CN114591933B - PET degrading enzyme mutant and application thereof - Google Patents

PET degrading enzyme mutant and application thereof Download PDF

Info

Publication number
CN114591933B
CN114591933B CN202210343406.4A CN202210343406A CN114591933B CN 114591933 B CN114591933 B CN 114591933B CN 202210343406 A CN202210343406 A CN 202210343406A CN 114591933 B CN114591933 B CN 114591933B
Authority
CN
China
Prior art keywords
ser
ala
gly
arg
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210343406.4A
Other languages
Chinese (zh)
Other versions
CN114591933A (en
Inventor
张友明
王晓彤
宋超逸
霍刘杰
李爱英
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong University
Original Assignee
Shandong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong University filed Critical Shandong University
Priority to CN202210343406.4A priority Critical patent/CN114591933B/en
Publication of CN114591933A publication Critical patent/CN114591933A/en
Application granted granted Critical
Publication of CN114591933B publication Critical patent/CN114591933B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
    • B09B—DISPOSAL OF SOLID WASTE NOT OTHERWISE PROVIDED FOR
    • B09B3/00—Destroying solid waste or transforming solid waste into something useful or harmless
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
    • Y02W30/00—Technologies for solid waste management
    • Y02W30/50—Reuse, recycling or recovery technologies
    • Y02W30/62—Plastics recycling; Rubber recycling

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Environmental & Geological Engineering (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

The invention belongs to the technical field of enzyme engineering, and relates to an enzyme mutant and application thereof. A PET degrading enzyme mutant is formed by mutating amino acid 132 of PETase 7029 of PET degrading enzyme from tryptophan to histidine, wherein the amino acid sequence of the mutant is shown as SEQ ID NO.3, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 11; the amino acid sequence of the PET degrading enzyme 7029PETase is shown as SEQ ID NO.1, and the nucleotide sequence of the gene is shown as SEQ ID NO. 9. Compared with the existing PET degrading enzyme, the PET degrading enzyme and the mutant thereof can degrade the PET enzyme at normal temperature, improve the degradation rate of commercial PET plastics and the monomer BHET thereof to a certain extent, and have good industrial prospect.

Description

PET degrading enzyme mutant and application thereof
Technical Field
The invention belongs to the technical field of enzyme engineering, and relates to an enzyme mutant and application thereof.
Background
Polyethylene terephthalate (polyethylene terephthalate, PET) is one type of plastic and is now widely used worldwide because of its high mechanical strength, low air permeability, light weight, low cost and the like. Meanwhile, the chemical inertness is difficult to degrade in a natural state, so that the chemical inertness is accumulated in a large amount in the environment, and serious environmental pollution is caused. Among the existing treatment methods for PET waste, the most commonly used is a mechanical recycling method, and although part of waste plastics are recycled, these processes cannot be used for recycling colored or opaque plastics, and these plastics usually finally enter a landfill or an incinerator, resulting in great resource waste and environmental pollution.
The diversity of microbial metabolism makes them extremely potential for environmental remediation, and many bacteria have been shown to produce certain hydrolases that degrade PET to varying degrees, but most of these hydrolases found to date require higher temperatures or are not efficient at normal temperatures. Therefore, if the efficient PET degrading enzyme under the normal temperature condition can be found or the mutant of the normal temperature PET degrading enzyme is obtained, the normal temperature degradation of PET plastic can be realized, and a tool is provided for the treatment of PET plastic waste under the energy-saving condition.
Disclosure of Invention
In view of the above problems in the prior art, the present invention aims to provide a degrading enzyme capable of effectively degrading PET plastics at normal temperature, and a mutant and application thereof.
The first technical scheme adopted for solving the technical problems is to provide a PET degrading enzyme: a PET degrading enzyme, the gene coding the enzyme is named 7029PETase, the amino acid sequence of the enzyme is shown as SEQ ID NO.1, and the nucleotide sequence of the gene is shown as SEQ ID NO. 9.
The second technical scheme adopted for solving the technical problems is to provide a PET degrading enzyme mutant, wherein the mutant is subjected to single-point or multi-point mutation at a substrate binding site of 7029PETase.
Furthermore, the mutant is formed by mutating the 61 st amino acid from leucine to threonine on 7029PETase, the amino acid sequence of the mutant is shown as SEQ ID NO.2, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 10.
Furthermore, the mutant is formed by mutating tryptophan at position 132 on 7029PETase into histidine, the amino acid sequence is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO. 11.
Furthermore, the mutant is formed by mutating the 259 th amino acid of 7029PETase from arginine to alanine, the amino acid sequence is shown as SEQ ID NO.4, and the nucleotide sequence is shown as SEQ ID NO. 12.
Furthermore, the mutant is formed by mutating the 61 st amino acid from leucine to threonine and mutating the 132 st amino acid from tryptophan to histidine on 7029PETase, the amino acid sequence is shown as SEQ ID NO.5, and the nucleotide sequence is shown as SEQ ID NO. 13.
Furthermore, the mutant is formed by mutating the 61 st amino acid from leucine to threonine and mutating the 259 rd amino acid from arginine to alanine on 7029PETase, the amino acid sequence is shown as SEQ ID NO.6, and the nucleotide sequence is shown as SEQ ID NO. 14.
Furthermore, the mutant is formed by mutating amino acid 132 from tryptophan to histidine and mutating amino acid 259 from arginine to alanine on 7029PETase, the amino acid sequence is shown as SEQ ID NO.7, and the nucleotide sequence is shown as SEQ ID NO. 15.
Furthermore, the mutant is formed by mutating the 61 st amino acid from leucine to threonine, mutating the 132 st amino acid from tryptophan to histidine and mutating the 259 rd amino acid from arginine to alanine on 7029PETase, the amino acid sequence is shown as SEQ ID NO.8, and the nucleotide sequence is shown as SEQ ID NO. 16.
The invention also provides a recombinant vector, which comprises the 7029PETase mutant.
The invention also provides a recombinant bacterium, which comprises the recombinant vector.
The invention also provides application of the PET degrading enzyme mutant in degrading PET plastics.
Compared with the existing PET degrading enzyme, the PET degrading enzyme and the mutant thereof can degrade the PET enzyme at normal temperature, improve the degradation rate of commercial PET plastics and the monomer BHET thereof to a certain extent, and have good industrial prospect.
Drawings
FIG. 1 is a predictive diagram of the degradation flow of the PET degrading enzyme 7029PETase to degrade commercial PET at ambient temperature (whether the substrate is PET plastic or its monomer BHET, reaction (2) is the primary reaction process, MHET is the primary reaction product);
FIG. 2 is a high performance liquid chromatogram of a wild type 7029PETase degrading commercial PET plastic degradation solution;
FIG. 3 is a schematic diagram of the exploration of 7029PETase optimal in vitro reaction conditions;
FIG. 4 is a predicted protein structure of 7029 PETase;
FIG. 5A is a comparison of the amount of MHET in the degradation products of each mutant using BHET as a substrate;
FIG. 5B is a comparison of the amount of TPA in the degradation products for each mutant using BHET as a substrate;
FIG. 5C is a comparison of the amount of MHET in the degradation products of each mutant using PET as a substrate;
FIG. 5D is a comparison of the amounts of BHET and TPA in the degradation products for each mutant using PET as a substrate.
Detailed Description
The PET degrading enzymes, mutants and applications of the present invention are described and illustrated in detail below with reference to the accompanying drawings and examples.
In the examples of the invention, the strain DSM7029 used in the experiment is purchased from DSMZ, the escherichia coli BL21 (DE 3) is purchased from Beijing Ding Guo Changsheng biotechnology Co., ltd, and the expression vector pET22b is purchased from Youbao organism
The reagent used is as follows:
the high-fidelity DNA polymerase primeSTAR MAX used for DNA amplification and the DNA marker used for agarose gel electrophoresis are purchased from Beijing Bao Ri doctor materials technology Co., ltd; the DNA endonuclease and Gibson assembly premix was purchased from New England Biolabs; agarose gel recovery kits were purchased from beijing tiangen biochemical technology limited.
The instrument used is as follows:
PCR amplification instrument (Eppendorf), high-speed refrigerated centrifuge (Eppendorf), agarose gel imaging system (biolab), high performance liquid chromatograph (shimadzu).
The present invention uses techniques and methods conventional in the fields of genetic engineering and molecular biology. Those skilled in the art may utilize other conventional techniques, methods and reagents in the art based on the embodiments provided herein and are not limited to the specific examples of the invention.
Example 1 Source of PET degrading enzyme 7029PETase and construction of heterologous expression vector in E.coli BL21 (DE 3)
By analyzing genome data in DSM7029 (ATCC 53080), a silenced gene is found in the genome, the amino acid sequence and the nucleic acid sequence of the silenced gene are compared with those of the reported PET degrading enzyme IsPETase to find that the silenced gene has certain homology, the amino acid sequence similarity is 64.3 percent, the nucleic acid sequence similarity is 72.6 percent, the enzyme coded by the gene is predicted to be PET degrading enzyme, the gene is named as 7029PETase, the amino acid sequence of the silenced gene is shown as SEQ ID NO.1, and the nucleotide sequence of the silenced gene is shown as SEQ ID NO. 9. Through heterologous expression and in vitro activity detection, the PET degrading enzyme 7029PETase has the capability of degrading commercial PET at normal temperature, and the degradation flow is shown in figure 1.
Using genomic DNA of DSM7029 as a template, using primers 7029-22b-1 and 7029-22b-2 with homology arms to amplify 7029PETase, and using agarose gel recovery kit to perform cut gel recovery on the target fragment; cutting and recovering the carrier fragment by using an Nco1 and Xho1 double enzyme cutting carrier pET22b and an agarose gel recovery kit; and (3) assembling the vector and the fragment by Gibson to obtain a recombinant expression vector pET22b-7029PETase of the wild 7029PETase.
The primer sequences used in the amplification process are as follows:
7029-22b-1：TCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCATGGAT
CAGACCAACCCCTACCAGCG，SEQ ID NO.17；
7029-22b-2：CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG
GTACGGGCAGCTCTCGCGGTACTC，SEQ ID NO.18。
wherein the underlined sequence indicates the homology arm moiety.
(1) The PCR procedure for fragment amplification was:
the pre-denaturation is carried out at 95 ℃ for 1 min, each cycle comprises 98 ℃ 10 s, 55 ℃ 15 s and 72 ℃ 20 s for 30 cycles, and finally the final extension is carried out at 72 ℃ for 10 min.
(2) The system of the double enzyme digestion of the Nco1 and the Xho1 is as follows:
nco 1:4. Mu.l, xho 1:4. Mu.l, cutmartbuffer:20. Mu.l, ddH2 O:92. Mu.l, plasmid: 80 μl,37 ℃,3 hours.
(3) Gibson assembly, transformation and identification:
150ng PCR amplified 7029PETase product fragment, 150ng vector pET22b double cut fragment, add ddH2O to make up 5. Mu.l, add 5. Mu.l Gibson premix and react at 50℃for 40min. Transferring the assembled solution after the reaction into escherichia coli DH5 alpha by a chemical conversion method, culturing overnight at 37 ℃, and picking up monoclonal enzyme digestion and sequencing identification. The identified correct recombinant vector was transformed into E.coli BL21 (DE 3) by chemical transformation and the recombinant strain was designated BL21-PETase for subsequent experiments.
Example 2: construction of PET degrading enzyme 7029PETase mutant
Site-directed mutagenesis is carried out on wild 7029PETase by utilizing an overlap PCR method, a recombinant vector pET22b-7029PETase of the wild 7029PETase is taken as a template, a front end coding sequence of the 7029PETase is amplified by using primers 7029-L61T-1 and 7029-22b-1, a rear end coding sequence and a terminator sequence of the 7029PETase are amplified by using primers 7029-L61T-2 and 7029-22b-2, and a nucleic acid sequence which causes the 61 th leucine to be mutated into threonine is introduced; finally, the product of overlap extension PCR is used as a template, and the coding sequence and the terminator sequence of the mutant are obtained by amplification using two primers, namely 7029-22b-1 and 7029-22 b-2. The PCR procedure used for the fragment amplification was the same as in example 1, and the resulting mutant was designated 7029PETase L61T The 7029PETase is formed by mutating 61 st amino acid from leucine to threonine, the amino acid sequence is shown as SEQ ID NO.2, and the nucleotide sequence is shown as SEQ ID NO. 10.
7029PETase was then constructed using the method in example 1 L61T Is identified as correct recombinant vectorThe vector was transformed into E.coli BL21 (DE 3) by chemical transformation and the recombinant strain was designated BL21-L61T for subsequent experiments.
Mutation methods of other mutants and 7029PETase L61T Similarly, the mutants obtained were designated 7029PETase, respectively W132H 、7029PETase R259A 、7029PETase L61T/W132H 、7029PETase W132H/R259A 、7029PETase L61T/R259A 、7029PETase L61T/W132H/R259A The method comprises the steps of carrying out a first treatment on the surface of the The recombinant strains constructed were named BL21-W132H, BL-R A, BL-L61T/W132H, BL-L61T/R259A, BL-W132H/R259A, BL-L61T/W132H/R259A, respectively.
The primer sequences used during the mutation were as follows:
7029-L61T-1：tgctggactggcgggcggtgtagccgggca，SEQ ID NO.19；
7029-L61T-2：accgcccgccagtccagcat，SEQ ID NO.20；
7029-W132H-1：ccgcctccgcccatcgaatggcccatcaccgc，SEQ ID NO.21；
7029-W132H-2：cattcgatgggcggaggcggca，SEQ ID NO.22；
7029-R259A-1：gccctctcggagtaccgcga，SEQ ID NO.23；
7029-R259A-2：cgcggtactccgagagggcgctgctgcgca，SEQ ID NO.24。
wherein the underlined section is the mutation region.
Example 3: expression purification of wild 7029PETase and mutant protein thereof
Expression purification procedure for wild type 7029PETase was as follows:
1) Streaking recombinant strain BL21-PETase on LB solid medium (containing 100 mug/ml of ampicillin) and culturing overnight at 37 ℃;
2) Selecting monoclonal bacteria in LB liquid culture medium (containing 50 mug/ml of ampicillin antibiotics), culturing at 37 ℃ at 200 rpm overnight;
3) Transferring the bacterial liquid obtained by overnight culture into 2L LB liquid culture medium (containing 50 mug/ml of ampicillin antibiotics) with an inoculum size of 1%, adding 0.1 mM IPTG for induction when the bacterial liquid is cultured at 37 ℃ and 200 rpm until the OD600 is about 0.8, and then continuously culturing at 18 ℃ and 200 rpm for 16-18 hours;
4) The bacterial solution was centrifuged (4500 rpm,15 min,4 ℃), the supernatant was discarded, and the cells were resuspended in 80 ml buffer A (50 mM Tris-HCl,300mM NaCl,10 mM imidozole, pH 7.6);
5) The bacterial body mass suspension was sonicated in an ice bath, the lysate was centrifuged (20000 rpm,25 min,4 ℃) to discard the precipitate, the supernatant was applied to a Ni column equilibrated with Buffer A, unbound protein was washed with Buffer A, and the target protein was eluted with Buffer B (50 mM Tris-HCl,300mM NaCl,250 mM imidazole, pH 7.6). The imidazole was then removed using a PD-10 gel column (GE Healthcare) and the protein was finally stored in Buffer C (50 mM Tris-HCl,300mM NaCl,10% glycerol, pH 7.6).
The expression purification method of 7029PETase mutant protein is the same as that of wild type.
Example 4:7029PETase optimal reaction conditions
To determine the optimal reaction conditions for 7029PETase, we measured its enzymatic activity at different pH (6.0-10.0) and temperature (25 ℃ -42 ℃). In 500. Mu.l of reaction buffer (pH 6.0-8.0, 50mM Na 2 HPO 4 -HCl; at pH 9.0-10.0, 50mM glycine-NaOH) was added to a concentration (200. 200 nM) of purified enzyme and incubated at a temperature of 18. 18 h. After that, the reaction was terminated by heat inactivation (80 ℃ C., 10 min), and the reaction solution was filtered through a 0.22 μm filter membrane, and the product was analyzed by HPLC. The optimum reaction pH of 7029PETase was different when the substrates were BHET and commercial PET plastic films, respectively, and the experimental results showed that the optimum reaction pH of 7029PETase was 7.0 (substrate was BHET, FIG. 3A) and 8.0 (substrate was PET, FIG. 3B), respectively, and the optimum reaction temperature was 30deg.C (FIG. 3C).
Example 5: comparison of the Activity of the individual mutants of 7029PETase with wild-type 7029PETase and mutants thereof
When the substrate is a monomeric form of PET, BHET, the enzyme activity on the substrate is compared as follows. Purified wild-type 7029PETase and its mutants were added to 500. Mu.l reaction buffer (50 mM Na2HPO4-HCl, pH 7.0) containing 4 mM BHET, respectively, and the final enzyme concentration was 100 nM, and incubated at 30℃for 18 h, three replicates for each group.
When the substrate is a commercial PET plastic, the method of comparing the activity of the enzyme on the substrate is as follows. Purified wild-type 7029PETase and its mutants were added to 500. Mu.l reaction buffer (50 mM Na2HPO4-HCl, pH 8.0) with a final enzyme concentration of 100 nM, respectively, and plastic plates with a diameter of 5 mM were added to the buffer. Incubation was carried out at 30℃for 18 h, three replicates per group.
After completion of the reaction, the reaction was terminated by heat treatment (80 ℃ C., 10 min), and after passing the reaction solution through a 0.22 μm filter, the final product was analyzed by reverse phase HPLC, as follows:
(A) Comparison of the amount of MHET in degradation products (the amount of MHET in wild-type 7029PETase degradation solution was defined as 1, MHET was the main product) for each mutant with BHET as substrate, see fig. 5A;
(B) Comparison of the amounts of TPA in degradation products (unit: mM) for each mutant using BHET as substrate, see FIG. 5B;
(C) Comparison of the amount of MHET in degradation products (the amount of MHET in wild-type 7029PETase degradation solution was defined as 1, MHET was the main product) for each mutant with PET as substrate, see fig. 5C;
(D) Each mutant uses PET as a substrate, and the comparison of the amount of BHET and TPA in the degradation products (unit: μM) is shown in FIG. 5D.
As can be seen from fig. 5A and 5B, when PET monomer BHET was used as a substrate, the activity of single-point mutant and multiple-point mutant of 7029PETase was improved to a different extent as compared with the wild-type activity. As can be seen from FIGS. 5C and 5D, when the substrate was changed to commercial PET plastic, the respective mutants enzymatically produced small amounts of BHET and TPA, but produced large differences in the major product MHET, wherein mutant 7029PETase W132H 、7029PETase R259A 、7029PETase W132H/R259A And 7029PETase L61T/W132H/R259A The activity of the enzyme is respectively improved by 1.04 times, 1.28 times, 1.12 times and 1.52 times compared with that of the wild type enzyme.
Sequence listing
<110> university of Shandong
<120> PET degrading enzyme mutant and application thereof
<141> 2019-05-22
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 269
<212> PRT
<213> amino acid sequence of wild-type 7029PETase (Artificial Sequence)
<400> 1
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Leu Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly Trp Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Arg Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 2
<211> 269
<212> PRT
<213> 7029PETase mutant L61T amino acid sequence (Artificial Sequence)
<400> 2
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Thr Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly Trp Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Arg Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 3
<211> 269
<212> PRT
<213> 7029PETase mutant W132H amino acid sequence (Artificial Sequence)
<400> 3
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Leu Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly His Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Arg Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 4
<211> 269
<212> PRT
<213> 7029PETase mutant R259A amino acid sequence (Artificial Sequence)
<400> 4
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Leu Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly Trp Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Ala Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 5
<211> 269
<212> PRT
<213> 29PETase double mutant L61T/W132H amino acid sequence (Artificial Sequence)
<400> 5
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Thr Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly His Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Arg Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 6
<211> 269
<212> PRT
<213> 7029PETase double mutant L61T/R259A amino acid sequence (Artificial Sequence)
<400> 6
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Thr Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly Trp Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Ala Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 7
<211> 269
<212> PRT
<213> 7029PETase double mutant W132H/R259A amino acid sequence (Artificial Sequence)
<400> 7
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Leu Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly His Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Ala Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 8
<211> 269
<212> PRT
<213> 7029PETase triple mutant L61T/W132H/R259A amino acid sequence (Artificial Sequence)
<400> 8
Gln Thr Asn Pro Tyr Gln Arg Gly Pro Asp Pro Thr Thr Arg Asp Leu
1 5 10 15
Glu Asp Ser Arg Gly Pro Phe Arg Tyr Ala Ser Thr Asn Val Arg Ser
20 25 30
Pro Ser Gly Tyr Gly Ala Gly Thr Ile Tyr Tyr Pro Thr Asp Val Ser
35 40 45
Gly Ser Val Gly Ala Val Ala Val Val Pro Gly Tyr Thr Ala Arg Gln
50 55 60
Ser Ser Ile Arg Trp Trp Gly Pro Arg Leu Ala Ser His Gly Phe Val
65 70 75 80
Val Ile Thr Leu Asp Thr Arg Ser Thr Ser Asp Gln Pro Ala Ser Arg
85 90 95
Ser Ala Gln Gln Met Ala Ala Leu Arg Gln Val Val Ala Leu Ser Glu
100 105 110
Thr Arg Ser Ser Pro Ile Tyr Gly Lys Val Asp Pro Asn Arg Leu Ala
115 120 125
Val Met Gly His Ser Met Gly Gly Gly Gly Thr Leu Ile Ser Ala Arg
130 135 140
Asp Asn Pro Ser Leu Lys Ala Ala Val Pro Phe Ala Pro Trp His Asn
145 150 155 160
Thr Ala Asn Phe Ser Gly Val Gln Val Pro Thr Leu Val Ile Ala Cys
165 170 175
Glu Asn Asp Thr Val Ala Pro Ile Ser Arg His Ala Ser Ser Phe Tyr
180 185 190
Asn Ser Phe Ser Ser Ser Leu Ala Lys Ala Tyr Leu Glu Ile Asn Asn
195 200 205
Gly Ser His Thr Cys Ala Asn Thr Gly Asn Ser Asn Gln Ala Leu Ile
210 215 220
Gly Lys Tyr Gly Val Ala Trp Ile Lys Arg Phe Val Asp Asn Asp Thr
225 230 235 240
Arg Tyr Ser Pro Phe Leu Cys Gly Ala Pro His Gln Ala Asp Leu Arg
245 250 255
Ser Ser Ala Leu Ser Glu Tyr Arg Glu Ser Cys Pro Tyr
260 265
<210> 9
<211> 807
<212> DNA
<213> nucleotide sequence of wild-type 7029PETase (Artificial Sequence)
<400> 9
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
ctcgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggctggtcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagccgcctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 10
<211> 807
<212> DNA
<213> 7029PETase mutant L61T nucleotide sequence (Artificial Sequence)
<400> 10
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
accgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggctggtcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagccgcctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 11
<211> 807
<212> DNA
<213> 7029PETase mutant W132H nucleotide sequence (Artificial Sequence)
<400> 11
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
ctcgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggccattcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagccgcctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 12
<211> 807
<212> DNA
<213> 7029PETase mutant R259A nucleotide sequence (Artificial Sequence)
<400> 12
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
ctcgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggctggtcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagcgccctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 13
<211> 807
<212> DNA
<213> 7029PETase double mutant L61T/W132H nucleotide sequence (Artificial Sequence)
<400> 13
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
accgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggccattcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagccgcctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 14
<211> 807
<212> DNA
<213> 7029PETase double mutant L61T/R259A nucleotide sequence (Artificial Sequence)
<400> 14
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
accgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggctggtcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagcgccctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 15
<211> 807
<212> DNA
<213> 7029PETase double mutant W132H/R259A nucleotide sequence (Artificial Sequence)
<400> 15
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
ctcgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggccattcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagcgccctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 16
<211> 807
<212> DNA
<213> 7029PETase triple mutant L61T/W132H/R259A nucleotide sequence (Artificial Sequence)
<400> 16
cagaccaacc cctaccagcg aggcccggac ccgacgaccc gcgacctgga agacagccga 60
gggccgttcc gctacgccag caccaacgtg cgctcgccca gcggttatgg cgcgggcacg 120
atctactacc ccaccgacgt cagcggcagc gtcggcgcgg tggcggtggt gcccggctac 180
accgcccgcc agtccagcat ccgctggtgg gggccgcgcc tggcctcgca cgggtttgtc 240
gtcatcaccc tcgacacccg ctcgacctcc gaccagcccg ccagccgttc cgctcaacag 300
atggcggcgc tgcggcaggt ggtggcgctc agcgagacgc gcagcagccc gatctacggc 360
aaggtcgatc ccaaccgtct cgcggtgatg ggccattcga tgggcggagg cggcacgctg 420
atctctgcgc gcgacaaccc cagcttgaag gccgccgtgc cattcgcccc gtggcacaac 480
accgccaact tctcgggcgt gcaagtgccg acgctcgtga tcgcttgcga aaacgacacc 540
gtcgccccga tctcgcgaca tgcctcgtcc ttctacaaca gcttttcgag ctcgctcgcc 600
aaggcctatc tcgagatcaa caacggctcg cacacctgcg ccaacaccgg caacagcaac 660
caggccctga tcggcaaata cggtgtggcg tggatcaagc gcttcgtcga caacgacaca 720
cgctacagcc ccttcctctg cggcgcacca catcaggccg acctgcgcag cagcgccctc 780
tcggagtacc gcgagagctg cccgtac 807
<210> 17
<211> 60
<212> DNA
<213> primer 7029-22b-1 (Artificial Sequence)
<400> 17
tctgctgctc ctcgctgccc agccggcgat ggccatggat cagaccaacc cctaccagcg 60
<210> 18
<211> 64
<212> DNA
<213> primer 7029-22b-2 (Artificial Sequence)
<400> 18
ctttgttagc agccggatct cagtggtggt ggtggtggtg gtacgggcag ctctcgcggt 60
actc 64
<210> 19
<211> 30
<212> DNA
<213> primer 7029-L61T-1 (Artificial Sequence)
<400> 19
tgctggactg gcgggcggtg tagccgggca 30
<210> 20
<211> 20
<212> DNA
<213> primer 7029-L61T-2 (Artificial Sequence)
<400> 20
accgcccgcc agtccagcat 20
<210> 21
<211> 32
<212> DNA
<213> primer 7029-W132H-1 (Artificial Sequence)
<400> 21
ccgcctccgc ccatcgaatg gcccatcacc gc 32
<210> 22
<211> 22
<212> DNA
<213> primer 7029-W132H-2 (Artificial Sequence)
<400> 22
cattcgatgg gcggaggcgg ca 22
<210> 23
<211> 20
<212> DNA
<213> primer 7029-R259A-1 (Artificial Sequence)
<400> 23
gccctctcgg agtaccgcga 20
<210> 24
<211> 30
<212> DNA
<213> primer 7029-R259A-2 (Artificial Sequence)
<400> 24
cgcggtactc cgagagggcg ctgctgcgca 30

Claims (5)

1. A PET degrading enzyme mutant characterized in that: the mutant is formed by mutating tryptophan at position 132 of PETase 7029 into histidine, the amino acid sequence of the mutant is shown as SEQ ID NO.3, and the nucleotide sequence of the mutant is shown as SEQ ID NO. 11; the amino acid sequence of the PET degrading enzyme 7029PETase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 9.
2. A PET degrading enzyme mutant characterized in that: the mutant is formed by mutating amino acid 132 from tryptophan to histidine and mutating amino acid 259 from arginine to alanine on PET degrading enzyme 7029PETase, the amino acid sequence is shown as SEQ ID NO.7, and the nucleotide sequence is shown as SEQ ID NO. 15; the amino acid sequence of the PET degrading enzyme 7029PETase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 9.
3. A recombinant vector, characterized in that: the vector comprising the PET degrading enzyme mutant according to claim 1 or 2.
4. A recombinant bacterium, characterized in that: the recombinant bacterium comprises the recombinant vector of claim 3.
5. Use of a PET degrading enzyme mutant according to claim 1 or 2, characterized in that: use of a PET degrading enzyme mutant in degrading PET plastics.
CN202210343406.4A 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof Active CN114591933B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210343406.4A CN114591933B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210343406.4A CN114591933B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof
CN201910439940.3A CN110241097B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN201910439940.3A Division CN110241097B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof

Publications (2)

Publication Number Publication Date
CN114591933A CN114591933A (en) 2022-06-07
CN114591933B true CN114591933B (en) 2023-09-22

Family

ID=67885046

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201910439940.3A Active CN110241097B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof
CN202210343406.4A Active CN114591933B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201910439940.3A Active CN110241097B (en) 2019-05-24 2019-05-24 PET degrading enzyme mutant and application thereof

Country Status (1)

Country Link
CN (2) CN110241097B (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111100835B (en) * 2020-01-07 2021-12-31 中国科学院青岛生物能源与过程研究所 PET degradation biocatalyst and application thereof
CN113684195B (en) * 2020-05-19 2022-07-22 中国海洋大学 Sterol esterase and coding gene and mutant thereof
CN114480343B (en) * 2020-10-27 2023-07-04 湖北大学 PET hydrolase with enhanced activity
CN114438140B (en) * 2020-11-02 2024-05-17 华南理工大学 PET degradation method
CN115125225B (en) * 2021-03-25 2023-07-04 湖北大学 PET degrading enzymes with improved thermostability
CN113774041B (en) * 2021-08-06 2022-09-02 天津大学 PET hydrolase IsPETase mutant enzyme, coding gene and engineering bacterium

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107674866A (en) * 2016-10-18 2018-02-09 电子科技大学 The PET water solution enzyme mutant of high catalytic activity
CN108467857A (en) * 2018-03-14 2018-08-31 四川大学 PET water solution enzyme mutant and its application
CN108588052A (en) * 2018-05-11 2018-09-28 天津大学 The mutant of PET degrading enzymes and its application

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5096884A (en) * 1990-01-09 1992-03-17 Bristol-Myers Squibb Company Glidobactin pf-1 peptide antibiotics
DE112011105840B3 (en) * 2010-02-05 2018-07-12 New England Biolabs, Inc. Restriction endonucleases with high accuracy
US8629243B2 (en) * 2011-08-16 2014-01-14 E I Du Pont De Nemours And Company Variant sucrose transporter polypeptides that enable faster sucrose utilization in bacteria
CN106367408A (en) * 2016-10-20 2017-02-01 天津大学 PET lytic enzyme mutant, coding gene and application thereof
CN107699550B (en) * 2017-08-11 2020-09-25 山东大学 Burkholderia homologous recombinase, expression vector and application thereof
CN109402037A (en) * 2018-11-07 2019-03-01 深伦生物科技（深圳）有限公司 A kind of genetic engineering bacterium for PET plastic degradation
CN112522219B (en) * 2020-12-08 2022-08-19 山东大学 Key amino acid site for controlling lipopeptide chain length change and mutant and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107674866A (en) * 2016-10-18 2018-02-09 电子科技大学 The PET water solution enzyme mutant of high catalytic activity
CN108467857A (en) * 2018-03-14 2018-08-31 四川大学 PET water solution enzyme mutant and its application
CN108588052A (en) * 2018-05-11 2018-09-28 天津大学 The mutant of PET degrading enzymes and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
聚对苯二甲酸乙二醇酯降解酶的研究进展;李秀;杨海涛;王泽方;;微生物学报(第12期);摘要 *

Also Published As

Publication number Publication date
CN110241097B (en) 2022-05-17
CN114591933A (en) 2022-06-07
CN110241097A (en) 2019-09-17

Similar Documents

Publication Publication Date Title
CN114591933B (en) PET degrading enzyme mutant and application thereof
CN109182284B (en) 7 beta-hydroxysteroid dehydrogenase mutant, coding sequence, recombinant expression vector, genetic engineering bacteria and application
CN109825484B (en) Zearalenone hydrolase ZHD101 mutant and method for hydrolyzing zearalenone by using mutant
JP2010510774A (en) Arabinose isomerase expressed from Corynebacterium sp. And method for producing tagatose using the same
CN111748537B (en) Uridine phosphatase mutant and application thereof
WO2017143945A1 (en) Cephalosporin c acylase mutant
CN109504645B (en) Isoleucine dioxygenase, mutant and application in synthesis of 4-hydroxyisoleucine
CN111172142B (en) Cephalosporin C acylase mutant with high thermal stability
CN109072215B (en) Cephalosporin C acylase mutant and application thereof
CN110714020B (en) Method for efficiently, simply and conveniently purifying protein
CN113801240A (en) D-psicose-3-epimerase activity aggregate and preparation method and application thereof
CN116064470A (en) Cutinase mutant and application thereof in efficient degradation of PET
EP2796548A1 (en) Stereoselective production of (R)-3-quinuclidinol
CN114836406B (en) Agarase mutant with improved catalytic activity and application thereof
CN106434586B (en) Trehalose synthetase mutant and gene thereof
CN105969751B (en) Beta-glucosidase gene and application thereof
CN111004794B (en) Subtilisin E mutant with improved thermal stability and application thereof
CN109207500B (en) Glycerol dehydratase gene independent of coenzyme B12 and application thereof
CN108841805B (en) Lipase mutant with improved heat stability
CN113122563A (en) Method for constructing R-3-aminobutyric acid production strain
CN110846289A (en) Acinetobacter baumannii xanthine dehydrogenase mutant and application thereof
CN113151213B (en) High-fidelity DNA polymerase, preparation method and PCR application thereof
CN113667651B (en) NADH oxidase mutant with improved enzyme activity and changed optimal pH
CN114196659B (en) Amidase mutant, coding gene, engineering bacteria and application thereof
CN114164223B (en) Antarctic soil-derived esterase and encoding gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant