CN114591400A

CN114591400A - FoxM1-DBD targeting polypeptide and application thereof

Info

Publication number: CN114591400A
Application number: CN202210319376.3A
Authority: CN
Inventors: 茆灿泉; 项坤; 常苗; 花欣怡; 梁安平
Original assignee: Southwest Jiaotong University
Current assignee: Southwest Jiaotong University
Priority date: 2022-03-29
Filing date: 2022-03-29
Publication date: 2022-06-07
Anticipated expiration: 2042-03-29
Also published as: CN114591400B

Abstract

The invention discloses acquisition of a group of targeted FoxM1-DBD polypeptides and application thereof in tumor resistance and fibrosis resistance. The polypeptide sequence is obtained by biological panning of a phage heptapeptide library, 4 types of high affinity and specificity are determined by reverse screening, and polypeptide modification is carried out, so that the modified polypeptide can effectively inhibit and kill cancer cells, promote cancer cell apoptosis and inhibit cancer cell migration; meanwhile, the compound can inhibit fibroblast proliferation and has potential anti-fibrosis effect. The polypeptide of the invention has research value for developing anti-tumor and fibrosis drugs.

Description

FoxM1-DBD targeting polypeptide and application thereof

Technical Field

The invention relates to the field of biotechnology pharmacy, in particular to a group of targeted FoxM1-DBD polypeptides and application thereof in tumor resistance and fibrosis resistance.

Background

Cancer targeted therapy blocks the growth of cancer cells by specifically targeting molecules required for cell growth and tumorigenesis, and has better therapeutic effects and lower side effects due to its specific effects on cancer cells compared to other conventional therapeutic approaches. FoxM1 is a transcription factor of the forkhead box protein family and is involved in a variety of biological processes including cell proliferation, differentiation, cell cycle transition, migration, apoptosis, DNA damage repair, and the like. FoxM1 is expressed in highly proliferating cells and disappears in resting and terminally differentiated cells. FoxM1 is closely related to the occurrence and development of cancers, is over-expressed in most human cancers including liver cancer, lung cancer, breast cancer and the like, and FoxM1 over-expression is closely related to various cancer characteristics including unlimited proliferation, invasion and metastasis, angiogenesis, drug resistance and the like. Numerous studies have demonstrated that inhibition of FoxM1 in cancer cells can lead to decreased cell proliferation and migration, invasion, angiogenesis, EMT, and drug resistance, suggesting that it is a very potential target for targeted cancer therapy.

Fibrotic diseases, such as idiopathic Pulmonary Fibrosis (PF) or scleroderma (systemic sclerosis) are chronic fibroproliferative diseases for which there is currently no effective treatment. The research shows that FoxM1 has a close relation with fibroblasts and fibrosis. FoxM1 is essential for pulmonary fibrosis and Epithelial Mesenchymal Transition (EMT). Excessive fibroblast proliferation is a key event in promoting pulmonary fibrosis, and inhibition of FoxM1 expression may improve the progression of fibroblast proliferation during pulmonary fibrosis. In addition, FoxM1 promotes renal fibrosis by activating the Wnt/β -catenin signaling pathway, and the FoxM1 inhibitor salinomycin a reduces renal fibrosis in UUO mice.

At present, although some achievements are achieved for anti-cancer molecules targeting FoxM1 at home and abroad, most of the anti-cancer molecules are limited to non-peptide organic synthetic drugs, and the drugs are greatly limited to be applied to clinical treatment due to the defects of difficult acquisition, poor biocompatibility, metabolic toxicity and the like. In contrast, the polypeptide drug has good biocompatibility, the structure is easy to modify, and the synthesis is simple, so that the polypeptide drug becomes a biological medicine research and development hotspot. Polypeptide drugs targeting FoxM1 are rarely reported, and in the earlier-stage subject group, a polypeptide 9R-P201 aiming at FoxM1 DNA Binding Domain (DBD) protein is obtained by screening a phage display dodecapeptide library, has a selective inhibition and killing effect on tumor cells, has an IC50 value of 13.1 mu M on liver cancer cells, and is described in patent ZL 201510783946.4. And in patent application 201910086295.1 it was disclosed that in combination with 5-Fu, it was able to enhance the sensitivity of HepG2 cells to 5-Fu. Patent application 202010150842.0 discloses a method for constructing biased peptide library according to P201 sequence to screen out an optimized peptide, which has stronger inhibiting and killing effect on tumor cells. Unconstrained linear random peptide libraries can assume millions of different conformations, but only a few of them are likely to bind to the receptor, however, cyclized peptide libraries may reduce the conformational freedom, reduce the entropy of the peptides, and hopefully isolate higher affinity ligands. In addition, compared with the dodecapeptide screened before, the heptapeptide has the advantages of smaller molecular weight, shorter sequence and lower synthesis and modification cost. Therefore, the screening of the phage heptapeptide library finds a new polypeptide which has higher affinity with a target FoxM1-DBD protein and has better inhibition and killing effects on tumor cells, and has important research significance and social significance for developing antitumor drugs. In addition, the polypeptide targeting FoxM1 is rarely reported to treat fibrotic diseases, so the research on the effect of the polypeptide targeting FoxM1-DBD protein on fibrosis has pioneering significance.

Disclosure of Invention

The invention aims to provide a group of targeted FoxM1-DBD polypeptides and application thereof in resisting tumors and fibrosis.

The polypeptide sequence of the targeted FoxM1-DBD polypeptide with the anti-tumor and fibrosis application is obtained by screening from a phage display cyclic heptapeptide library.

The polypeptide is a cyclic peptide with disulfide bonds formed between cysteines at two ends, and the sequence is shown as SEQ ID NO: 1-NO: shown at 21. And (3) obtaining cyclic peptides with high affinity and specificity to a target FoxM1-DBD through back screening, wherein the cyclic peptides are named as CP13, CP18, CP29 and FCP20, and the sequences of the cyclic peptides are respectively shown as SEQ ID NO: 1-NO: 4, respectively.

Modifying and designing the screened high-affinity and specific cyclic peptide sequence, deleting cysteine at two ends of the sequence, connecting N end of the sequence with 9D-type arginine transmembrane peptides through a dimeric glycine serine connecting peptide to form linear peptides which are respectively named as 9R-CP13L, 9R-CP18L, 9R-CP29L and 9R-FCP20L, and the sequences are respectively shown as SEQ ID NO: 22-NO: shown at 25. The four modified polypeptides can inhibit tumor cells, and the 9R-CP29L polypeptide has the strongest inhibition effect.

The method for obtaining the target FoxM1-DBD polypeptide comprises the following specific steps:

s1, phage biopanning; the method specifically comprises the following substeps:

s11, adding the recombinant expression FoxM1-DBD protein into a high-affinity microplate, placing the microplate on an ice box for coating overnight, and washing with a TBST solution for 1 time; BSA blocking solution was added to block for at least 1h at 4 ℃ and the plates were washed 6 times with TBST.

S12, the step is carried out according to the following two methods:

adding phage into a pore plate coated with BSA, shaking and combining for 1h at room temperature, and then sucking into the pore plate coated with FoxM1-DBD protein;

directly adding the phage into a pore plate coated with FoxM1-DBD protein;

s13, washing the plate for 6-8 times by TBST, eluting the combined phage, sucking the eluent into a micro tube, and adding 1M Tris-HCl to neutralize the eluent; a portion of the phage was titered, and the remaining phage were amplified and titered for the next round of panning, for four rounds.

S2, phage monoclonal sequencing and reverse screening;

s21, sequencing: randomly picking a single plaque from a plate for testing titer, carrying out small-amount amplification, sucking partial bacteria liquid, designing a primer according to an M13KE vector, carrying out sequencing, and deducing a sequence of the displayed polypeptide according to the amino acid sequence of the phage.

S22, reverse screening: amplifying the sequenced monoclonal phageIncrease, and titer determination was performed at 1X 10 per well⁹The amount of the monoclonal antibody is added into a microplate, then the bound phage is eluted and the titer is determined, the P/N value, namely the titer of the phage eluted by the FoxM1-DBD protein coated hole/the titer of the phage eluted by the BSA-blocked hole is used, the affinity and the specificity of the phage monoclonal to the target are judged, and a plurality of types with high affinity and specificity are screened.

S3, polypeptide modification: the screened high-affinity and high-specificity cyclic heptapeptide is connected into a ring by a disulfide bond, the disulfide bond is unstable and is easy to reduce and break under the reducing environment in a tumor cell because FoxM1 is an intracellular target, Cys at two ends of a peptide sequence is preliminarily designed to be deleted, 9D-type arginines are designed to be added at the N end of the peptide sequence to achieve the purpose of membrane penetration, and the newly designed linear polypeptide containing 20 amino acids including 9R is obtained by connecting dimeric glycine serine with a target binding peptide.

Preferably, the step S21 is specifically: individual plaques were randomly picked from the plates for the third and fourth rounds of eluate titer determination, a small amount of amplification was performed, a portion of the lysate was aspirated, sequencing was performed based on M13KE vector design primers (F: CTGTCTTTCGCTGCTGAGG, R: AACCCCGCTAATCCTAATCC), and the sequence of the displayed polypeptide was deduced based on the amino acid sequence of the phage. In step S22, four cyclic heptapeptides CP13(CHGYPWSLC), CP18(CMHSNTLYC), CP29(CAWWNTEWC), and FCP20(CDSYFWRPC) with high affinity and specificity were finally screened. In the step S3, the screened cyclic heptapeptides CP13, CP18, CP29 and FCP20 are used for engineering design. The four modified polypeptide sequences are respectively 9R-CP13L (RRRRRRRRRGSGSHGYPWSL), 9R-CP18L (RRRRRRRRRGSGSMHSNTLY), 9R-CP29L (RRRRRRRRRGSGSAWWNTEW) and 9R-FCP20L (RRRRRRRRRGSGSDSYFWRP).

S4, polypeptide synthesis. (synthesized by Shanghai Qianyao Biotechnology Co., Ltd.)

The polypeptide synthesis steps are as follows:

(1) swelling resin: 2-Chlorotrityl Chloride Resin (2-Chlorotrityl Chloride Resin having a degree of substitution of 1.1 mmol/g) was put into a reaction tube, DMF (15mL/g) was added thereto, and the mixture was shaken for 60 min.

(2) Grafting with the first amino acid: filtering off solvent by sand core, adding 3 times molar excess Fmoc-Trp (Boc) -OH and C terminal first amino acid of Fmoc-Arg (pbf) -OH, adding 10 times molar excess DIEA, finally adding DMF (10mg/g) for dissolving, and oscillating for 30 min; methanol was capped for 30 min.

(3) Deprotection: DMF was removed and 20% piperidine DMF solution (15mL/g) was added for 5min and 20% piperidine DMF solution (15mL/g) was added for 15 min.

(4) And (3) detection: the piperidine solution is pumped out, dozens of particles of resin are taken, washed with ethanol for three times, added with ninhydrin, KCN and phenol solution, and heated for 5min at 105-110 ℃, and the positive reaction is obtained when the color turns dark blue.

(5) Washing: DMF (10mL/g) was taken twice, methanol (10mL/g) was taken twice, and DMF (10mL/g) was taken twice.

(6) Condensation: adding 3 times molar excess Fmoc protected amino acid, 3 times molar excess HBTU, adding 10 times molar excess DIEA, adding DMF (10mg/g) for dissolving, and shaking for 45 min.

(7) And (3) detection: taking dozens of resins, washing the resins with ethanol for three times, adding ninhydrin, pyridine and phenol solution into the resins one drop at a time, heating the resins at 105-110 ℃ for 5min, and taking colorless negative reaction.

(8) Washing: DMF (10mL/g) was used once, methanol (10mL/g) was used twice, and DMF (10mL/g) was used twice.

(9) Repeating the operations in the steps (3) to (8), and connecting the amino acids in the sequence from right to left.

(10) The resin was washed and drained as follows:

DMF (10mL/g) was taken twice, DCM (10mL/g) was taken three times, and methanol (10mL/g) was taken four times and pumped dry for 10 min.

(11) Cutting: preparing cutting fluid (10/g) TFA 94.5%; 2.5 percent of water; 2.5 percent of EDT; TIS 1% cut time: and 180 min.

(12) Drying and washing: drying the lysate with nitrogen as much as possible, separating out ether, centrifuging to remove supernatant, washing the precipitate with ether for six times, and volatilizing at normal temperature.

(13) Purification and preparation:

first, a little crude product, H, is taken₂Dissolving the O/ACN. Then, a small amount of sample is taken to be analyzed on an HPLC analyzer to judge the peak-off time corresponding to the target peak.Using a C18 reverse phase chromatography preparation system: avelength is 220 nm; flow Rate 15 mL/min; vol 20mL Column Temp 25 ℃ Buffer A0.1% TFA in water Buffer B0.1% TFA in Acetonitrile; and collecting the target peak solution. A small amount of the target peak solution was taken out from a 1.5mL centrifuge tube for mass spectrometric confirmation and purity detection.

(14) And (4) freeze-drying the qualified target peak solution to obtain a finished product.

And respectively taking a small amount of finished polypeptide, and performing MS molecular weight identification and HPLC analysis purity identification. Sealing and packaging white powdery polypeptide, and storing at-20 deg.C.

Compared with the prior art, the invention has the advantages that:

the invention provides a group of polypeptide molecules with anti-tumor activity targeting FoxM1, which can effectively inhibit and kill cancer cells, promote cancer cell apoptosis and inhibit cancer cell migration. Meanwhile, the polypeptide can inhibit the proliferation of the fibrocyte and has the potential of treating fibrotic diseases. Especially, the polypeptide 9R-CP29L has the best effect, can effectively inhibit highly metastatic liver cancer cells and triple negative breast cancer cells, and can also inhibit fibroblasts. Lays a good work foundation for developing and designing new drug molecules with the effects of resisting tumors and fibrotic diseases.

Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.

Drawings

FIG. 1 is a graph showing the elution recovery rate of phage obtained by four rounds of biopanning.

FIG. 2 is a bar graph of the results of reverse screening of phage clones.

FIG. 3, bar chart of the four synthetic polypeptides on the inhibition of cell viability of HCCLM3 and MDA-MB-231.

FIG. 4 is a graph showing the effect of the polypeptide 9R-CP29L on the cell viability of HCCLM 3.

FIG. 5 is a graph showing the effect of the polypeptide 9R-CP29L on MDA-MB-231 cell viability.

FIG. 6, polypeptide 9R-CP29L flow chart of HCCLM3 apoptosis.

FIG. 7, histogram of polypeptide 9R-CP29L apoptosis on HCCLM 3.

FIG. 8, Transwell plot of polypeptide 9R-CP29L on cell migration of HCCLM 3.

FIG. 9, histogram of polypeptide 9R-CP29L migration against HCCLM3 cells.

FIG. 10 is a graph showing the inhibition of L929 cell activity by the polypeptide 9R-CP 29L.

FIG. 11, graph of the effect of polypeptide 9R-CP29L on L929 cell clones.

FIG. 12, histogram of the L929 cell clone with polypeptide 9R-CP 29L.

FIG. 13 is a graph showing the expression of FoxM1 protein in L929 cells after the treatment with the polypeptide 9R-CP 29L.

FIG. 14, the molecular docking scheme of the polypeptide CP29L and FoxM1-DBD protein.

Detailed Description

The preferred embodiments of the present invention will be described in conjunction with the accompanying drawings, and it should be understood that they are presented herein only to illustrate and explain the present invention and not to limit the present invention.

A group of FoxM1 targeting peptide acquisition method comprises the following steps:

s1, phage biopanning;

adding 15 μ g of recombinant expressed FoxM1-DBD protein into high affinity microplate, placing in ice box, coating overnight, washing with TBST solution for 1 time (TBS + Tween20, four-wheel Tween concentrations are 0.1%, 0.3%, and 0.3%), adding 300 μ LBSA blocking solution, blocking at 4 deg.C for at least 1h, washing with TBST for 6 times, and adding 1 × 10¹¹Phages were applied to BSA coated plates and bound for 1h with shaking at room temperature before being pipetted into FoxM1-DBD protein coated plates. This is the subtraction method. Here, a non-subtractive method was used, i.e., phage was added directly to the FoxM1-DBD coated wells. The plates were washed 6-8 times with TBST, 200. mu.L of Glycine-HCl (pH 2.2), 1mg/mL BSA per well to elute bound phage, gently shaken for about 10min, the eluate was pipetted into a microtube, and 30. mu.L of 1M Tris-HCl (pH 9.1) was added to neutralize the eluate. 10 μ L of phage was titered, the remaining phage amplified and titered for the next round of panning, for four rounds. The results are shown in FIG. 1: by passingThe recovery rate of the phage is gradually improved by four cycles of combination-elution-amplification of the phage display library, and the phage combined with the target is considered to be effectively enriched.

S2, phage monoclonal sequencing and reverse screening;

s21, sequencing: individual plaques were randomly picked from the plates for titer determination from the third and fourth rounds of eluate, a small amount of amplification was performed, a portion of the ER2738 bacterial fluid was aspirated, sequencing was performed based on M13KE vector design primers (F: CTGTCTTTCGCTGCTGAGG, R: AACCCCGCTAATCCTAATCC), the sequence of the displayed polypeptide was deduced based on the amino acid sequence of the phage, and the results are shown in the following Table.

Serial number	Screening number	Sequence of	Screening frequency of appearance
				SEQ ID：NO5	CP7	CMSYGGAPC	1
SEQ ID：NO6	CP9	CHPSWNTFC						1
				SEQ ID：NO1	CP13	CHGYPWSLC	1
SEQ ID：NO7	CP14	CTLWGTYEC						2
				SEQ ID：NO8	CP15	CSGHLPTLC	1
SEQ ID：NO2	CP18	CMHSNTLYC						1
				SEQ ID：NO3	CP29	CAWWNTEWC	10
SEQ ID：NO9	CP40	CNTWPWQFC						1
				SEQ ID：NO10	CP43	CSQWWFGAC	2
SEQ ID：NO11	FCP7	CNVEMFWRC						2
				SEQ ID：NO12	FCP9	CPVEFKPLC	1
SEQ ID：NO13	FCP10	CSHLLAVKC						1
				SEQ ID：NO14	FCP11	CDEHLHRTC	1
SEQ ID：NO15	FCP15	CLNMPISHC						1
				SEQ ID：NO16	FCP18	CEPMLGPRC	1
SEQ ID：NO4	FCP20	CDSYFWRPC						1
				SEQ ID：NO17	FCP29	CNSDSFKLC	1
SEQ ID：NO18	FCP4N	CFGVYTNVC						1
				SEQ ID：NO19	FCP8N	CLSGPLSKC	1
SEQ ID：NO20	FCP12N	CLPTGLIAC						1
				SEQ ID：NO21	FCP18N	CMTPIDWRC	1

S22, reverse screening: the sequenced monoclonal phage were amplified and titer determined at 1X 10 per well⁹The amount of the phage is added into a microplate (coated with 1 mu g of the target), the plate is washed 8 times by TBST, then the bound phage is eluted and the titer is determined, and the affinity and the specificity of the phage monoclonal to the target are judged by using the P/N value, namely the titer of the phage eluted from the wells coated with FoxM1-DBD protein/the titer of the phage eluted from the wells only sealed by BSA. The results are shown in FIG. 2: the P/N value of the phage displaying peptides CP13, CP18, CP29 and FCP20 is the highest, and the frequency of CP29 in the screening process is the highest and is 10 times.

S3, polypeptide modification: the cyclic heptapeptides CP13, CP18, CP29 and FCP20 (designated as CP13 (SEQ ID NO: CHGYPWSLC), CP18 (SEQ ID NO: CMHSNTLYC), CP29 (SEQ ID NO: CAWWNTEWC) and FCP20 (SEQ ID NO: CDSYFWRPC) obtained by screening were linked to form a ring by a disulfide bond. Since FoxM1 is an intracellular target and the disulfide bond is unstable and easy to be reduced and broken under the reducing environment in tumor cells, Cys at two ends of a deleted peptide sequence (named as CP13L (sequence: HGYPWSL), CP18L (sequence: MHSNTLY), CP29L (sequence: AWWNTEW) and FCP20L (sequence: DSYFLRP) are designed preliminarily, in order to enable the polypeptide to enter cells through cell membranes to play a role in acting with the target, 9D-type arginines (9R) are added at the N end of the peptide sequence to achieve the purpose of membrane penetration, and the polypeptide is connected with the target binding peptide through dimeric glycine. Accordingly, newly designed linear polypeptides of 20 amino acids including 9R (designated as 9R-CP13L (SEQ ID NO: RRRRRRRRRGSGSHGYPWSL), 9R-CP18L (SEQ ID NO: RRRRRRRRRGSGSMHSNTLY), 9R-CP29L (SEQ ID NO: RRRRRRRRRGSGSAWWNTEW), and 9R-FCP20L (SEQ ID NO: RRRRRRRRRGSGSDSYFWRP), respectively, were designed.

S4, synthesizing polypeptide, and the steps are as follows:

(1) swelling resin: 2-Chlorotrityl Chloride Resin (2-Chlorotrityl Chloride Resin with a degree of substitution of 1.1 mmol/g) was placed in a reaction tube, DMF (15mL/g) was added thereto, and the mixture was shaken for 60 min.

(2) Grafting with the first amino acid: filtering off the solvent by a sand core, adding 3 times of molar excess Fmoc-Trp (Boc) -OH and C-terminal first amino acid of Fmoc-Arg (pbf) -OH, adding 10 times of molar excess DIEA, finally adding DMF (10mg/g) for dissolving, and oscillating for 30 min; methanol was capped for 30 min.

(5) Washing: DMF (10mL/g) twice, methanol (10mL/g) twice, and DMF (10mL/g) twice.

(7) And (3) detection: washing dozens of resins with ethanol for three times, adding ninhydrin, pyridine and phenol solution one drop by one drop, heating at 105-110 ℃ for 5min, and taking colorless negative reaction.

(10) The resin was washed and drained as follows:

(13) Purification and preparation:

first, a little crude product, H₂Dissolving the O/ACN. Then, a small amount of sample is taken to be analyzed on an HPLC analyzer to judge the peak-off time corresponding to the target peak. Using a C18 reverse phase chromatography preparation system: avelength is 220 nm; flow Rate 15 mL/min; vol 20mL Column Temp 25 ℃ Buffer A0.1% TFA in water Buffer B0.1% TFA in Acetonitrile; and collecting the target peak solution. A small amount of the target peak solution was taken out by a 1.5mL centrifuge tube for mass spectrometric confirmation and purity detection.

The performance of the polypeptide prepared by the method is studied as follows:

1. inhibiting effect of synthetic polypeptide on tumor cell activity

The CCK8 method is adopted to detect the influence of four synthesized polypeptides on the cell viability of human high-metastasis hepatoma cell HCCLM3 and human triple-negative breast cancer cell MDA-MB-231. The HCCLM3 and MDA-MB-231 cells in good state were inoculated into 96-well plates at 5X 10/well³Culturing the individual cells overnight, adding polypeptide, and preparing the polypeptide with DMEMDiluting the mother liquor with 10% FBS culture medium to obtain concentration gradient (30, 50, unit. mu.M), adding 4 multiple wells per concentration, reacting for 24h and 48h, adding mixed CCK8 mixed solution (CCK8 solution: culture medium volume ratio is 1: 10), incubating in incubator for about 2h, detecting absorbance values at 450nm and 630nm (reference wavelength) with microplate reader, using OD450-OD630 as reading after correction, and calculating cell activity inhibition rate [% 1- (medicated well reading-background value)/(control reading-background value) according to the formula]X 100. The results are shown in FIG. 3, and the four polypeptides have different degrees of inhibition on two tumor cells, wherein the 9R-CP29L peptide has the strongest inhibition on the two tumor cells.

2. Inhibition of polypeptide 9R-CP29L on tumor cell viability

The CCK8 method is adopted to detect the influence of the polypeptide 9R-CP29L on the activity of HCCLM3 cells and MDA-MB-231 cells. As described in method 1, polypeptide concentration was diluted to concentration gradient (5, 10, 20, 30, 40, 50, unit μ M), 4 replicates per concentration, and% cell viability ═ 100 (medicated well readings-background)/(control group readings-background). The results are shown in FIGS. 4 and 5: with the concentration gradually increased, the cell activity is obviously reduced, and under the concentration of 20 mu M, the cell activity of HCCLM3 is respectively reduced by 74.46%, 91.83% and 86.62% in 12h, 24h and 48 h; MDA-MB-231 cells have 38.26 percent, 77.00 percent and 92.87 percent of cell activity reduced under the concentration of 20 mu M; it can be found that 9R-CP29L has dose-dependent inhibition on the viability of both tumor cells, while 9R-CP29L has a significantly shorter inhibitory effect on HCCLM3 cells than MDA-MB-231 cells. The IC50 values of 9R-CP29L for HCCLM3 cells at 12h, 24h and 48h were 12.87. mu.M, 7.20. mu.M and 8.57. mu.M, respectively, and for MDA-MB-231 cells at three time periods, IC50 was 20.10. mu.M, 11.63. mu.M and 7.27. mu.M, respectively.

3. Apoptosis-promoting effect of polypeptide 9R-CP29L on tumor cells

The effect of the treatment of the polypeptide 9R-CP29L on the apoptosis of HCCLM3 cells was detected by annexin V-FITC/PI double staining method. Laying 1X 10 in 12-hole plate⁵Adding 10 and 20 μ M polypeptide after one HCCLM3 cell overnight, treating for 24 hr, collecting cell culture solution after action time, washing cell once with PBS, collecting, and digesting fine cell with EDTA-free pancreatinStopping digestion after cells become round, mixing with the collected cells, centrifuging and collecting, washing cell precipitates twice by PBS, adding 100 mu LBinding buffer to resuspend the cells, adding 5 mu LannexinV-FITC to lightly blow uniformly, adding 5 mu LPI to mix uniformly; incubate in dark at room temperature for 10min, add 400. mu.L Binding Buffer and mix gently, detect by up-flow, repeat 2 per group. The results are shown in FIGS. 6 and 7: the mean early and late apoptosis rates were 4.90% and 6.70% after 24h of 10 μ M treatment, and 17.44% and 25.09% after 24h of 20 μ M treatment (figure 6 shows only one of the results, figure 7 is an average of two). The apoptosis rate of the polypeptide-treated group was significantly increased relative to untreated cells and was dose-dependent.

4. Inhibition of tumor cell migration by polypeptide 9R-CP29L

The Transwell method was used to examine the effect of treatment with the polypeptide 9R-CP29L on migration of HCCLM3 cells. Laying 1X 10 in 12-hole plate⁵Treating the cells with 10 and 15 μ M polypeptide for 24h after overnight, washing with PBS 2 times to remove dead cells after reaching action time, digesting the cells with pancreatin, centrifuging and collecting after termination, washing with PBS once to precipitate the cells, resuspending the cells with DMEM medium after centrifuging and collecting the cells, counting, and suspending at 1.5 × 10 μ L per well of 200 μ L cell suspension⁴Cells were added to the chamber, the chamber was moved to a 24-well plate containing 600 μ L of 20% fetal bovine serum medium, after 24h the cells in the chamber were wiped off with a cotton swab, fixed with 4% paraformaldehyde for 25min, stained with 0.1% crystal violet for 25min, and photographed under a microscope, with 2-3 fields of view randomly per chamber, each set was repeated 3 times. Counting was performed using Image J software. The results are shown in fig. 8 and 9: the polypeptide treatment group showed a significant reduction in cells passing through the chamber, while the number of cells passing through the chamber showed a decreasing trend with increasing concentration of the polypeptide.

5. Inhibition of fibroblast viability by polypeptide 9R-CP29L

The CCK8 method is adopted to detect the effect of the treatment of the polypeptide 9R-CP29L on the activity of the mouse fibroblast L929. The CCK8 experiment was performed as described in 1, with polypeptide concentration gradients (10, 20, 30, 40, 50, 60, 70, units μ M) of 5 replicates per concentration. The results are shown in FIG. 10, where the inhibitory effect of the 9R-CP29L peptide on L929 cells appears dose-and time-dependent. The IC50 values at 24h and 48h were 20.64. mu.M and 16.43. mu.M, respectively.

6. Inhibition of fibroblast clonogenic by polypeptide 9R-CP29L

The effect of the polypeptide 9R-CP29L on the clonality of L929 cells was examined using a clonality assay. Inoculating 700 cells into each hole of a six-hole plate, adding 30 mu M and 50 mu M medicaments after overnight treatment, acting for two weeks, changing the solution every three days, washing once by PBS after reaching the time, fixing for 30min by 4% paraformaldehyde, dyeing for 30min by 0.1% crystal violet, washing for 3-4 times by PBS until the background is clear, and taking a picture by a camera. The experiment was repeated three times. The results are shown in FIGS. 11 and 12, in which the number of colony formation is significantly reduced in the drug-added group compared to the control group, and the inhibitory effect is more significant at higher concentrations.

7. Inhibition of polypeptide 9R-CP29L on fibroblast FoxM1 protein expression

The effect of the polypeptide 9R-CP29L on the expression of FoxM1 protein in L929 cells was examined by Western Blot assay. Inoculate 1.5X 10 wells per 12-well plate⁵And (2) after overnight culture of L929 cells, adding a blank culture medium and 30 mu M polypeptide for treatment for 24h and 48h, after the acting time is reached, using RIPA to lyse the cells, centrifuging at 13000rpm for 10min, sucking supernatant, taking a small amount of protein supernatant, using a BCA kit to detect the concentration, adding 5 times of protein loading buffer solution into the rest, boiling and denaturing for 10min, then running glue, performing wet transfer, sealing for 3h, incubating FoxM1 primary antibody for 4 ℃ overnight, washing for 3-4 times by TBST, incubating secondary antibody for 1h, washing for 3-4 times by TBST, and adding ECL developing solution for exposure. The results are shown in fig. 13, where the FoxM1 protein expression level decreased after polypeptide treatment.

8. Docking of the polypeptide CP29L with the target FoxM1-DBD molecule

Downloading a FoxM1-DBD protein structure file (3G73) from a PDB database, performing molecular docking by using an online protein-polypeptide docking website HPEPDCK, uploading a PDB format file after deleting nucleic acid in the FoxM1-DBD, inputting a polypeptide ligand into a CP29L sequence without designating a binding site for docking, analyzing and predicting the interaction of the optimal binding conformation of the protein and the polypeptide by using a Discovery Studio Visualizer Client, and visualizing the result by PyMOL software. As shown in FIG. 14, the polypeptide CP29L was able to form hydrogen bond with Asn283, His287, Asn288, and His292, Pi-position interaction with Arg236 and electrostatic attraction, and Pi-Pi T-shaped interaction with His 287. The major contributors to the binding specificity of FoxM1 for DNA are the three residues that are invariably conserved: asn-283, Arg-286 and His-287. Therefore, it is speculated that CP29L can bind to these sites, interfering with binding of FoxM1-DBD to DNA, thereby affecting expression of downstream genes and exerting corresponding biological activities.

In conclusion, the embodiment shows that the linear polypeptides 9R-CP13L, 9R-CP18L, 9R-CP29L and 9R-FCP20L screened and designed and modified by the invention have inhibition effects of different degrees on high-metastasis hepatoma carcinoma cell HCCLM3 and triple-negative breast cancer cell MDA-MB-231, wherein 9R-CP29L has the strongest inhibition effect on HCCLM3 and MDA-MB-231, and the IC50 value of the 9R-CP29L peptide on cancer cells is almost the reported lowest concentration of anti-tumor polypeptide molecules screened from a phage random peptide library aiming at FoxM1 targets, so that the research value is higher; in addition, 9R-CP29L can promote HCCLM3 cell apoptosis and inhibit cell migration, and can inhibit the proliferation of fiber cell L929 and the expression of FoxM1 protein in the cell, thereby laying a good foundation for developing and designing new drug molecules with anti-tumor and anti-fibrosis disease effects.

Although the present invention has been described with reference to a preferred embodiment, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> southwest university of transportation

<120> a group of targeted FoxM1-DBD polypeptides and application thereof

<160> 25

<170> SIPOSequenceListing 1.0

<210> 1

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 1

Cys His Gly Tyr Pro Trp Ser Leu Cys

1 5

<210> 2

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 2

Cys Met His Ser Asn Thr Leu Tyr Cys

1 5

<210> 3

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 3

Cys Ala Trp Trp Asn Thr Glu Trp Cys

1 5

<210> 4

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 4

Cys Asp Ser Tyr Phe Trp Arg Pro Cys

1 5

<210> 5

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 5

Cys Met Ser Tyr Gly Gly Ala Pro Cys

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 6

Cys His Pro Ser Trp Asn Thr Phe Cys

1 5

<210> 7

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 7

Cys Thr Leu Trp Gly Thr Tyr Glu Cys

1 5

<210> 8

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 8

Cys Ser Gly His Leu Pro Thr Leu Cys

1 5

<210> 9

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 9

Cys Asn Thr Trp Pro Trp Gln Phe Cys

1 5

<210> 10

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 10

Cys Ser Gln Trp Trp Phe Gly Ala Cys

1 5

<210> 11

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 11

Cys Asn Val Glu Met Phe Trp Arg Cys

1 5

<210> 12

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 12

Cys Pro Val Glu Phe Lys Pro Leu Cys

1 5

<210> 13

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 13

Cys Ser His Leu Leu Ala Val Lys Cys

1 5

<210> 14

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 14

Cys Asp Glu His Leu His Arg Thr Cys

1 5

<210> 15

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 15

Cys Leu Asn Met Pro Ile Ser His Cys

1 5

<210> 16

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 16

Cys Glu Pro Met Leu Gly Pro Arg Cys

1 5

<210> 17

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 17

Cys Asn Ser Asp Ser Phe Lys Leu Cys

1 5

<210> 18

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 18

Cys Phe Gly Val Tyr Thr Asn Val Cys

1 5

<210> 19

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 19

Cys Leu Ser Gly Pro Leu Ser Lys Cys

1 5

<210> 20

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 20

Cys Leu Pro Thr Gly Leu Ile Ala Cys

1 5

<210> 21

<211> 9

<212> PRT

<213> Artificial sequences (artificial series)

<400> 21

Cys Met Thr Pro Ile Asp Trp Arg Cys

1 5

<210> 22

<211> 20

<212> PRT

<213> Artificial sequences (artificial series)

<400> 22

Arg Arg Arg Arg Arg Arg Arg Arg Arg Gly Ser Gly Ser His Gly Tyr

1 5 10 15

Pro Trp Ser Leu

20

<210> 23

<211> 20

<212> PRT

<213> Artificial sequences (artificial series)

<400> 23

Arg Arg Arg Arg Arg Arg Arg Arg Arg Gly Ser Gly Ser Met His Ser

1 5 10 15

Asn Thr Leu Tyr

20

<210> 24

<211> 20

<212> PRT

<213> Artificial sequences (artificial series)

<400> 24

Arg Arg Arg Arg Arg Arg Arg Arg Arg Gly Ser Gly Ser Ala Trp Trp

1 5 10 15

Asn Thr Glu Trp

20

<210> 25

<211> 20

<212> PRT

<213> Artificial sequences (artificial series)

<400> 25

Arg Arg Arg Arg Arg Arg Arg Arg Arg Gly Ser Gly Ser Asp Ser Tyr

1 5 10 15

Phe Trp Arg Pro

20

Claims

1. A group of FoxM1-DBD targeting polypeptides, wherein the polypeptide sequences are selected from phage display cyclic heptapeptide libraries.

2. The FoxM1-DBD targeting polypeptide of claim 1, wherein the polypeptide is a cyclic peptide with a disulfide bond formed between two cysteines, and the sequence is shown in SEQ ID NO: 1-NO: shown at 21.

3. The targeted FoxM1-DBD polypeptide of claim 2, wherein cyclic peptides with high affinity and specificity for the target FoxM1-DBD are obtained by back screening, designated CP13, CP18, CP29, FCP20, and the cyclic peptide sequences are set forth in SEQ ID NOs: 1-NO: 4, respectively.

4. The FoxM 1-DBD-targeting polypeptide of claim 3, wherein the screened high affinity and specificity cyclic peptide sequence is engineered, cysteine residues at two ends of the sequence are deleted, and the N end of the sequence is connected with 9D-type arginine transmembrane peptides through a dimeric glycine serine connecting peptide to form linear peptides which are respectively named as 9R-CP13L, 9R-CP18L, 9R-CP29L and 9R-FCP20L, and the sequences are respectively shown as SEQ ID NO: 22-NO: shown at 25.

5. The FoxM 1-DBD-targeting polypeptide of claim 4, wherein the four modified polypeptides inhibit tumor cells and the 9R-CP29L polypeptide inhibits tumor cells most effectively.

6. The FoxM 1-DBD-targeting polypeptide of claim 5, wherein the polypeptide 9R-CP29L is effective in inhibiting highly metastatic hepatoma cells, triple negative breast cancer cells, and fibroblasts.

7. The use of the FoxM1-DBD targeting polypeptide according to any one of claims 2-6, wherein the polypeptide molecule can be used as a lead molecule for the preparation of a medicament for the treatment of tumor and fibrotic diseases.