Tandem Repeats (TRS) of the Central Variable Region (CVR) within the B602L gene (Gallardo et al, 2009; Lubibi et al, 2009; Nix et al, 2020) and the E183L gene encoding p54 protein are also target genes for studying genotype diversity of ASFV strains in ASF molecular epidemiology, and by combining the B646L, E183L and pB602L gene sequences, more data support can be provided for typing of ASFV viruses (Gallardo et al, 2009; bases et al, 2004; Wilkinson et al, 2000). Further studies have shown that detection of the E183L gene sequence is a valuable additional genotyping method that can be used in molecular epidemiological studies to identify genotype i ASFV (Carmina et al, 2009). However, the above studies are all methods of sequencing using genes, and genotyping viruses by combining the gene sequences, but there is no fluorescent quantitative PCR detection method for distinguishing genotype I and genotype II ASFV infections. Moreover, because most of the B602L gene is a repetitive sequence, the designed fluorescent quantitative PCR primer can not carry out specific amplification,
since there is no efficient commercial vaccine for ASF, control and eradication strategies are based primarily on early screening of ASFV and the implementation of strict biosafety control measures, laboratories must have rapid and sensitive detection procedures, and identification of strain genotypes is critical to measures to control and eradicate ASF.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a dual-fluorescence quantitative PCR detection primer, a probe and a kit for identifying African swine fever viruses of genes I and II.
Compared with the gene I, the gene E183L of the gene II ASFV lacks a complete sequence, so that the fluorescent quantitative PCR primer for specifically amplifying the gene I ASFV E183L can be designed. Therefore, aiming at the epidemic situation of the gene I type ASFV strain and the gene II type ASFV strain existing in China, the invention screens out the fluorescent quantitative PCR primer of the specific amplification gene I type ASFV E183L gene by comparing a plurality of gene sequences, and is used for developing the dual fluorescent quantitative PCR detection primer and the kit for identifying the gene I type African swine fever virus and the gene II type African swine fever virus according to B646L and E183L. Is used for identifying the prior gene I and gene II ASFV strains in China. If only B646L gene is detected, the detection sample is a genotype II strain, and if B646L and E183L genes are detected simultaneously, the detection sample is genotype I infection. The method can simultaneously detect ASFV of type I and type II genes existing in China through two pairs of primers and two probes. The universal primer and the probe of the B646L gene are used, so that the gene is used for judging whether a sample is infected by ASFV; primers and probes for the E183L gene are specific for genotype I, so the method distinguishes genotype I and II strains by specifically amplifying the E183L gene. The test sample can be judged to be ASFV-positive only when the B646L gene is detected, and negative otherwise.
The specific detection of the method shows that the primers and the probes used in the method can not generate cross reaction with other common porcine viruses in a pig farm. In this detection method, B646L and E183L detectionThe minimum copy number of (A) is 1.07X 102copies/. mu.L and 3.13X 104The copies/mu L, and the established standard curve has good linear relation, and the experimental data is real and reliable. Meanwhile, 284 clinical samples of pigs are detected by using the double fluorescent quantitative PCR detection method, and 7 ASFV positive samples are found, which is consistent with the detection method recommended by OIE. Therefore, the establishment of the detection method provides a powerful tool for identifying the genotype of the existing ASFV strain in China, so as to more accurately evaluate the origin and the propagation track of the ASFV outbreak in an epidemic area, establish a solid foundation for the epidemiological investigation of the ASFV and the prevention and control of epidemic diseases, and play a key role in the prevention and control strategy of China on the ASFV.
The first purpose of the invention is to provide a fluorescent quantitative PCR detection primer for identifying the African swine fever virus of genotype I and genotype II.
The second purpose of the invention is to provide a combination of fluorescence quantitative PCR detection primers and probes for identifying the African swine fever viruses of types I and II.
The third purpose of the invention is to provide the application of the fluorescent quantitative PCR detection primer in the preparation of a kit for identifying the African swine fever viruses of genes I and II.
The fourth purpose of the invention is to provide the application of any one of the compositions in preparing a kit for identifying African swine fever viruses of genes I and II.
The fifth purpose of the invention is to provide a kit for identifying the African swine fever virus type I and type II genes.
A sixth object of the present invention to provide
In order to achieve the purpose, the invention is realized by the following scheme:
the invention claims a fluorescent quantitative PCR detection primer for identifying African swine fever viruses of genes I and II, and nucleotide sequences of the primer are shown as SEQ ID NO 1-2 and 4-5.
The invention further claims a composition of a fluorescent quantitative PCR detection primer and a probe for identifying the African swine fever viruses of the genes I and II, which contains the fluorescent quantitative PCR detection primer.
Preferably, the kit also comprises probes with nucleotide sequences shown as SEQ ID NO. 3 and 6.
More preferably, probes with nucleotide sequences shown in SEQ ID NO 3 and 6 have different fluorescent groups modified at the 5 'end and different quenching groups modified at the 3' end.
More preferably, the probe with the nucleotide sequence shown in SEQ ID NO. 3 is modified with a fluorescent group FAM at the 5 'end and a quenching group MGB at the 3' end; the probe with the nucleotide sequence shown as SEQ ID NO. 6 has a 5 'end modified with a fluorescent group HEX and a 3' end modified with a quenching group BHQ 1.
The invention also claims application of the fluorescent quantitative PCR detection primer in preparation of a kit for identifying the African swine fever viruses of the genes I and II.
The invention also claims the application of any one of the compositions in preparing a kit for identifying the African swine fever viruses of genes I and II.
The invention also claims a kit for identifying the African swine fever viruses of genes I and II, which contains the fluorescent quantitative PCR detection primer or any one of the compositions.
Preferably, the kit also contains fluorescent quantitative PCR reagents and/or water.
More preferably, the fluorescent quantitative PCR reagent is 2 × AceQ Universal U+Probe Master Mix V2。
Most preferably, the dual fluorescent quantitative PCR detection kit for identifying African swine fever virus type I and type II genes comprises: the primer and probe with nucleotide sequences shown in SEQ ID NO 1 to 6, the 5 'end modifying group of the B646L gene detection probe (SEQ ID NO 3) is FAM, and the 3' end quenching group is MGB; the 5 'end modifying group of the E183L gene detecting probe (SEQ ID NO:6) is HEX, the 3' end quenching group is BHQ1, and the specific information is as follows:
B646L upstream primer: ATAGAGATACAGCTCTTCCAG (SEQ ID NO:1),
B646L downstream primer: GTATGTAAGAGCTGCAGAAC (SEQ ID NO:2),
probe B646L: FAM-TATCGATAAGATTGAT-MGB (SEQ ID NO:3),
E183L upstream primer: CGCGAGTGCTCATCCGACT (SEQ ID NO:4),
E183L downstream primer: GCTTCACAAACAATGTCGGCT (SEQ ID NO:5),
probe E183L: HEX-CATCCGACTGAGCCTTACACGACAGTCACT-BHQ1(SEQ ID NO: 6).
Also included were fluorescent quantitative PCR reagents (2 × AceQ Universal U + Probe Master Mix V2, Vazyme, China), DEPC H2O.
The using method comprises the following steps: 1. extraction of sample nucleic acid
Weighing 0.1g of tissue sample, adding 1mL of PBS under low temperature, grinding with a mortar and repeatedly freezing and thawing for three times, infiltrating a mouth swab with 1mL of PBS, centrifuging at 1000 Xg 4 ℃ for 5min, and taking the supernatant. Nucleic acid extraction was performed on blood, tissues and mouth swabs using the Axyprep Body Fluid Viral DNA/RNA Miniprep Kit nucleic acid extraction Kit (Axygen, China). The extracted nucleic acid was subjected to cDNA retrieval using HiScript II 1st Strand cDNA Synthesis Kit (+ gDNA wiper) inversion Kit (Vazyme, China), and stored at-80 ℃ until use.
2. Dual fluorescent quantitative PCR reaction system and conditions
Performing double fluorescent quantitative PCR detection and analysis by using ExCycle-48 real-time fluorescent quantitative PCR instrument (GinX, China), and simultaneously setting blank control, and reacting amplification system such as
2×AceQ Universal U+Probe Master Mix V210.0μL，B646L-F(SEQ ID NO:1)0.4μL，B646L-R(SEQ ID NO:2)0.4μL，B646L-Probe(SEQ ID NO:3)0.2μL，E183L-F(SEQ ID NO:4)0.4μL，E183L-R(SEQ ID NO:5)0.4μL，E183L-Probe(SEQ ID NO:6)0.2μL，Template DNA 2μL，DEPC H2O make up to 20. mu.L.
PCR reaction procedure: 2min at 37 ℃; 5min at 95 ℃; 10s at 95 ℃, 30s at 60 ℃ and 40 cycles.
If an amplification curve appears in the FAM channel, the detection sample is ASFV positive infection; and if an amplification curve appears in the HEX channel, the detected sample is infected by ASFV with genotype I.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides and establishesA dual fluorescent quantitative PCR detection primer and a probe for identifying the African swine fever virus type I and type II based on B646L and E183L genes are provided, and a detection method and a detection kit are further established, wherein the method can distinguish the ASFV type I and the ASFV type II through the primer and the probe of a specific amplification gene type I E183L. The method has strong specificity, can simultaneously detect ASFV B646L and E183L genes, and has no cross reaction with Porcine Epidemic Diarrhea Virus (PEDV), porcine circovirus, porcine reproductive and respiratory syndrome virus and porcine pseudorabies virus; the dual fluorescent quantitative PCR detection results of the gene I type ASFV DNA and the gene II type ASFV DNA both have a B646L amplification curve, only the gene I type ASFV DNA has an E183L amplification curve, which is consistent with the expectation; the sensitivity is high, and the minimum detection copy number of the method to recombinant plasmids pUC57-B646L and pCAGGS-E183L is 1.07 x 10 respectively2copies/. mu.L and 3.13X 104copies/. mu.L; the repeatability is good, and the Ct value variation coefficients detected by the two recombinant plasmids are less than 2 percent; the method and the fluorescent quantitative PCR recommended by OIE are used for carrying out parallel detection on 284 samples, the result shows that 7 samples are positive, 277 samples are negative, and the detection results of the two methods are consistent. The double fluorescent quantitative PCR established by the research provides a rapid detection method for identifying gene I and gene II ASFV, and is beneficial to perfecting the high-efficiency prevention and control measures made by China for ASF.
Drawings
FIG. 1 shows the FAM channel amplification curve of gene I type ASFV, gene II type ASFV, mixed sample of gene I and II type ASFV, and negative pig nucleic acid double fluorescent quantitative PCR detection.
FIG. 2 shows HEX channel amplification curves of ASFV type I gene, ASFV type II gene, ASFV type I and type II gene mixed sample and negative pig nucleic acid double fluorescent quantitative PCR detection.
FIG. 3 is a FAM channel amplification curve of double fluorescent quantitative PCR detection of genotype I ASFV, genotype II ASFV, PEDV, PRRSV, PRV, PCV-2, CSFV and negative pig nucleic acid.
FIG. 4 is a HEX channel amplification curve of double fluorescent quantitative PCR detection of genotype I ASFV, genotype II ASFV, PEDV, PRRSV, PRV, PCV-2, CSFV and negative pig nucleic acid.
FIG. 5 shows the detection of dual fluorescent quantitative PCR sensitivity. A.B646L gene sensitivity test; e183L gene sensitivity assay.
FIG. 6 shows the establishment of a double fluorescence quantitative PCR standard curve. A. Standard curve for plasmid pUC57-B646L, y-3.258 x +41.69, R20.994; B. standard curve for plasmid pCAGGS-E183L, y ═ 3.639x +48.47, R2＝0.997。
FIG. 7 shows the results of detection of 284 swine field clinical samples, wherein A is a FAX channel amplification curve of dual fluorescence quantitative PCR detection, 1-7 are 7 ASFV positive samples, and NC is a negative control; and B is a HEX channel amplification curve detected by double fluorescence quantitative PCR, 284 samples are negative to genotype I ASFV, and NC is negative control.
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Viruses, viral nucleic acids, plasmids and clinical samples:
the ASFV nucleic acid type I gene, the ASFV nucleic acid type II gene, the Porcine Epidemic Diarrhea Virus (PEDV), the Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), the pseudorabies virus (PRV), the circovirus type 2 (PCV-2), the Classical Swine Fever Virus (CSFV), the recombinant plasmid pUC57-B646L (the B646L gene fragment of the ASFV type II gene is inserted into the pU57 unloaded plasmid) and the pCAGGS-E183L (the E183L gene fragment of the ASFV type I gene is inserted into the pCAGGS unloaded plasmid) are preserved in the infectious disease research laboratory of the college of veterinary medicine of southern agriculture university of China. 284 clinical samples were tested from a pig farm in Guangdong province, 178 of which were porcine anticoagulated blood, 56 of which were porcine mouth swabs, 27 of which were porcine tonsils, 23 of which were porcine lymph nodes.
EXAMPLE 1 preparation of primers and probes
Primer probes for the B646L gene and the E183L gene were designed and synthesized, all of which were synthesized by Thermo corporation, and Table 1 shows the sequences of the synthesized primer probes and the sizes of the amplified fragments.
Table 1 primers and probes:
wherein, the primer probe of the B646L gene is ASFV detection primer (SEQ ID NO: 1-2) and probe (SEQ ID NO:3) recommended by CADC, and the size of the amplified fragment is 159 bp; the primer probe of the E183L gene uses the Oigo7 software to design detection primers (SEQ ID NO: 4-5) and probes (SEQ ID NO:6) in the type I specific region of the gene according to the sequence published by GenBank, and the amplified fragment size is 73 bp. GenBank accession numbers of the B646L and E183L genes are GZ201801.1 and NC _001659.2, respectively.
The 5 'end modifying group of the B646L gene detecting probe (SEQ ID NO:3) is FAM, and the 3' end quenching group is MGB; the 5 'end modifying group of the E183L gene detecting probe (SEQ ID NO:6) is HEX, and the 3' end quenching group is BHQ 1.
Example 2 specific detection of primers and probes
First, experiment method
Extracting nucleic acid from PEDV, PRRSV, PRV, PCV-2, CSFV and SPF negative pig tissues and carrying out reverse transcription, detecting the nucleic acid of genotype I ASFV, genotype II ASFV, PEDV, PRRSV, PRV, PCV-2, CSFV and negative pig by using the primer and the probe of example 1 and using a double fluorescence quantitative PCR method, and carrying out specificity verification on the primer and the probe for double fluorescence quantitative PCR detection.
1. Extraction of sample nucleic acid
Weighing 0.1g of tissue sample, adding 1mL of PBS under low temperature, grinding with a mortar and repeatedly freezing and thawing for three times, infiltrating a mouth swab with 1mL of PBS, centrifuging at 1000 Xg 4 ℃ for 5min, and taking the supernatant. Nucleic acid extraction was performed on blood, tissues and mouth swabs using the Axyprep Body Fluid Viral DNA/RNA Miniprep Kit nucleic acid extraction Kit (Axygen, China). The extracted nucleic acid was subjected to cDNA retrieval using HiScript II 1st Strand cDNA Synthesis Kit (+ gDNA wiper) inversion Kit (Vazyme, China), and stored at-80 ℃ until use.
2. Dual fluorescent quantitative PCR reaction system and conditions
2 × AceQ Universal U Using fluorescent quantitative PCR kit+The Probe Master Mix V2(Vazyme, China) is used for detecting a sample, an Excycler-48 real-time fluorescent quantitative PCR instrument (GinX, China) is used for carrying out double fluorescent quantitative PCR detection and analysis, and a template is DEPCH2Blank control of O, amplification system of the reaction is shown in Table 2.
Table 2 fluorescent quantitative PCR amplification system:
PCR reaction procedure: 2min at 37 ℃; 5min at 95 ℃; 10s at 95 ℃, 30s at 60 ℃ and 40 cycles.
Second, experimental results
Performing double fluorescence quantitative PCR detection on gene I type ASFV, gene II type ASFV, mixed sample of gene I type and II type ASFV and nucleic acid of negative pig, wherein an amplification curve appears in FAM channel of gene I type ASFV, gene II type ASFV and mixed sample of gene I type and II type ASFV (figure 1); HEX channel appearance amplification curves for genotype I ASFV and mixed genotype I and II ASFV samples (FIG. 2).
The description shows that no matter the gene type I ASFV or the gene type II ASFV, the FAM channel for detecting the B646L gene has an amplification curve as long as the ASFV exists; however, only when genotype I exists, the HEX channel of the E183L gene is detected to generate an amplification curve, and the infection of the genotype I ASFV strain can be identified.
And performing a specificity test of double fluorescent quantitative PCR detection by taking nucleic acids of the gene I type ASFV, the gene II type ASFV, PEDV, PRRSV, PRV, PCV-2, CSFV and negative pigs as templates, wherein the nucleic acids of the PEDV, PRRSV, PRV, PCV-2, CSFV and the negative pigs have no amplification curve in FAM and HEX channels, and the result is negative. The amplification curves of the FAM channel of the gene I type ASFV and gene II type ASFV nucleic acid samples (FIG. 3), and the amplification curve of the HEX channel of the gene I type ASFV nucleic acid samples (FIG. 4). The double fluorescent quantitative PCR detection method based on the B646L and E183L genes has no cross reaction on nucleic acids of other common porcine viruses, can distinguish the infection of ASFV strains of genotype I, and further verifies that the double fluorescent quantitative PCR method has good specificity.
Example 2 sensitivity detection and construction of Standard Curve
First, experiment method
The concentrations of recombinant plasmids pUC57-B646L and pCAGGS-E183L were measured using a spectrophotometer (Thermo NanoDrop Lite) at 335.1 ng/. mu.L and 183.13 ng/. mu.L, respectively. According to the DNA copy number calculation formula [ dsDNA copy number (copies/. mu.L). ] (6.02X 10)23(copies/mol). times.concentration (ng/. mu.L). times.10-9)/DNA length×660]The copy numbers of plasmids pUC57-B646L and pCAGGS-E183L are respectively as follows: 1.07X 1011copies/. mu.L and 3.13X 1010copies/. mu.L. The recombinant plasmid is diluted by 10 times of gradient, 10 times of gradient dilution is carried out-1、10-2、10-3、10-4、10-5、10-6、10-7、10-8、10-9The diluted plasmid was used as a standard template, and 3 replicates of each dilution were used for dual fluorescence quantitative PCR detection for sensitivity analysis and standard curve drawing, the specific dual fluorescence quantitative PCR method was the same as in example 1.
Second, experimental results
The recombinant plasmids pUC57-B646L and pCAGGS-E183L were subjected to 10-fold gradient dilution, followed by detection of fluorescence quantitative PCR sensitivity, and a standard curve was drawn using fluorescence quantitative analysis software. The results showed that the minimum copy amounts of pUC57-B646L and pCAGGS-E183L detected by fluorescent quantitative PCR were 1.07X 102copies/. mu.L and 3.13X 104The primers and the probes of the detection method have higher sensitivity on the detection of two genes (figure 5). The slopes of the standard curves of the two plasmids, pUC57-B646L and pCAGGS-E183L, were-3.258 and-3.639, respectively, and R of the standard curves was plotted2The values are 0.994 and0.997 (fig. 6), indicating that each diluted sample exhibits a good linear relationship.
Example 3 reproducibility test
First, experiment method
The dilution of the recombinant plasmids pUC57-B646L and pCAGGS-E183L in different gradients was used as an amplification template for double fluorescent quantitative PCR detection, each concentration was repeated 3 times, and the method of double fluorescent quantitative PCR was the same as that of example 1 to evaluate the repeatability.
And calculating a Coefficient of Variation (CV) according to the Ct value, wherein the CV is (standard deviation SD/Mean value Mean) multiplied by 100 percent, and verifying the repeatability of the established method.
Second, experimental results
A10-fold gradient dilution of recombinant plasmids pUC57-B646L and pCAGGS-E183L was subjected to a reproducibility test. And calculating according to the Ct value of the detection result. The intra-batch CV of pUC57-B646L is 0.40-1.88% (Table 3); the intra-batch CV of pCAGGS-E183L was 0.42 to 1.14% (Table 4); the interpatch CV of pUC57-B646L was 0.44-1.86% (Table 5); the interpatch CV of pCAGGS-E183L was 0.56 to 1.19% (Table 6). CV's are all less than 2%, indicating that the method has good repeatability.
TABLE 3 repeatability in batch for the double fluorescent quantitative PCR detection of B646L gene
Table 4: in-batch repeatability for detecting E183L gene by dual fluorescence quantitative PCR
Table 5: batch-to-batch repeatability for detecting B646L gene by dual fluorescence quantitative PCR
Table 6: batch-to-batch repeatability for detecting E183L gene by dual-fluorescence quantitative PCR (polymerase chain reaction)
Example 4 Dual fluorescent quantitative PCR detection kit for identifying African swine fever virus type I and type II genes
A, make up
The primer and probe with nucleotide sequences shown in SEQ ID NO 1 to 6, the 5 'end modifying group of the B646L gene detection probe (SEQ ID NO 3) is FAM, and the 3' end quenching group is MGB; the 5 'end modifying group of the E183L gene detecting probe (SEQ ID NO:6) is HEX, the 3' end quenching group is BHQ1, and the specific information is as follows:
B646L upstream primer: ATAGAGATACAGCTCTTCCAG (SEQ ID NO:1),
B646L downstream primer: GTATGTAAGAGCTGCAGAAC (SEQ ID NO:2),
probe B646L: FAM-TATCGATAAGATTGAT-MGB (SEQ ID NO:3),
E183L upstream primer: CGCGAGTGCTCATCCGACT (SEQ ID NO:4),
E183L downstream primer: GCTTCACAAACAATGTCGGCT (SEQ ID NO:5),
probe E183L: HEX-CATCCGACTGAGCCTTACACGACAGTCACT-BHQ1(SEQ ID NO: 6);
also contains fluorescent quantitative PCR reagent (2 x AceQ Universal U)+Probe Master Mix V2，Vazyme,China)，DEPC H2O。
Second, the application method
1. Extraction of sample nucleic acid
Weighing 0.1g of tissue sample, adding 1mL of PBS under low temperature, grinding with a mortar and repeatedly freezing and thawing for three times, infiltrating a mouth swab with 1mL of PBS, centrifuging at 1000 Xg 4 ℃ for 5min, and taking the supernatant. Nucleic acid extraction was performed on blood, tissues and mouth swabs using the Axyprep Body Fluid Viral DNA/RNA Miniprep Kit nucleic acid extraction Kit (Axygen, China). The extracted nucleic acid was subjected to cDNA retrieval using HiScript II 1st Strand cDNA Synthesis Kit (+ gDNA wiper) inversion Kit (Vazyme, China), and stored at-80 ℃ until use.
2. Double fluorescent quantitative PCR reaction system and conditions
The double fluorescent quantitative PCR detection and analysis are carried out by using an ExCycle-48 real-time fluorescent quantitative PCR instrument (GinX, China), a blank control is set, and the amplification system of the reaction is shown in Table 2.
Table 2 fluorescent quantitative PCR amplification system:
PCR reaction procedure: 2min at 37 ℃; 5min at 95 ℃; 10s at 95 ℃, 30s at 60 ℃ and 40 cycles.
Third, interpretation of results
If an amplification curve appears in the FAM channel, the detection sample is ASFV positive infection; and if an amplification curve appears in the HEX channel, the detection sample is infected by ASFV with genotype I.
EXAMPLE 5 detection of clinical samples
First, experiment method
284 clinical samples from a pig farm in Guangdong province were tested using the kit of example 4.
Second, experimental results
The result shows that 7 positive samples are detected by the ASFV B646L and E183L gene-based double fluorescent quantitative PCR kit in example 4, and the rest 277 samples are negative, which is consistent with the detection result of the fluorescent quantitative PCR method recommended by OIE. And after the detection is finished, carrying out high-temperature and high-pressure treatment on the sample according to the biosafety operation specification.
In the detection results of 7 ASFV positive samples, only the FAM channel showed the amplification curve of B646L gene, indicating that the 7 positive samples are all clinical samples infected by genotype II (FIG. 7). 7 ASFV positive samples were collected from 3 ASF-infected pigs (published cases in the department of agricultural rural development, published information in the district of Shanghai, Zhuhai, Guangdong, http:// www.moa.gov.cn/gk/yjgl _1/yqfb/201812/t20181219_6165233.htm), and nucleic acids thereof were prepared and stored by the national African swine fever regional laboratory (Guangzhou).
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention and not to limit the scope of the present invention, and that those skilled in the art can make other variations or modifications on the basis of the above description and idea, and that all embodiments are neither necessary nor exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> dual fluorescent quantitative PCR detection primers, probes and kit for identifying type I and type II African swine fever viruses
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atagagatac agctcttcca g 21
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cgcgagtgct catccgact 19
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gcttcacaaa caatgtcggc t 21
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
catccgactg agccttacac gacagtcact 30
Claims (10)
1. A fluorescent quantitative PCR detection primer for identifying gene I and gene II African swine fever viruses is characterized in that the nucleotide sequence is shown as SEQ ID NO 1-2 and 4-5.
2. A fluorescent quantitative PCR detection primer and probe composition for identifying African swine fever virus type I and type II genes, which is characterized by comprising the fluorescent quantitative PCR detection primer according to claim 1.
3. The composition of claim 2, further comprising probes having nucleotide sequences shown in SEQ ID NOs 3 and 6.
4. The composition of claim 3, wherein the probes having the nucleotide sequences shown in SEQ ID NO 3 and 6 have different fluorophores modified at the 5 'end and different quenchers modified at the 3' end.
5. The composition of claim 3, wherein the probe has a nucleotide sequence shown in SEQ ID NO. 3, and the 5 'end is modified with a fluorescent group FAM and the 3' end is modified with a quenching group MGB; the probe with the nucleotide sequence shown as SEQ ID NO. 6 has a 5 'end modified with a fluorescent group HEX and a 3' end modified with a quenching group BHQ 1.
6. The use of the fluorescent quantitative PCR detection primer of claim 1 in the preparation of a kit for identifying African swine fever viruses of genotype I and genotype II.
7. Use of a composition according to any one of claims 2 to 5 in the manufacture of a kit for identifying the genotypes i and ii african swine fever virus.
8. A kit for identifying the genotypes i and ii african swine fever virus, comprising the fluorescent quantitative PCR detection primer of claim 1 or the composition of any one of claims 2 to 5.
9. The kit of claim 8, further comprising a fluorescent quantitative PCR reagent and/or water.
10. The kit of claim 9, wherein the fluorescent quantitative PCR reagent is 2 xcaeq Universal U+Probe Master Mix V2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210190570.6A CN114592090B (en) | 2022-02-28 | 2022-02-28 | Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying genes I and II of African swine fever virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210190570.6A CN114592090B (en) | 2022-02-28 | 2022-02-28 | Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying genes I and II of African swine fever virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114592090A true CN114592090A (en) | 2022-06-07 |
| CN114592090B CN114592090B (en) | 2024-01-30 |
Family
ID=81815215
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210190570.6A Active CN114592090B (en) | 2022-02-28 | 2022-02-28 | Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying genes I and II of African swine fever virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114592090B (en) |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101463396A (en) * | 2009-01-06 | 2009-06-24 | 天津出入境检验检疫局动植物与食品检测中心 | African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof |
| CN106947838A (en) * | 2017-05-31 | 2017-07-14 | 广东出入境检验检疫局检验检疫技术中心 | African swine fever virus nonstructural gene real-time fluorescence LAMP detection primer group, kit and detection method |
| CN110628956A (en) * | 2019-11-08 | 2019-12-31 | 青岛立见诊断技术发展中心 | Dual-fluorescence PCR primer and kit for identifying ASFV strain and CD2v gene deletion strain |
| CN111218528A (en) * | 2020-03-11 | 2020-06-02 | 山东省滨州畜牧兽医研究院 | PCR primer group and kit for detecting African swine fever virus based on double genes and application |
| CN111893210A (en) * | 2019-05-06 | 2020-11-06 | 中国农业科学院北京畜牧兽医研究所 | LAMP-TaqMan rapid detection kit for African swine fever virus and application |
| CN112342319A (en) * | 2021-01-08 | 2021-02-09 | 北京市动物疫病预防控制中心 | Primer combination, probe combination and application thereof in porcine virus detection, detection reagent, kit and detection method |
| CN112646934A (en) * | 2021-01-21 | 2021-04-13 | 华南农业大学 | Triple fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit for identifying African swine fever wild strains and gene deletion strains |
| CN112831597A (en) * | 2019-11-22 | 2021-05-25 | 洛阳普泰生物技术有限公司 | Real-time fluorescent PCR amplification primer pair and probe primer for gene identification and detection of African swine fever virus and prepared kit |
| CN113215110A (en) * | 2021-05-13 | 2021-08-06 | 华南农业大学 | Method for improving multiplication capacity of African swine fever virus |
-
2022
- 2022-02-28 CN CN202210190570.6A patent/CN114592090B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101463396A (en) * | 2009-01-06 | 2009-06-24 | 天津出入境检验检疫局动植物与食品检测中心 | African hog cholera virus fluorescent quantitative PCR detecting reagent and preparation and use thereof |
| CN106947838A (en) * | 2017-05-31 | 2017-07-14 | 广东出入境检验检疫局检验检疫技术中心 | African swine fever virus nonstructural gene real-time fluorescence LAMP detection primer group, kit and detection method |
| CN111893210A (en) * | 2019-05-06 | 2020-11-06 | 中国农业科学院北京畜牧兽医研究所 | LAMP-TaqMan rapid detection kit for African swine fever virus and application |
| CN110628956A (en) * | 2019-11-08 | 2019-12-31 | 青岛立见诊断技术发展中心 | Dual-fluorescence PCR primer and kit for identifying ASFV strain and CD2v gene deletion strain |
| CN112831597A (en) * | 2019-11-22 | 2021-05-25 | 洛阳普泰生物技术有限公司 | Real-time fluorescent PCR amplification primer pair and probe primer for gene identification and detection of African swine fever virus and prepared kit |
| CN111218528A (en) * | 2020-03-11 | 2020-06-02 | 山东省滨州畜牧兽医研究院 | PCR primer group and kit for detecting African swine fever virus based on double genes and application |
| CN112342319A (en) * | 2021-01-08 | 2021-02-09 | 北京市动物疫病预防控制中心 | Primer combination, probe combination and application thereof in porcine virus detection, detection reagent, kit and detection method |
| CN112646934A (en) * | 2021-01-21 | 2021-04-13 | 华南农业大学 | Triple fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit for identifying African swine fever wild strains and gene deletion strains |
| CN113215110A (en) * | 2021-05-13 | 2021-08-06 | 华南农业大学 | Method for improving multiplication capacity of African swine fever virus |
Non-Patent Citations (3)
| Title |
|---|
| CARMINA GALLARDO 等: "Enhanced discrimination of African swine fever virus isolates through nucleotide sequencing of the p54, p72, and pB602L (CVR) genes", 《VIRUS GENES》, vol. 38, no. 1, pages 86 * |
| JONAS THOROMO 等: "Diagnosis and genotyping of African swine fever viruses from 2015 outbreaks in Zambia", 《ONDERSTEPOORT JOURNAL OF VETERINARY RESEARCH》, vol. 83, no. 1, pages 2 * |
| THI BICH NGOC TRINH 等: "Development of a novel real-time PCR assay targeting p54 gene for rapid detection of African swine fever virus (ASFV) strains circulating in Vietnam", 《VETMED SCI.》, vol. 7, no. 6, pages 2268 - 2272 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114592090B (en) | 2024-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111004870B (en) | Novel coronavirus N gene nucleic acid detection kit | |
| CN111020064A (en) | Novel coronavirus ORF1ab gene nucleic acid detection kit | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN115279925A (en) | Novel dual detection kit for coronavirus | |
| Masuda et al. | Development of one-step real-time reverse transcriptase-PCR-based assays for the rapid and simultaneous detection of four viruses causing porcine diarrhea | |
| CN110735006A (en) | African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit | |
| CN117265186B (en) | TaqMan fluorescent quantitative PCR primer group, kit and method for detecting pangolin east yang virus | |
| CN112458208B (en) | Kit and method for detecting bovine sarcoidosis virus | |
| CN116814859A (en) | Primer probe composition, kit and method for identifying African swine fever virus genes I and II | |
| US20230250497A1 (en) | One-step nested pcr primers set and kit modified with locked nucleic acid for detecting african swine fever virus | |
| CN114085929B (en) | Kit for detecting African swine fever virus wild strain and vaccine strain | |
| CN113604609B (en) | Primer combination for detecting SARS-CoV-2 and D614G mutant strain thereof and application thereof | |
| CN116004925A (en) | Triple fluorescence PCR primer probe group, reagent and method for identifying wild strain and gene deletion strain of African swine fever virus | |
| CN114592090B (en) | Dual-fluorescence quantitative PCR detection primer, probe and kit for identifying genes I and II of African swine fever virus | |
| CN112626278B (en) | Primer and probe for identifying canine distemper virus wild strain and vaccine strain and application | |
| KR102346881B1 (en) | A kit for simultaneous diagnosis of coronavirus and influenza virus | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN113493850A (en) | PCR primer probe group and kit for real-time fluorescent quantitative detection of toxoplasma gondii and eperythrozoon of pig and detection method thereof | |
| CN111500777A (en) | Kit for detecting novel coronavirus nucleic acid based on fluorescence RT-PCR method | |
| CN111500773A (en) | Fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) primer, probe and kit for identifying serotype of epidemic hemorrhagic disease virus | |
| CN114752707B (en) | Primer probe group and application thereof, and kit for detecting African swine fever virus, swine fever virus and erysipelas | |
| CN116515840B (en) | Kit and detection method for detecting bovine viral diarrhea virus type 3 | |
| CN114262758B (en) | Kit for detecting novel coronavirus mutant strain and detection method | |
| KR102141369B1 (en) | Composition for detecting Severe Fever with Thrombocytopenia Syndrome viral RNA and method of diagnosing Severe Fever with Thrombocytopenia Syndrome using the same | |
| RU2731716C1 (en) | Kit for differentiating cattle pestiviruses and method for differentiating cattle pestiviruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |