CN114574624B

CN114574624B - DNA molecular marker for distinguishing eggplant pulp color and application

Info

Publication number: CN114574624B
Application number: CN202210399766.6A
Authority: CN
Inventors: 陶涛; 王永清; 邹敏; 杨洋; 田时炳; 周珊珊; 胡玮
Original assignee: Chongqing Academy of Agricultural Sciences
Current assignee: Chongqing Academy of Agricultural Sciences
Priority date: 2022-04-15
Filing date: 2022-04-15
Publication date: 2024-03-19
Anticipated expiration: 2042-04-15
Also published as: CN114574624A

Abstract

The invention discloses a DNA molecular marker for distinguishing eggplant pulp colors and application thereof, and belongs to the field of molecular biology. The DNA molecular marker is 80586213 to 80589660 base positions of a No. 8 chromosome of an eggplant gene, and the nucleotide sequence is shown in SEQ ID NO: 21. Also discloses a primer pair for amplifying the DNA molecular marker and application of the molecular marker or the primer pair in eggplant flesh color breeding. Experiments prove that the DNA molecular marker disclosed by the invention can distinguish green meat type materials from white meat type materials, and improves the breeding efficiency of eggplants.

Description

DNA molecular marker for distinguishing eggplant pulp color and application

Technical Field

The invention relates to the field of molecular biology, in particular to a DNA molecular marker for distinguishing the color of eggplant pulp and application thereof.

Background

Eggplant (Solanum melongena l.) is native to the india, southeast asia tropical region, and is transferred into China in the 4-5 th century of the male element, china is considered to be the second origin of eggplant. In China, eggplant fruits form to evolve into 11 types of balls, oval, long cylinders, long strips, short sheep horns and the like, and fruit colors also evolve into 8 colors of white, green, purple, black purple and the like. Eggplants are widely cultivated in various places in China, and are important fruits and vegetables loved by people. According to the Food and Agricultural Organization (FAO) statistics of 2016, china is the country with the largest eggplant cultivation area, and the sowing area is 78.19 ten thousand hectares, which accounts for 43.59% of the eggplant industry in the world. For a long time, because of diversified climatic ecological types and differentiated consumption habits of various regions in China, various regions form unique eggplant cultivar types, and eggplant varieties produced and consumed in different regions have great differences in the traits of fruit shape, fruit color, fruit flesh color, pulp hardness degree and the like. The eggplant cultivar pulp has white, yellow white, green and the like, and the main reasons for the difference in fruit and meat color are the presence or absence of chlorophyll or the accumulation or degradation degree of chlorophyll in the fruit development process. Genetic and molecular marker studies on eggplant peel color are relatively many, while genetic studies on eggplant fruit flesh color are relatively few. Molecular markers related to pulp have not been reported.

Disclosure of Invention

The invention aims to provide a DNA molecular marker for distinguishing the color of eggplant pulp and application thereof, so as to solve the problems in the prior art, and the molecular marker can distinguish green meat type materials from white meat type materials, thereby improving the breeding efficiency of eggplants.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a DNA molecular marker for distinguishing the color of eggplant pulp, which is 80586213 to 80589660 base positions of eggplant gene 8 th chromosome, and the specific nucleotide sequence is shown in SEQ ID NO:21 (see http:// Eggplant-hq. Cn/Eggplant/home/index for the gene sequence of the molecular marker).

The invention also provides a primer pair for amplifying the DNA molecular marker.

Preferably, the primer pair includes any one of the following:

ep7-17F(SEQ ID NO：1)：ATGAAAACTCCACTCTACTCTACTCCAC；

ep7-17R(SEQ ID NO：2)：GTTTGCTAACGTACGCCTCAATTGCTCT；

0802018-3F(SEQ ID NO：3)：AACTTACAGAAATCCCACATTGAGG；

0802018-4R(SEQ ID NO：4)：CCGCGCTACACTTTCTTCCT；

0802018-6R(SEQ ID NO：5)：CCATGTAATTGCAGTTTACTCGTTC；

SSR9F(SEQ ID NO：6)：CTCTGTCATTGTCACATTAGG；

SSR9R(SEQ ID NO：7)：ATGGTCGAATTGGCAAGAA；

SSR90F(SEQ ID NO：8)：TTCTGGTTGTTCTCTTCGAT；

SSR90R(SEQ ID NO：9)：TGAGGTAATGGTAAGGTCTAC；

SSR-133F(SEQ ID NO：10)：GGAGAAACAACCATCTATTC；

SSR-133R(SEQ ID NO：11)：CAACGAATTGGTGACAGT；

SSR-165F(SEQ ID NO：12)：CATCGGAGCATCACTGTT；

SSR-165R(SEQ ID NO：13)：GACCAAAGTCAAAGCAAGTT；

SSR-377F(SEQ ID NO：14)：CATGTCATCGAGGTATCATT；

SSR-377R(SEQ ID NO：15)：GCTCACACACTTGAAAGG；

SSR-852F(SEQ ID NO：16)：CAGTTGCCTGCTTAATTGTC；

SSR-852R(SEQ ID NO：17)：CGATTGACGTGTCTGCTTA。

the invention also provides a kit for distinguishing the color of eggplant pulp, which comprises the DNA molecular marker or the primer pair.

The invention also provides an application of the DNA molecular marker, the primer pair or the kit in eggplant pulp color breeding.

The invention also provides a method for detecting eggplant pulp genes by using the DNA molecular markers, which comprises the following steps:

(1) Amplifying eggplant pulp DNA to be detected by using the primer pair;

(2) If the amplified product shows a 222bp band, it is white pulp; the amplified product showed only 199bp bands, green pulp; the amplified product showed two bands of 222bp and 199bp, which were green pulp.

Preferably, the amplification reaction system is: ddH ₂ O4.7. Mu.L, 2 XMix 5. Mu.L, 0.1. Mu.L each of F primer and R primer, and 0.1. Mu.L of template DNA.

Preferably, the amplification procedure is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 1min,35 cycles; after the reaction is finished, the mixture is further extended for 2 minutes at 72 ℃; preserving at 4 ℃.

The invention discloses the following technical effects:

the invention takes two eggplant inbred lines with great pulp color difference (green and white) as materials, and researches the inheritance of the pulp color through the pulp color separation proportion of the inbred and backcrossed offspring; the SSR markers associated with the flesh color are identified by utilizing a BSA method, a DNA molecular marker is developed, green flesh and white flesh type materials can be distinguished through PCR product band type differences of eggplant DNA, and the eggplant breeding efficiency is improved.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the color of parent and F1 fruit flesh; left: NC7; in (a): f1 (NC 7 XBL); right: BL;

FIG. 2 shows the selection of the amphiphilic polymorphism SSR primers; m:100bp DNAladder,1-45 are amplification bands of different SSR primer pairs in parents;

FIG. 3 is an identification of SSR markers associated with flesh color; m:100bp DNA ladder,1-2 is a parent BL, 3-4 is a parent NC7, 5-6 is F1,7-8 is a white pulp DNA mixing pool, 9-10 is a green pulp DNA mixing pool, 11-20 is 10 single plants in the white pulp DNA mixing pool, and 21-30 is 10 single plants in the green pulp DNA mixing pool;

FIG. 4 shows the amplification bands of SSR primers ep7-17 in F2 generation individuals; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-137: f2 population individual plants, wherein the boxes are hybrid plants, and the fruit flesh phenotype is shown by an arrow and is inconsistent with the mark;

FIG. 5 is an amplified band of SSR primers ep7-17 in the BC1 generation; m:100bp DNAladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, box is hybrid plants, and the fruit flesh phenotype indicated by the arrow is inconsistent with the marker;

FIG. 6 is a comparison of the differences in amplified band DNA sequences of SSR primers ep7-17 in parents;

FIG. 7 shows the results of verification of SSR9 primers in the progeny of the BC1 backcross; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 8 shows the results of verification of SSR90 primers in the progeny of BC1 backcross; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 9 shows the results of verification of SSR-133 primers in the progeny of BC1 backcrosses; m:100bp DNAladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 10 shows the results of verification of SSR-165 primers in the progeny of the BC1 backcross; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 11 shows the results of verification of SSR-377 primers in the progeny of BC1 backcross; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 12 shows the results of verification of SSR-852 primer in the progeny of BC1 backcross; m:100bp DNA ladder,P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotypes and banding samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker;

FIG. 13 is a genetic map by mapmaker after alignment of the banding patterns of the various primers in BC1 offspring with the pulp color phenotype;

FIG. 14 is a validation result in the BC1 generation for the 0802018 locus; a, M: DL15000bp DNA marker, P1: "BL", P2: "NC7",1-131: BC1 population individuals, boxes are hybrid plants and individuals with non-acquired phenotype, band-type samples, and the flesh color phenotype indicated by the arrow is inconsistent with the marker; b, secondary test results for 66#, 112# and 113 #; m: DL15000bp DNA marker, P1: "BL", P2: "NC7", arrow indicates where the large band is located;

fig. 15 shows the results of verification of eggplants with different colors for 0802018 site 1-30 as green meat type material and 31-60 as white meat type material.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

Example 1

1. Test materials

The method is characterized in that BL and NC7 with different pulp colors are selected as parents, BL peel and pulp colors are white, the high-generation separated inbred line of a commercial variety "Bailong" cultivated by vegetable research institute of the national academy of agricultural sciences of Guangdong is selected, NC7 peel is black purple, pulp is green, and the high-generation separated inbred line of a commercial variety "Britta" is selected. Taking NC7 as a female parent and BL as a male parent, and obtaining F through hybridization ₁ ，F ₁ Selfing while "BL" and F ₁ Backcrossing to obtain F ₂ And BC (binary code) ₁ By parents, F ₁ 、F ₂ And BC (binary code) ₁ For materials, fruit flesh color genetic analysis and SSR marker identification are carried out.

2. Test reagents and apparatus

Plant genome DNA extraction kit, 100bp DNA Marker, DL15000bp DNA Marker, 2xTaq Plus Master Mix II (Dye Plus) are purchased from Nanjinouzan biotechnology Co., ltd, silver nitrate, sodium hydroxide, ammonium persulfate, TEMED, 40% acr-Bis (29:1) glue making solution, agarose, affinity silane, stripping silane and other reagents are purchased from Beijing Ding national prosperous biotechnology Co., ltd, T4 DNA ligase and pMD19-T vector are purchased from Takara, competent cells DH5 alpha are purchased from Beijing Optimago biotechnology Co., ltd, and characteristic band DNA sequences are determined by Beijing Optimago biotechnology Co.

The 219 pair SSR primer sequence information for the test was derived from Nunome t. (2009), synthesized by english-swiftly (shanghai) trade limited. The PCR amplification instrument was BIO RAD S1000.

2. Test method

2.1 field test

The test was performed at a Chongqing academy of agricultural sciences test base. Parent hybridization is carried out in summer in 2018 and in 2019F in summer ₁ Selfing and backcrossing to construct a test population. Sowing different generation materials in the next 2 months of 2020, and planting in open field for 4 months, wherein the row spacing is 0.8m and the plant spacing is 0.5m. Parent, F ₁ Planting 20 plants each, F ₂ And BC (binary code) ₁ And (5) planting 150 plants. And (5) performing conventional field management.

2.2 pulp color observations and genetic analysis

In the commodity period of eggplant, the middle part of the fruit is transected, and the color of the pulp of each generation of single plant is observed by adopting a visual inspection method. Using Mendelian genetic theory to F ₂ And BC (binary code) ₁ Pulp color separation was analyzed and tested for suitability for card square (lid. Cowboy. 2015. Statistical methods of experiments (fourth edition), china agricultural Press, 2015, 126-129.).

2.3 sampling and DNA extraction

The indoor test is completed in a Chongqing city-level key laboratory for the stress agriculture research. Collecting tender leaves with stem tips not fully developed in adult plant period, and collecting parents F ₁ 10 plants are selected for mixed sampling, F ₂ And BC (binary code) ₁ The individual plants are sampled after numbering the individual plants. Selecting 0.1g of leaf sample, placing into a 2mL centrifuge tube, adding a stainless steel ball with the diameter of 4mm, fully freezing with liquid nitrogen, fully grinding with a grinder, and extracting the genome DNA of the eggplant leaf according to the specification of the plant genome extraction kit.

2.4 establishment of near isogenic pools

The BSA method proposed by Michelcore et al (1991) was used in BC ₁ And respectively selecting 10 single plants of green pulp and white pulp from the generation separation population, mixing the DNA of the 10 single plants in equal quantity, and respectively constructing a near isogenic pool of the green pulp and the white pulp.

2.5 PCR reaction

Amplification system: 10 μL system in which ddH ₂ O4.7. Mu.L, 2 XMix 5. Mu.L, 5 'primer and 3' primer each 0.1. Mu.L, template DNA 0.1. Mu.L.

The reaction procedure: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 1min,35 cycles; after the reaction is finished, the mixture is further extended for 2 minutes at 72 ℃; preserving at 4 ℃.

2.6 Polyacrylamide gel electrophoresis and quick silver staining

8% polyacrylamide gel electrophoresis (60 mL per plate gel, 40% Acr-Bis (29:1) 12mL,5xTBE 12mL,10% ammonium persulfate 600. Mu.L, TEMED 60. Mu.L, ddH) ₂ O-make-up 60 mL); 1 μl of PCR product per sample; constant voltage 350V, electrophoresis 3h.

After electrophoresis, washing two sides of the glass plate with tap water, and precooling; stripping off gel, and washing twice with double distilled water; immersed in 0.1% AgNO ₃ In the solution, silver staining is carried out on a shaking table for 8 minutes; washing with double distilled water for 1min each time; immersing in 1.2% NaOH+0.4% formaldehyde solution for developing, and immediately flushing a large amount of double distilled water after the occurrence of the strip, and stopping developing; and (5) naturally airing the rubber plate, and photographing.

2.7 linkage analysis

At F ₂ And BC (binary code) ₁ In the isolated population, single plants with phenotype and effective data with phenotype are selected for analysis, the coincidence degree of the markers and the phenotype (the number of single plants consistent with the phenotype/the total number of single plants multiplied by 100%) is calculated respectively, the exchange value (the proportion of the recombinant individuals to the population) is calculated, linkage analysis is carried out by using Mapmaker3.0 software, and the genetic distance is calculated.

2.8 amplification and sequencing of characteristic bands

Amplification and recovery: the amphiphilic specific difference strip gel blocks are cut off from the PAGE gel plates respectively, put into a 1.5mL centrifuge tube, added with a proper amount of sterilized water to completely immerse the gel blocks, and kept stand at 4 ℃ for about 2 hours to dissolve DNA from the gel. 5. Mu.L of the leachate is sucked, 40. Mu.L of an amplification system is used for carrying out PCR reaction on amplified bands by using SSR primers ep7-17, and the reaction conditions are the same. 2% agarose electrophoresis followed by dicing of the specific bands and recovery of fragments using a DNA gel recovery kit.

Ligation transformation: 1. Mu.L of T4-DNA ligase, 2. Mu.L of Buffer, 0.5. Mu.L of pMD19-T, 10. Mu.L of fragment was recovered, and ddH was recovered ₂ O was made up to 20. Mu.L and reacted overnight at 16 ℃; transferring the ligation product into 100. Mu.L DH 5. Alpha. Competent cells, standing on ice for 20min, heat-shocking at 42 ℃ for 90sec, immediately placing on ice for 5min, adding 500. Mu.L of antibiotic-free LB liquid medium, culturing at 37 ℃ for 30-45min, coating on an LB solid plate containing Amp antibiotics, drying in a super clean bench, and culturing at 37 ℃ overnight.

Positive validation and sequencing: selecting single bacterial colony to perform bacterial colony PCR, wherein the reaction system and the conditions are the same as those above; positive bacteria are selected for culture, plasmids are extracted by a plasmid extraction kit and sequenced.

3. Results and analysis

3.1 pulp color genetic analysis

3.1.1 hybridization of green pulp "NC7" as female parent and white pulp "BL" as male parent, F ₁ The color of the pulp was observed. F (F) ₁ The pulp color of the 20 plants is green, and the color depth is consistent with NC 7. The results showed that eggplant green pulp was completely dominant to white pulp (see fig. 1).

3.1.2 pairs F ₂ And BC (binary code) ₁ The pulp color of the individual plants of the population is observed and recorded respectively, and the separation proportion is analyzed and the suitability X is carried out ² Testing.

In field planting F ₂ In 150 plants, 13 dead plants, 13 mixed plants after planting in seedling stage, 27 plants without obtaining accurate flesh color data, and 97 plants with effective flesh color phenotype data are actually obtained. In the 97 strains observed, the pulp color is obviously divided into green and white, and the color depth of the green pulp is consistent with that of the parent NC 7. Wherein, the green pulp has 71 strains and the white pulp has 21 strains, and the number of the green pulp and the white pulp is separated into 2.73:1. If the pulp color is controlled by a pair of dominant genes, the theoretical separation ratio is 3:1. Via suitability X ² Testing, at F ₂ In the single plant of the group, the separation ratio of the green pulp plant number and the white pulp plant number accords with 3 of a pair of gene control: 1 separation ratio (see table 1).

BC in field planting ₁ In 150 generations, 19 dead plants, 1 hybrid plants (12#), 5 plants (14#, 31#, 37#, 86#, 111#) which do not obtain accurate flesh color data, and 125 plants which actually obtain effective flesh color phenotype data are obtained. For BC ₁ Analysis of the color separation of the pulp of the generation, the ratio of the number of green pulp plants to the number of white pulp plants was 1:1 separation ratio (see table 1).

TABLE 1F ₂ And BC (binary code) ₁ Group individual plant pulp color separation ratio and chi-square test

By the method of F ₁ Fruit flesh color appearance and F ₂ And BC (binary code) ₁ The result of the separation analysis of the fruit flesh color shows that the color of eggplant fruit flesh belongs to quality character, the color is completely dominant, the green flesh is dominant to white, and the color is controlled by a pair of genes.

3.2 fruit flesh color SSR markers

3.2.1SSR primer-parental polymorphism analysis

Among 236 pairs of SSR primers reported by Nunome T. (2009,Development of SSR markers derived from SSR-enriched genomic library of eggplant (Solanum melongena L.)), 219 pairs of primers distributed over 12 linkage groups were selected for determining polymorphisms between parents. In 219 pairs of SSR primers detected, 79 pairs of clear bands cannot be amplified in one parent or parent, and 140 pairs of clear bands can be amplified in the parent, accounting for 63.93% of the total number of primers. Of 140 pairs of primers capable of amplifying distinct bands, 69 primers had polymorphisms between parents, accounting for 31.51% of the total number of primers (see Table 2), and FIG. 2 shows the banding pattern behavior of 45 pairs of SSR primers in parents.

TABLE 2 identification of the polymorphism of the amphiphilic SSR primers

SSR primer Total	Total number of polymorphic primers	Number of primers without polymorphism	Countless primers without amplified bands
				219	69	71	79

3.2.2 polymorphism SSR primers for near-equivalent pool polymorphism analysis

At BC ₁ And in the separation group, 10 green pulp single-plant DNA and white pulp single-plant DNA are selected and mixed in equal quantity, and a green pulp and white pulp DNA mixing pool is respectively established. And (3) amplifying 69 pairs of SSR primers with polymorphism between parents in the mixed pool, and screening SSR primers with polymorphism between the mixed pools. Among 69 pairs of primers, 1 pair of primers (ep 7-17) detected polymorphism between pools, and the sequences of the primers were:

F：ATGAAAACTCCACTCTACTCTACTCCAC；

R：GTTTGCTAACGTACGCCTCAATTGCTCT。

3.2.3 SSR markers associated with flesh color

Primers ep7-17 amplified about 220bp characteristic bands in the parent "BL" (lanes 1 and 2), about 190bp characteristic bands in "NC7" (lanes 3 and 4), F ₁ Two characteristic bands with parents were amplified (lanes 5 and 6), belonging to heterozygosity, whereby the SSR markers were seen to be co-dominant markers. The white pulp pool signature bands (lanes 7 and 8) were identical to the parent "BL", and the green pulp pool signature bands (lanes 9 and 10) were identical to F ₁ Is a uniform one of (a) and (b). Amplifying the single plants in the mixed pool respectively, wherein 10 single plant amplifying strips in the white pulp mixed pool are completely consistent with the parent BL, and 10 single plant amplifying strips in the green pulp mixed pool are completely consistent with F ₁ Is identical to (figure 3). Amplifying and F in green pulp mixing pool ₁ The same hybrid belt, but not the green pulp parent "NC7", is used because the test materials are selected from the white pulp parents "BL" and F ₁ BC of backcross of (a) ₁ All BC ₁ The genotypes of the green pulp single plants are all heterozygous. The result shows that the SSR primer ep7-17 amplified strip can well identify white pulp and green pulp plants and can be used as SSR molecular markers associated with eggplant pulp.

3.2.4 SSR marker verification associated with flesh color

The marker ep7-17 associated with flesh color will be identified at BC ₁ And F ₂ Verification was performed in population isolate individuals.

After F2 population culled the hybrid individuals, there were 3 banding patterns, homozygous and heterozygous for the parents "BL" and "NC 7". If the marker loci are not exchanged with the control flesh color gene loci, the color of the separated single plant flesh consistent with the parental BL band type is green, the color of the separated single plant flesh consistent with the NC7 band type is green. The obtained 97 strains of effective phenotype data were compared with banding patterns, 91 individual strains of fruit flesh phenotype were matched with banding patterns, 6 strains (8, 20, 48, 81, 85 and 122) were not matched (FIG. 4), and the banding pattern was 93.81% matched with phenotype, and the swap value was 6.18%. The genetic distance between the identified SSR markers ep7-17 and the control flesh color gene was 7.8cM as analyzed by Mapmaker3.0 software.

At BC ₁ In the population, only the homozygous and heterozygous bands consistent with the parent "BL" exist. Theoretically, the homozygous pulp is white, and the heterozygous pulp is green. The obtained 125 effective phenotype data were compared with the banding pattern, 122 individual fruit flesh phenotype was consistent with the banding pattern, only 3 strains (24, 66 and 117) were inconsistent, the banding pattern was 97.60% consistent with the phenotype, and the crossover value was 2.4%. The mapmaker3.0 software analysis shows that the genetic distance between the SSR markers ep7-17 and the control flesh colour gene is 2.5cM.

Through F ₂ And BC (binary code) ₁ The pulp phenotype data of the two separated population single plants are compared with the banding patterns, and ep7-17 and pulp colors have a closer linkage relationship, and the mark and phenotype coincidence degree is more than 93% although a certain exchange exists, so that the ep7-17 can be completely used for pulp color auxiliary selection in the seedling stage.

3.2.5 characteristic stripe sequence analysis

The DNA of the differential bands with the parent specificity is recovered and amplified for sequence analysis. The size of the BL band is 222bp (SEQ ID NO: 18), the NC7 band is 199bp (SEQ ID NO: 19), and the homology reaches 89.64%. The analysis found that the difference between the two was that "BL" contained the 23bp repeat CTTTTTGAATTTGTTCTCTGAGA twice, whereas "NC7" was only once (see FIG. 6).

3.2.6 Fine targeting of target genes

Comparing the amplified sequences of ep7-17 primer pairs on an Eggplant genome website (http:// Eggplant-hq.cn/Eggplant/home/index), finding that the locus is located at 80844176 to 80843965 base positions of an Eggplant genome No. 8 chromosome, respectively selecting 1M base sequences upstream and downstream of the locus by taking the locus as an origin, uploading the 2M base sequences to an SSR prediction website (http:// www.repeatmasker.org/cgi-bin/WEBRepeatMasker) for SSR locus prediction, carrying out primer design according to the returned result of the website, and then verifying the polymorphism of the primers in parents, wherein the final experimental result shows that 6 pairs of primers have better polymorphism in the two parents, and the 6 pairs of primers are respectively: SSR9, SSR90, SSR-133, SSR-165, SSR-377, SSR-852 were verified in BC1 backcross progeny with these 6 pairs of primers.

The primers are specifically as follows:

SSR9F：CTCTGTCATTGTCACATTAGG；

SSR9R：ATGGTCGAATTGGCAAGAA；

SSR90F：TTCTGGTTGTTCTCTTCGAT；

SSR90R：TGAGGTAATGGTAAGGTCTAC；

SSR-133F：GGAGAAACAACCATCTATTC；

SSR-133R：CAACGAATTGGTGACAGT；

SSR-165F：CATCGGAGCATCACTGTT；

SSR-165R：GACCAAAGTCAAAGCAAGTT；

SSR-377F：CATGTCATCGAGGTATCATT；

SSR-377R：GCTCACACACTTGAAAGG；

SSR-852F：CAGTTGCCTGCTTAATTGTC；

SSR-852R：CGATTGACGTGTCTGCTTA。

by comparing the phenotype of the newly designed primer with the phenotype of the pulp color in the BC1 offspring (see fig. 7-12), the data are removed because some fruit color characters are not collected and some samples are not banded during PCR amplification, red boxes are added in the diagram for removal, and triangles represent samples with band types and non-conforming phenotypes. Genetic mapping was performed by Mapmaker3.0 and the fruit-colored phenotypic marker (FCP) was found to be located between SSR-165 and SSR-377 (see FIG. 13). The SSR-165 locus is located at about 165kb upstream of the ep7-17 locus, the SSR-377 locus is located at about 377kb upstream of the ep7-17 locus, the physical distance between the two markers is about 212kb, and 14 genes are contained between the two loci.

The 14 genes are subjected to sequence analysis, primers are respectively designed to clone the 14 genes, and in the process of cloning the 14 genes, a pair of primers (0802018-3F and 0802018-4R) are found to have a great band type difference in the electrophoresis pattern of PCR products of two types of materials, and the fragment difference amplified by the two materials at the site is about 5 kb. Fragments amplified by the pair of primers of NC7 and white dragon DNA of 0802018-3F and 0802018-4R are respectively cloned on a sequencing vector in a segmented mode, and finally sequences are spliced to obtain the fragment length amplified by NC7 of 8725bp (SEQ ID NO: 20) and the fragment length amplified by BL of 3448bp (SEQ ID NO: 21).

0802018-3F and 0802018-4R primer pairs:

0802018-3F：AACTTACAGAAATCCCACATTGAGG；

0802018-4R：CCGCGCTACACTTTCTTCCT。

because the amplified fragments of the 0802018-3F and 0802018-4R primer pairs in NC7 are too long, in order to reduce the length of the amplified fragments, a primer 0802018-6R is designed: CCATGTAATTGCAGTTTACTCGTTC. PCR amplification is carried out on NC7 and white dragon parent DNA by using the primer and 0802018-3F, so that bands with theoretical lengths of 6947bp and 1669bp can be obtained respectively.

As shown in fig. 14A, this site was verified in the BC1 generation with 0802018-3F and 0802018-6R primers, and experimental results showed that the band patterns of the other samples were fully matched with the pulp color phenotype, except that 66#, 112# were not matched with the phenotype, and the larger band of 113# was invisible. Since the DNA of BC1 progeny has a long shelf life, there is a possibility of degradation, especially when amplifying large fragments, it is highly likely that large fragments cannot be amplified due to degradation of DNA, and thus the frozen samples of the three samples are re-extracted. Because of the long shelf life, the quality of the extracted DNA was not very good, and PCR verification was performed with these three re-extracted DNA, as shown in fig. 14B, 112# and 113# were able to amplify large bands, with 66# being visible in a subtle fashion, and this site was further matched to the phenotype.

PCR amplification of 30 green and 30 white meat type materials was verified using primer pairs 0802018-3F and 0802018-6R at this site, as shown in FIG. 15, which was found to be able to distinguish these green and white meat type materials by 100% (see Table 3).

Table 3.60 eggplant material names for different fruit colors

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Sequence listing

<110> Chongqing market agricultural academy of sciences

<120> DNA molecular marker for distinguishing eggplant pulp color and application thereof

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgaaaactc cactctactc tactccac 28

<210> 2

<211> 28

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gtttgctaac gtacgcctca attgctct 28

<210> 3

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

aacttacaga aatcccacat tgagg 25

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ccgcgctaca ctttcttcct 20

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ccatgtaatt gcagtttact cgttc 25

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ctctgtcatt gtcacattag g 21

<210> 7

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

atggtcgaat tggcaagaa 19

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

ttctggttgt tctcttcgat 20

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tgaggtaatg gtaaggtcta c 21

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ggagaaacaa ccatctattc 20

<210> 11

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

caacgaattg gtgacagt 18

<210> 12

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

catcggagca tcactgtt 18

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gaccaaagtc aaagcaagtt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

catgtcatcg aggtatcatt 20

<210> 15

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

gctcacacac ttgaaagg 18

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

cagttgcctg cttaattgtc 20

<210> 17

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

cgattgacgt gtctgctta 19

<210> 18

<211> 222

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

atgaaaactc cactctactc tactccactc ttctccttaa tcggagttcg gaatcaacaa 60

tgtgagtaat tgaggcttca cacacataga ttttttttcc cgcaaattta ctagcttttt 120

gaatttgttc tctgagactt tttgaatttg ttctctgaga atgaattttt cttatttttg 180

gatattcaac agggagagca attgaggcgt acgttagcaa ac 222

<210> 19

<211> 199

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

atgaaaactc cactctactc tactccactc ttctccttaa tcggagttcg gaatcaacaa 60

tgtgagtaat tgaggcttca cacacataga ttttttttcc cgcaaattta ctagcttttt 120

gaatttgttc tctgagaatg aatttttctt atttttggat attcaacagg gagagcaatt 180

gaggcgtacg ttagcaaac 199

<210> 20

<211> 8725

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

aacttacaga aatcccacat tgagggaaag aaatttcaat ttatcccaac tttttttcta 60

tttacaaaaa tctcataaaa agacaattat gcggatacac ttaaaaagac aattttacag 120

atccacttcg ccatatatga ttcataagtc atgattcatt gtaatcaata tctaatgcga 180

tgaatcagcc atgtgttaac tattttattg caatgaatca tattgtatga tccattgtct 240

caatgaatca acccattaat atgattcatt ggtgtatcat cattatatga tgcacccaat 300

gaatcatcaa cctataacaa ctagaaaaag tatcacaatg aattactata ttcaatccat 360

acagttctag tgaatcgaca acatatatga ctcggtttta tatataaatg aatcaccata 420

tttaatgaat caccataaaa aattgtgaac aactcatagt tttgaaatga atcaccatac 480

aagatacata ctctcggttt tatatataga tgaatcacca taaaaagttg tgaacaactc 540

atagttttga aatgaatcac catacaagat atataccaca cacataaatc gctatatttt 600

cttaaaccca tatagtctca tgaatcacat atctgagctt tcttcttcga ttttattttt 660

gagatttttg aatctgggtg attttgaact tgaagagggt cgtcataggt gaactttgaa 720

cttcaagttc aagttcaaaa tggatctggg atttgaagca gaagaaaagg agaagaaata 780

agatcaacca ttgattttga atctatatcc acaacaccag ctaaccaatc attgccatgg 840

ccgtatcctt acaattacag acactccctt ctaccttcac acgtcctcgc gctctcttta 900

tctctttttc cttttccctt tcccccattt gtctatttct ccactctccc aaaaccttcg 960

caagattttc agtactccct ttgaagggaa ttgaagaaga taaattaacc tattttttga 1020

ttttgaatta gtttggcttg attctccttg aagaaacagg attttgtgga aaaggggatg 1080

agtgtatcag aaagtagcga aaaaaggatt ttagtaattt gtaaaaaaga tagggaatat 1140

ttgaaaatat tttaacataa tgtgggattt ttataatttt tccaaaaaaa aaaaaaacaa 1200

gacaaataaa ttgaaataaa aaaatattta tttttaattt tattactgtg atttaatttt 1260

gtattttttg acgaatgaat tgcgagagtt acattatgag ttaacaattt tttaaaaata 1320

aaatttagga tattattaca taaattataa agttatcaaa gacgctaact actcagtaat 1380

cttgatgtta gtgtagcatt tttctaaagt tggaaatttt agtgtaccaa tgttattaca 1440

ttagttgtta acttgttata tcaaaagtgg agtttgataa aaatagtgtt tacttaataa 1500

ataaagtata atttatataa attttatggt gtaagaagca aattatatca tattcctatt 1560

cttttctaat ttataaaatt cccctaaaat atgagtcgtt tgggtatatc ccagtatgca 1620

tgatacataa aaattgatac attaattagt tgttctgtgg gaaacaaaac ataattatta 1680

atatgaaatt cataaattac gcaaatcata caaatcataa tgatgtcgat gtctaccaag 1740

acataacaat tttaaacaat tcaaatttta aactttcttc tctcatatct ttctcaaatc 1800

gtttcagatt caaaaaattt ttaaaaaaat tatctggtac atgatgaatc tatctatttt 1860

gttgagatat ttaggaatat gaaaaagtgg tatgagttat aaacgataca aaagtgatag 1920

aatagttgtt ggaccaacta cgaattcacc caaattgtaa tatatttcaa aatcattaag 1980

aattgtagag atacactatg aatatcttaa tttgttgaga cattctggaa tctgaaaaaa 2040

tgaggccagt tatcaacgat acaacaaatg tattatgttg tgtagtagaa ttttgtttat 2100

tatgtcaaca taattatata tatcacgata cattgttatt ttgataatgt attcatcaat 2160

ttacgtgtgc caaggagatg gtcccctgtc ttaccacggt tgctggcaag agaatccgct 2220

ttttgacaca tatattagat tgtagcacaa gagatgattc gctctagtcc cgtaaccaag 2280

cgaaagagga ttcacggaca gaagttgtgg gtaaaccctc ggtttgccct caactatata 2340

cgttgatagg ggataacttc tttgctagct accagctaaa ggtgatacta tctacaactc 2400

ctgaaagaag gccaaatagt gtctcatccg gttcataatg tgttcaatct tagatcgata 2460

cattactgag tggtagttac taggtatcat atacatgctc cgtgttttta tgaatatatc 2520

atgcctaaaa atttttgaga tgtgcttttg aactggatat aagacatgat acattaatag 2580

tcctaacata agtcgtaaat tactaactag tgtaatacta caagatacat tagggaagta 2640

aaggttgtcc ataatgtgct ttcttttaga gttgtacatt atcgcgtggt cattattaag 2700

tataagaatc gtataatatt gttttcgtaa aatccttttg agcaattcaa ccagcttttc 2760

aagtaattcc cacacacaaa actccattaa ttatttttca agtgaaatac atgttcatct 2820

caactttcaa atatcatgtt ttaacacctt caataaataa cgttatatat aatatgtaac 2880

gtatttagaa ctcattttta atttagaagc cacaaactaa gaattgtttt acgcattatt 2940

tcccaaaagc aatcaataga gcacactcat cagcccaaac atgcaaaatt gggctagaaa 3000

aaaaggggaa accatatttg ggtccattat ttacaacaac tcaattttga ccttaaagtc 3060

aatgccatac acatggctca ctctgtgcca atcatttatt cattcttcaa gacatcagaa 3120

tccgggtcgg gtcgggtcgg gtcactgggt gatgtcatgg tgcatgtgtc catcaagtca 3180

ttggatcttt ctttttcaca aagaatgact gccatgtcat ctccgacaat tgatttgtgg 3240

agggacggtt gagatccctt gtctagaaag ttcgtcgaga acgccctccg tggaaggagg 3300

ttttaggccc aacggaagtg gtaaccatgg tttggttatt gcctccttta ctactttatc 3360

aatcacctcc tctgtctgca ccacaagcaa aaactcgaca aaataaattt tatagcttct 3420

cattattaca catgtagttt aagcactatt atcaaaagag ttctaggcct aagggtgtgt 3480

tctaggagga taaaaggttt cttatttatt ttcttatgtt tggtacataa acaaaaaaaa 3540

atattattct aatggcattt gttttataat ctagacaaat actatggaag gtggggatgg 3600

aggctacgag gatgcagtga agaagaaatg tgttggagag aggagaagaa tgaggacata 3660

atcgatgtgg aacgctactc ctgttacttg tttttcctac ttccactaga gaagtcattt 3720

ttgtcatttt taagaaactt gttttcctac agaaaatatt ttccaaaaat tttgaccaac 3780

tgaaaggaaa aataacactc ttccgtatga ataatctcct agctaagttg ctcagactct 3840

ccaaaaatgt tgccgaccca tgtcagatcc tttaaaaata cactattttt ggaggatcca 3900

ccacacactc gtcgacattc tcgaagagtc tgagcaacat agtctcctag tacaatgtat 3960

gtataaagaa ctttgtcgat ctgaaatagg atctacagtc tatgaagata tccataacaa 4020

tcctagttga gacaatctta ccgggtgaag atcaaacgac ttctctagca tgctatatct 4080

gctatgcatt ccgtgaggct ggtacactcc agcattctgc acaatccaac cgacgtgcca 4140

ttaagaactc aatccaagag tgcattcaca taagatagct caagaacatt gctaaactga 4200

aacatatatc aaatgggggt gatatattgc caacgtattc acctgaggat atggtggata 4260

tgatccaaat gatgacgcca tgacagggga gccccatgta tcagcatgta gctgcattat 4320

tacaaaatgc aagtttttag atgtggtatt tcttggacct aaaatatctt gtgaaacggt 4380

tgacctacga atgtcacacg atcaagctca aaaggaaata gtgcagcgaa ggacgaataa 4440

tatttacccc tggttgagga gtccagtgcc aagtttctgc aggcttccat cccagatagt 4500

atggtgaacc ccatacttgt aaaccattcg gacaacttgc tggtggtaac caaccaggac 4560

aaaattgacc acctggggcg acatgattag aatgataagg tgggaacgtc atgataggtt 4620

tatgaggata gtaactcctt tgtactgaat ctctaggttg tggatgaggc catctccttt 4680

ccacttcctt tggcaaaagt tgccgccgat gcattctgta tttctgtttg gaaattgaaa 4740

ggcaatacta ttgttaagcg gaaagacatg tcaacatcca acttcattgt agcacaactg 4800

tgttatacta caccccctcg tagaacatgg aaatatcata tgaatattta tctaacttga 4860

ggtgccaaca gactcaaaat ggtcaagatt tagtactatc ttgtttcccc aaatgttaga 4920

agatttatat caaaacatct ttcaaccaaa ttgcttctga tgctgctgtg taacacagcc 4980

agacatattc attcagatat gatcatatga aagagcagaa ctcacaaacc tggagatggc 5040

tagctacatt atgtcttgtt aagccctcta ctttcatcag gtccagtatt cgagaaggaa 5100

tggcttgatc tataccgagt tgctctactg cttgaacgaa cttcttgtgt agttcaggtg 5160

tccaatctac ctgaatccaa aggaaatacc aaattaatcc cccgaaacaa gtgattcaag 5220

ttttcaagaa tgcacaatta tttaacctca gcttagtcaa ctatatttaa ggctgaacta 5280

cagaagatag ttctagaaag aagagataaa taacgaaaca ccgcatgaga gatgagctag 5340

agaagcaatc atgaagcttg ttttaagagc gtatgcggag cttatgcaac caggaaaaaa 5400

acaaacttag gtcagaaaac agcattcttg tacctttgga accagtagac aatacataat 5460

ggcattcttg gacaaattat ggaatttcgg acacataatt actgtcgtta ttttttgatg 5520

aaaaccaggc accatttctt ccatcttacc ttcaacttct tcttattgga tttagtccca 5580

cttgaactat gaggaccaga tgctttacta ggttccgcag aatgactaat gctactgtca 5640

gggcagtcat tactttgaga agaggtagca atattagcct ccatcttttg atgaggagat 5700

gaaacattct cctctttcaa gattctctct ccttgttgtc caggaggact tgtttggaca 5760

gtattctcag caagtgaatt gttatatgta gtttcgacag atttagtgtc accatcatgc 5820

tcaccactgt cttggtcagt tgagaagata gtatgatcat ggcaatcacc atcatccacc 5880

gaccgcactc cttgtttcaa ttgtggggtt gagggagcag ggtatttatc acagcccgat 5940

aactgttcgg tgttgctttc cgcaattgca gtgagaggtt ctattcgatt tgaatttttg 6000

tcatctgctt catcctttgc tggttttagc tgtagcattg agaggagaga ttcttttacc 6060

ggatcaagcg atctggacac atcctttcta gaattgaatg cctgttgcaa caaaaaaaga 6120

tcaggatttc attttcatat aaaagtgtag tgaaagaaca taagctgatc aactgaagtc 6180

tctggctctc cgctacaaac cttgtgaacc acatgctgcc atatattttt gagtttatca 6240

tctgacaatg gtttctgaag gaactcaact gctcccagct gcaaaatatc gaagcattga 6300

acatctttcc cacataatta ccaaaaacaa ttaacatcaa atgaaaattt gagccccaag 6360

atcttaccgc aatacacttc atcattgtgc taagagaatg aatatttgat gtcactgcac 6420

aaagtaaatg aagctctctt agatatgttt tagcatttat aacatttgaa gacgagcaaa 6480

ctattccaag ttcgggggtc tccatgatgt atctaccaca gagactttcc attctataat 6540

gacccccaaa ttgctctaaa taaaaaacaa agaaaatgaa aggaatgaaa gacatcactt 6600

atttttttcg tatgtttagc actcacttat agttggtaga tctttggcac tttcaagaaa 6660

tcggagaacc ccatcactat tgccttcact tacctgtgtc aattaataga caaattcatc 6720

aacagttata aaaacatttt gacctatgtt cacattttgt cgatcgacta ctgtaaatta 6780

caaatcaact gggatgacta ccattttagc tgcaacaaat actagcccaa attcccaaag 6840

atgaaactag tacctccaca atggcaacat gaaagccctc ggatttgctt gagattgcgg 6900

ttaaagcttc actctcatta cagaacgagt aaactgcaat tacatggtgt gttataccac 6960

atgaatataa taatgacctt tcgtgcagat tcatgaaatg aaaaaaaatt caagaccatt 7020

gcaacaagtt tgtgtagaaa aacagacaag ctaaggacag agcaaaatgt caccctaacc 7080

atataataag ttgaagcttc aaaaacacta cttcgattct gctggccaca ttacttacga 7140

aagtgattca gaacatttaa caactagtaa ttaccccaaa tctcgaaaca acataaatag 7200

attctccgtc tatttcaatt tgtttgtttt ctttcctttt taatctacta taagaaagaa 7260

cgattctttc attttttcga caactcttag ttttcaattt tccacctggt atgtttaaca 7320

ctacaagatt aaaagacact ttggtaaatt atatgtatct ttagttcaag ataacaagat 7380

aaaaaaatat tctttatttt cttaaactcc atgtcaagta aaagaagacg aacaaattga 7440

aacggaggta gtataaactt gcaagaacca taaaaagaaa gttagattct atactgttag 7500

aggatctctg cagcactcca ggaaaaggta aaagtatgaa tcttgaatta cctaaatgct 7560

cttcatctta taatagaaat gatggaatag aatactctat cttcccttaa aggcaataaa 7620

tgtaaaggta tttccatata aggataaatc aaccaagaaa tgcacaattg acttgcaaaa 7680

caaaatggaa gtgaactttg taccaaaaga aggaacatag aggattaaac acccgatgcg 7740

agtaagtatt tttcgacttt aatttgttac aactatttac ctatgtagtc cattttctca 7800

agccttgatc tcatctcagc agcagaattg ctgtcttcat caagaagtag gactttaagc 7860

ccctttggga aatctttcca acccaataat tcatcctcaa tgcaaatcat ttctaaaaag 7920

catccttttt agaacatcca aattaatgcc tccaaaacag tcacttaatc aatcattaac 7980

tattcaatct gcacacccaa aaatcaaatt accctcagat ttacaaacaa acaacatact 8040

cagtataatc acacaaattt actaaggtct gacggattgt tttcaattta tattaaaaaa 8100

acaatcttta gaaaaacccc acttaaacca acaacagaaa taaaataatc cctcttctcc 8160

ttttcaacac acctttaaaa gcttgagtct ttaacatcat ccaacaaaaa aggaaagaga 8220

caagactatc tttttagcta tagaataaga aataacataa aagcaacaaa aaacataaaa 8280

ccccatgtga gagatcttca acatagtaac ataagaaacc ccaatgtgta tacacaagca 8340

tcacaattcc aagaaaacct tagttttcaa gataagtgga gaaaccccac aagcaagatc 8400

ttaactttga tcttctcctt gatgcatgaa catgtaaaga atcattatac tgataataca 8460

atgcatgtaa cagaaatcag caaattcaaa gtagacaaaa gtagtactat aatataccat 8520

gtatctcttg ggaaataaga aaaacttaag taagctcatt ttttttctct ggaacttctt 8580

ttaaagggtc ctttcttggt tgtatttagg tgggtcgaaa gaaacaagag aaaagggagg 8640

agggtagggg gtaggggaga cagtaagact gagaaaagag agaacagaaa ttgaagaaga 8700

gagagaggaa gaaagtgtag cgcgg 8725

<210> 21

<211> 3448

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

aacttacaga aatcccacat tgagggaaag aaatttcaat ttatcccaac ttttttcata 60

tttacaaaaa tctcataaaa agacaattat gcggatacac ttaaaaagac aattttacag 120

atccacttcg ccatatatga ttcataagtc atgattcatt gtaatcaata tctaatgcga 180

tgaatcatat tggacaaatt atggaatttc ggacacataa ttactgtcgt tattttttga 240

tgaaaaccag gcaccatttc ttccatctta ccttcaactt cttcttattg gatttagtcc 300

cacttgaact atgaggacca gatgctttac taggttccgc agaatgacta atgctactgt 360

cagggcagtc attactttga gaagaggtag caatattagc ctccatcttt tgatgaggag 420

atgaaacatt ctcctctttc aagattctct ctccttgttg tccaggagga cttgtttgga 480

cagtattctc agcaagtgaa ttgttatatg tagtttcgac agatttagtg tcaccatcat 540

gctcaccact gtcttggtca gttgagaaga tagtatgatc atggcaatca ccatcatcca 600

ccgaccgcac tccttgtttc aattgtgggg ttgagggagc agggtattta tcacagcccg 660

ataactgttc ggtgttgctt tccgcaattg cagtgagagg ttctattcga tttgaatttt 720

tgtcatctgc ttcatccttt gctggtttta gctgtagcat tgagaggaga gattctttta 780

ccggatcaag cgatctggac acatcctttc tagaattgaa tgcctgttgc aacaaaaaaa 840

gatcaggatt tcattttcat ataaaagtgt agtgaaagaa cataagctga tcaactgaag 900

tctctggctc tccgctacaa accttgtgaa ccacatgctg ccatatattt ttgagtttat 960

catctgacaa tggtttctga aggaactcaa ctgctcccag ctgcaaaata tcgaagcatt 1020

gaacatcttt cccacataat taccaaaaac aattaacatc aaatgaaaat ttgagcccca 1080

agatcttacc gcaatacact tcatcattgt gctaagagaa tgaatatttg atgtcactgc 1140

acaaagtaaa tgaagctctc ttagatatgt tttagcattt ataacatttg aagacgagca 1200

aactattcca agttcggggg tctccatgat gtatctacca cagagacttt ccattctata 1260

atgaccccca aattgctcta aataaaaaac aaagaaaatg aaaggaatga aagacatcac 1320

ttattttttt cgtatgttta gcactcactt atagttggta gatctttggc actttcaaga 1380

aatcggagaa ccccatcact attgccttca cttacctgtg tcaattaata gacaaattca 1440

tcaacagtta taaaaacatt ttgacctatg ttcacatttt gtcgatcgac tactgtaaat 1500

tacaaatcaa ctgggatgac taccatttta gctgcaacaa atactagccc aaattcccaa 1560

agatgaaact agtacctcca caatggcaac atgaaagccc tcggatttgc ttgagattgc 1620

ggttaaagct tcactctcat tacagaacga gtaaactgca attacatggt gtgttatacc 1680

acatgaatat aataatgacc tttcgtgcag attcatgaaa tgaaaaaaaa ttcaagacca 1740

ttgcaacaag tttgtgtaga aaaacagaca agctaaggac agagcaaaat gtcaccctaa 1800

ccatataata agttgaagct tcaaaaacac tacttcgatt ctgctggcca cattacttac 1860

gaaagtgatt cagaacattt aacaactagt aattacccca aatctcgaaa caacataaat 1920

agattctccg tctatttcaa tttgtttgtt ttctttcctt tttaatctac tataagaaag 1980

aacgattctt tcattttttc gacaactctt agttttcaat tttccacctg gtatgtttaa 2040

cactacaaga ttaaaagaca ctttggtaaa ttatatgtat ctttagttca agataacaag 2100

ataaaaaaat attctttatt ttcttaaact ccatgtcaag taaaagaaga cgaacaaatt 2160

gaaacggagg tagtataaac ttgcaagaac cataaaaaga aagttagatt ctatactgtt 2220

agaggatctc tgcagcactc caggaaaagg taaaagtatg aatcttgaat tacctaaatg 2280

ctcttcatct tataatagaa atgatggaat agaatactct atcttccctt aaaggcaata 2340

aatgtaaagg tatttccata taaggataaa tcaaccaaga aatgcacaat tgacttgcaa 2400

aacaaaatgg aagtgaactt tgtaccaaaa gaaggaacat agaggattaa acacccgatg 2460

cgagtaagta tttttcgact ttaatttgtt acaactattt acctatgtag tccattttct 2520

caagccttga tctcatctca gcagcagaat tgctgtcttc atcaagaagt aggactttaa 2580

gcccctttgg gaaatctttc caacccaata attcatcctc aatgcaaatc atttctaaaa 2640

agcatccttt ttagaacatc caaattaatg cctccaaaac agtcacttaa tcaatcatta 2700

actattcaat ctgcacaccc aaaaatcaaa ttaccctcag atttacaaac aaacaacata 2760

ctcagtataa tcacacaaat ttactaaggt ctgacggatt gttttcaatt tatattaaaa 2820

aaacaatctt tagaaaaacc ccacttaaac caacaacaga aataaaataa tccctcttct 2880

ccttttcaac acacctttaa aagcttgagt ctttaacatc atccaacaaa aaaggaaaga 2940

gacaagacta tctttttagc tatagaataa gaaataacat aaaagcaaca aaaaacataa 3000

aaccccatgt gagagatctt caacatagta acataagaaa ccccaatgtg tatacacaag 3060

catcacaatt ccaagaaaac cttagttttc aagataagtg gagaaacccc acaagcaaga 3120

tcttaacttt gatcttctcc ttgatgcatg aacatgtaaa gaatcattat actgataata 3180

caatgcatgt aacagaaatc agcaaattca aagtagacaa aagtagtact ataatatacc 3240

atgtatctct tgggaaataa gaaaaactta agtaagctca ttttttttct ctggaacttc 3300

ttttaaaggg tcctttcttg gttgtattta ggtgggtcga aagaaacaag agaaaaggga 3360

ggagggtagg gggtagggga gacagtaaga ctgatgaaaa gagagaaaca gaattgaaga 3420

agagagagag gaagaaagtg tagcgcgg 3448

Claims

1. A DNA molecular marker for distinguishing the color of eggplant pulp, which is characterized in that the DNA molecular marker is 80586213 to 80589660 base positions of eggplant gene 8 chromosome, and the nucleotide sequence is shown in SEQ ID NO: 21.

2. A primer pair for amplifying a DNA molecular marker as set forth in claim 1, wherein said primer pair comprises any one of the following:

ep7-17F：ATGAAAACTCCACTCTACTCTACTCCAC；

ep7-17R：GTTTGCTAACGTACGCCTCAATTGCTCT；

0802018-3F：AACTTACAGAAATCCCACATTGAGG；

0802018-4R：CCGCGCTACACTTTCTTCCT；

0802018-6R：CCATGTAATTGCAGTTTACTCGTTC；

SSR9F：CTCTGTCATTGTCACATTAGG；

SSR9R：ATGGTCGAATTGGCAAGAA；

SSR90F：TTCTGGTTGTTCTCTTCGAT；

SSR90R：TGAGGTAATGGTAAGGTCTAC；

SSR-133F：GGAGAAACAACCATCTATTC；

SSR-133R：CAACGAATTGGTGACAGT；

SSR-165F：CATCGGAGCATCACTGTT；

SSR-165R：GACCAAAGTCAAAGCAAGTT；

SSR-377F：CATGTCATCGAGGTATCATT；

SSR-377R：GCTCACACACTTGAAAGG；

SSR-852F：CAGTTGCCTGCTTAATTGTC；

SSR-852R：CGATTGACGTGTCTGCTTA。

3. a kit for differentiating eggplant flesh color, comprising the DNA molecular marker of claim 1 or the primer pair of claim 2.

4. Use of a DNA molecular marker according to claim 1, or a primer pair according to claim 2, or a kit according to claim 3 in eggplant pulp color breeding.

5. A method for detecting eggplant pulp genes by using the DNA molecular markers as claimed in claim 1, comprising the steps of:

(1) Amplifying the eggplant pulp DNA to be detected using the primer pair of claim 2;

6. The method of claim 5, wherein the amplification reaction system is: ddH ₂ O4.7. Mu.L, 2 XMix 5. Mu.L, 0.1. Mu.L each of F primer and R primer, and 0.1. Mu.L of template DNA.

7. The method of claim 5, wherein the amplification procedure is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30sec, annealing at 55℃for 30sec, elongation at 72℃for 1min,35 cycles; after the reaction is finished, the mixture is further extended for 2 minutes at 72 ℃; preserving at 4 ℃.