CN114574604A - Biomarker and method for assisting diagnosis of high risk group of colorectal cancer - Google Patents
Biomarker and method for assisting diagnosis of high risk group of colorectal cancer Download PDFInfo
- Publication number
- CN114574604A CN114574604A CN202210337375.1A CN202210337375A CN114574604A CN 114574604 A CN114574604 A CN 114574604A CN 202210337375 A CN202210337375 A CN 202210337375A CN 114574604 A CN114574604 A CN 114574604A
- Authority
- CN
- China
- Prior art keywords
- primer
- colorectal cancer
- high risk
- risk group
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 206010009944 Colon cancer Diseases 0.000 title claims abstract description 70
- 208000001333 Colorectal Neoplasms Diseases 0.000 title claims abstract description 70
- 239000000090 biomarker Substances 0.000 title claims abstract description 23
- 238000000034 method Methods 0.000 title claims abstract description 20
- 238000003745 diagnosis Methods 0.000 title claims abstract description 15
- 239000000523 sample Substances 0.000 claims abstract description 54
- 230000002550 fecal effect Effects 0.000 claims abstract description 19
- 238000001514 detection method Methods 0.000 claims abstract description 18
- 244000005700 microbiome Species 0.000 claims abstract description 16
- 208000022131 polyp of large intestine Diseases 0.000 claims abstract description 14
- 230000000813 microbial effect Effects 0.000 claims abstract description 8
- 239000008280 blood Substances 0.000 claims abstract description 5
- 210000004369 blood Anatomy 0.000 claims abstract description 5
- 238000003753 real-time PCR Methods 0.000 claims abstract description 5
- 241000186000 Bifidobacterium Species 0.000 claims description 17
- 239000003153 chemical reaction reagent Substances 0.000 claims description 17
- 241000193830 Bacillus <bacterium> Species 0.000 claims description 16
- 241000193403 Clostridium Species 0.000 claims description 13
- 238000011144 upstream manufacturing Methods 0.000 claims description 13
- 241000894006 Bacteria Species 0.000 claims description 10
- 230000000295 complement effect Effects 0.000 claims description 10
- 241001134775 Lysinibacillus fusiformis Species 0.000 claims description 5
- 241000193755 Bacillus cereus Species 0.000 claims description 3
- 241000605909 Fusobacterium Species 0.000 claims description 3
- 241000304886 Bacilli Species 0.000 claims 1
- 238000003759 clinical diagnosis Methods 0.000 abstract description 2
- 210000003608 fece Anatomy 0.000 abstract description 2
- 230000009286 beneficial effect Effects 0.000 abstract 1
- 206010028980 Neoplasm Diseases 0.000 description 8
- 238000012216 screening Methods 0.000 description 4
- 241000801600 Bacteroides clarus Species 0.000 description 3
- 241000186016 Bifidobacterium bifidum Species 0.000 description 3
- 241000605986 Fusobacterium nucleatum Species 0.000 description 3
- 241001674997 Hungatella hathewayi Species 0.000 description 3
- 229940002008 bifidobacterium bifidum Drugs 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 230000007613 environmental effect Effects 0.000 description 3
- 238000003752 polymerase chain reaction Methods 0.000 description 3
- 241000736262 Microbiota Species 0.000 description 2
- 201000011510 cancer Diseases 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 244000005709 gut microbiome Species 0.000 description 2
- 238000007481 next generation sequencing Methods 0.000 description 2
- 230000002265 prevention Effects 0.000 description 2
- 108020004465 16S ribosomal RNA Proteins 0.000 description 1
- 206010006187 Breast cancer Diseases 0.000 description 1
- 208000026310 Breast neoplasm Diseases 0.000 description 1
- 208000005623 Carcinogenesis Diseases 0.000 description 1
- 206010008342 Cervix carcinoma Diseases 0.000 description 1
- 241000193163 Clostridioides difficile Species 0.000 description 1
- 206010061818 Disease progression Diseases 0.000 description 1
- 208000034826 Genetic Predisposition to Disease Diseases 0.000 description 1
- 241000590002 Helicobacter pylori Species 0.000 description 1
- 208000008051 Hereditary Nonpolyposis Colorectal Neoplasms Diseases 0.000 description 1
- 206010051922 Hereditary non-polyposis colorectal cancer syndrome Diseases 0.000 description 1
- 241000701806 Human papillomavirus Species 0.000 description 1
- 208000022559 Inflammatory bowel disease Diseases 0.000 description 1
- 201000005027 Lynch syndrome Diseases 0.000 description 1
- 206010034764 Peutz-Jeghers syndrome Diseases 0.000 description 1
- 208000005718 Stomach Neoplasms Diseases 0.000 description 1
- 208000006105 Uterine Cervical Neoplasms Diseases 0.000 description 1
- 241000700605 Viruses Species 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000036952 cancer formation Effects 0.000 description 1
- 230000000711 cancerogenic effect Effects 0.000 description 1
- 231100000504 carcinogenesis Toxicity 0.000 description 1
- 231100000315 carcinogenic Toxicity 0.000 description 1
- 201000010881 cervical cancer Diseases 0.000 description 1
- 208000029664 classic familial adenomatous polyposis Diseases 0.000 description 1
- 210000001072 colon Anatomy 0.000 description 1
- 208000010643 digestive system disease Diseases 0.000 description 1
- 230000005750 disease progression Effects 0.000 description 1
- 208000035475 disorder Diseases 0.000 description 1
- 230000002526 effect on cardiovascular system Effects 0.000 description 1
- 230000036397 gastrointestinal physiology Effects 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 230000005182 global health Effects 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 229940037467 helicobacter pylori Drugs 0.000 description 1
- 208000006454 hepatitis Diseases 0.000 description 1
- 231100000283 hepatitis Toxicity 0.000 description 1
- 206010073071 hepatocellular carcinoma Diseases 0.000 description 1
- 231100000844 hepatocellular carcinoma Toxicity 0.000 description 1
- 239000012678 infectious agent Substances 0.000 description 1
- 208000015181 infectious disease Diseases 0.000 description 1
- 230000002458 infectious effect Effects 0.000 description 1
- 230000000968 intestinal effect Effects 0.000 description 1
- 210000004347 intestinal mucosa Anatomy 0.000 description 1
- 210000002429 large intestine Anatomy 0.000 description 1
- 210000004185 liver Anatomy 0.000 description 1
- 230000035800 maturation Effects 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 230000002503 metabolic effect Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000009826 neoplastic cell growth Effects 0.000 description 1
- 244000052769 pathogen Species 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 230000002459 sustained effect Effects 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 230000001131 transforming effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Compared with the prior art, the method has the advantages that the fecal sample of a colorectal polyp patient is collected, fecal genome DNA is extracted from the fecal sample, the kit for the assisted diagnosis of the colorectal cancer high risk group is adopted to carry out real-time fluorescence quantitative PCR detection on the fecal genome DNA by a microbial flora probe method, the content of the biomarker is determined, and the colorectal cancer risk of the colorectal polyp patient is determined in an assisted manner according to the determined content of the biomarker. The biomarker and the method for assisting in diagnosing the high risk group of the colorectal cancer can quickly diagnose whether blood or feces contain the characteristic microorganisms of the colorectal cancer, and are beneficial to clinical diagnosis and treatment of the colorectal cancer.
Description
Technical Field
The application relates to the field of colorectal cancer diagnosis, in particular to a biomarker and a method for assisting in diagnosing high risk group of colorectal cancer.
Background
Colorectal cancer (CRC) is one of the most common cancers and carries a significant global health burden. As with many diseases, neoplasia in the large intestine is multifactorial, and various genetic and environmental factors contribute to disease progression. Although the genetic predisposition syndromes to CRC are well described, such as Lynch syndrome, familial adenomatous polyposis and Peutz-Jeghers syndrome, they account for only a few cases of CRC. Based on evidence from twin and family studies, the heritability of CRC is estimated to be only 12-35%. This relatively low heritability of CRC reflects the importance of the environment, which has a greater role in causing sporadic CRC.
Among environmental factors, the role of microorganisms in cancer biology has become increasingly recognized. It is estimated that in a new cancer case of 2012, infectious pathogens account for more than 15% of all cancers, including the vast majority of gastric cancers (helicobacter pylori), hepatocellular carcinomas (hepatitis b and c virus), and cervical cancers (human papilloma virus). Although the carcinogenic mechanisms of specific infectious agents have been studied, researchers have also begun to study collective microbial communities in tumor environments. This microbiota, also known as microbiota, has become an important environmental factor for some cancers, including colorectal, liver, biliary, and even breast cancers. The colon contains about 3X 10-13 bacteria, which interact with a large number of microorganisms, with which the intestinal epithelium has sustained cross-talk. These microorganisms are important to gastrointestinal physiology (e.g., energy harvesting and immune maturation) and changes in their relative abundance can alter the equilibrium, leading to intestinal and parenteral disorders. While perturbations in gut microbiota have been described in a variety of diseases, including cardiovascular, metabolic, neuropsychiatric and other digestive system diseases (such as inflammatory bowel disease and clostridium difficile, its role in the colorectal has received extensive attention over the last 5 years, carcinogenesis, an emerging transforming application of gut microbiota is its use as a biomarker. Several preclinical studies have shown that analysis of the microbial profile characteristic of colorectal cancer can be used to determine the risk of colorectal cancer. Nevertheless, by identifying the microbiome characteristic of colorectal cancer based on the next-generation sequencing methods such as NGS (e.g., metagenome), the possibility of judging whether a colorectal polyp patient suffers from colorectal cancer is still limited by cost, time and expertise, and cannot be performed in clinical practice on a large scale, reducing the efficiency of screening for microorganisms characteristic of colorectal cancer.
Therefore, how to improve the screening efficiency of microorganisms characteristic to colorectal cancer of patients with colorectal polyps has become an urgent problem to be solved by those skilled in the art.
Disclosure of Invention
In order to solve the technical problems, the application provides a biomarker and a method for assisting in diagnosing high risk group of colorectal cancer, which can improve the screening efficiency of characteristic microorganisms of colorectal cancer of patients with colorectal polyps.
The technical scheme provided by the application is as follows:
the application provides a biomarker for assisting in diagnosing high risk group of colorectal cancer, comprising: one or more of nuclear Clostridium (Fusobacterium Nuclear), Bifidobacterium (Bifidobacterium), Bacillus (Bacillus genus) and Clostridium (Clostridium halowayi).
Further, in a preferred mode of the present invention, blood microorganisms and/or fecal microorganisms are included.
The application also provides a detection reagent for assisting in diagnosing the high risk group of the colorectal cancer, and the detection reagent contains the biomarker for assisting in diagnosing the high risk group of the colorectal cancer.
Further, in a preferred aspect of the present invention, the method further includes: a primer and a probe for detecting the nuclear shuttle rod bacteria; primers and probes for detecting bifidobacteria; primers and probes for detecting bacillus; a primer and a probe for detecting Bacillus fusiformis.
Further, in a preferred aspect of the present invention, the primer sequence for detecting nuclear shuttle rod bacteria is:
an upstream primer 5'-CAACCATTACTTTAACTCTACCATGTTCA-3';
the downstream primer 5'-GTTGACTTTACAGAAGGAGATTATGTAAAAATC-3' is a primer that is complementary to the primer,
the probe sequence for detecting the nuclear shuttle rod bacteria is as follows:
probes GTTGACTTTACAGAAGGAGATTATGTAAAAATC.
Further, in a preferred embodiment of the present invention, the primer sequence for detecting bifidobacterium is:
an upstream primer 5'-CTCCTGGAAACGGGTGG-3';
the downstream primer 5'-GGTGTTCTTCCCGATATCTACA-3' is a primer that is complementary to the primer,
the sequence of the probe for detecting the bifidobacterium is as follows:
probes 5'-ATGCGAGGGCAA-3'.
Further, in a preferred embodiment of the present invention, the primer sequence for detecting bacillus is:
an upstream primer TCCATCCGCAAGCCTTTACT;
the downstream primer GCTTCCGGTGCCATTGACTA is a primer that is complementary to the primer,
the probe sequence for detecting bacillus is as follows:
probes TTCATCATCACAGCCGACAACGCA.
Further, in a preferred mode of the present invention, the primer sequence for detecting the clostridium is:
an upstream primer GGGCTGCGGAAGCAACTTA;
the downstream primer GATGACCTCGCCCTGATCAT is a primer that is complementary to the primer,
the probe sequence for detecting the bacillus cereus is as follows:
probes ACCACCACACAGGACGGAAAGATTCTCC.
The application also provides a kit for assisting in diagnosing the high risk group of colorectal cancer, which comprises: the detection reagent for the auxiliary diagnosis of the high risk group of the colorectal cancer and the reagent required by PCR.
The application also provides an auxiliary diagnosis method for the high risk group of colorectal cancer, which comprises the following steps:
s1, collecting a stool sample of a colorectal polyp patient;
s2, extracting fecal genomic DNA from the fecal sample in the step S1;
s3, performing real-time fluorescence quantitative PCR detection on the fecal genome DNA in the step S2 by adopting the kit for assisting in diagnosing the high risk group of colorectal cancer through a microbial community probe method, and determining the content of the biomarker;
s4, the colorectal cancer risk of the colorectal polyp patient is judged in an auxiliary mode according to the content of the biomarkers determined in the step S3.
Compared with the prior art, the technical scheme provided by the invention has the advantages that the biomarker for the auxiliary diagnosis of the high risk group of colorectal cancer and the method thereof can be used for assisting the diagnosis of the high risk group of colorectal cancer by collecting the stool sample of a colorectal polyp patient, extracting fecal genomic DNA from a fecal sample, performing real-time fluorescence quantitative PCR (polymerase chain reaction) detection on the fecal genomic DNA by using a microbial flora probe method by using a kit for assisting in diagnosing high risk groups of colorectal cancer, and measuring the content of the nucleolus spinosus, the bifidobacterium, bacillus and the clostridium in the sample, the risk of suffering from colorectal cancer of a patient suffering from colorectal cancer is judged in an auxiliary way according to the content of the microbial flora which is characteristic of colorectal cancer, so that whether the excrement contains the microorganisms which are characteristic of colorectal cancer or not can be quickly diagnosed, so as to carry out early intervention prevention and treatment on the high-risk group of the colorectal cancer and improve the screening efficiency of the colorectal cancer characteristic microorganisms of patients with colorectal polyps.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a flowchart illustrating steps of a method for assisting in diagnosing a high risk group of colorectal cancer according to an embodiment of the present invention.
Detailed Description
In order to make those skilled in the art better understand the technical solutions in the present application, the technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application, and it is obvious that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.
It will be understood that when an element is referred to as being "fixed" or "disposed" on another element, it can be directly on the other element or be indirectly disposed on the other element; when an element is referred to as being "connected to" another element, it can be directly connected to the other element or be indirectly connected to the other element.
It will be understood that the terms "length," "width," "upper," "lower," "front," "rear," "first," "second," "vertical," "horizontal," "top," "bottom," "inner," "outer," and the like, as used herein, refer to an orientation or positional relationship indicated in the drawings that is solely for the purpose of facilitating the description and simplifying the description, and do not indicate or imply that the referenced device or element must have a particular orientation, be constructed and operated in a particular orientation, and thus should not be considered as limiting the present application.
Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present application, "plurality" or "a plurality" means two or more unless specifically limited otherwise.
It should be understood that the structures, ratios, sizes, and the like shown in the drawings are only for illustrative purposes and are not intended to limit the scope of the present disclosure, so that those skilled in the art can understand and read the present disclosure, and the present disclosure is not limited to the conditions and conditions that can be implemented in the present disclosure.
The application provides a biomarker for assisting in diagnosing high risk group of colorectal cancer, comprising: one or more of nuclear Clostridium (Fusobacterium Nuclear), Bifidobacterium (Bifidobacterium), Bacillus (Bacillus genus) and Clostridium (Clostridium halowayi).
Specifically, in embodiments of the present invention, blood microorganisms and/or fecal microorganisms are included.
The application also provides a detection reagent for assisting in diagnosing the high risk group of the colorectal cancer, and the detection reagent contains the biomarker for assisting in diagnosing the high risk group of the colorectal cancer.
Specifically, in the embodiment of the present invention, the method further includes: a primer and a probe for detecting the nuclear shuttle rod bacteria; primers and probes for detecting bifidobacteria; primers and probes for detecting bacillus; a primer and a probe for detecting Bacillus fusiformis.
Specifically, in the embodiment of the present invention, the primer sequence for detecting rod bacteria is as follows:
an upstream primer 5'-CAACCATTACTTTAACTCTACCATGTTCA-3';
the downstream primer 5'-GTTGACTTTACAGAAGGAGATTATGTAAAAATC-3' is used to make the primer,
the probe sequence for detecting the nuclear shuttle rod bacteria is as follows:
probes GTTGACTTTACAGAAGGAGATTATGTAAAAATC.
Specifically, in the embodiment of the present invention, the primer sequence for detecting bifidobacterium is:
an upstream primer 5'-CTCCTGGAAACGGGTGG-3';
the downstream primer 5'-GGTGTTCTTCCCGATATCTACA-3' is a primer that is complementary to the primer,
the sequence of the probe for detecting the bifidobacterium is as follows:
probes 5'-ATGCGAGGGCAA-3'.
Specifically, in the embodiment of the present invention, the primer sequence for detecting bacillus is:
an upstream primer TCCATCCGCAAGCCTTTACT;
the downstream primer GCTTCCGGTGCCATTGACTA is a primer that is complementary to the primer,
the probe sequence for detecting bacillus is as follows:
probes TTCATCATCACAGCCGACAACGCA.
Specifically, in the embodiment of the present invention, the primer sequence for detecting the bacillus fusiformis is:
an upstream primer GGGCTGCGGAAGCAACTTA;
the downstream primer GATGACCTCGCCCTGATCAT is a primer that is complementary to the primer,
the probe sequence for detecting the bacillus cereus is as follows:
probes ACCACCACACAGGACGGAAAGATTCTCC.
The application also provides a kit for assisting in diagnosing the high risk group of colorectal cancer, comprising: the detection reagent for the auxiliary diagnosis of the high risk group of the colorectal cancer and the reagent required by PCR.
It should be added that, in the embodiment of the present invention, the kit for assisting in diagnosing the high risk group of colorectal cancer further includes: internal control primers for internal control.
More specifically, the sequence characteristics of the internal reference primer are as follows:
an upstream primer CGTCAGCTCGTGYCGTGAG;
a downstream primer CGTCRTCCCCRCCTTCC;
probes TTAAGTCCCRYAACGAGCGCAACCC.
More specifically, the reference primer uses the 16S rRNA gene as an internal control.
Referring to fig. 1, the present application further provides a method for auxiliary diagnosis of high risk group of colorectal cancer, comprising the following steps:
s1, collecting a stool sample of a colorectal polyp patient;
s2, extracting fecal genomic DNA from the fecal sample in the step S1;
s3, performing real-time fluorescence quantitative PCR detection on the fecal genome DNA in the step S2 by adopting the kit for assisting in diagnosing the high risk group of colorectal cancer through a microbial community probe method, and determining the content of the biomarker;
s4, according to the content of the biomarker determined by the step S3, the colorectal cancer risk of the colorectal polyp patient is judged in an auxiliary mode.
More specifically, when the kit for assisting in diagnosing the high risk group of colorectal cancer is used for determining that the nucleus clostridium, the bifidobacterium, the bacillus and the clostridium are expressed in a sample, the risk of suffering from the tumor is judged, so that whether the blood or the feces contains the microorganisms characteristic of the colorectal cancer or not can be quickly diagnosed, the early intervention and prevention can be performed on the high risk group of colorectal cancer, the clinical diagnosis and treatment of the colorectal cancer are facilitated, and the incidence rate of the colorectal cancer of the patient with colorectal polyp can be reduced.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Point of Party (Chongqing) biomedical research Co., Ltd
<120> biomarker and method for auxiliary diagnosis of high risk group of colorectal cancer
<130> 00
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213> Fusobacterium nucleatum
<400> 1
caaccattac tttaactcta ccatgttca 29
<210> 2
<211> 33
<212> DNA
<213> Fusobacterium nucleatum
<400> 2
gttgacttta cagaaggaga ttatgtaaaa atc 33
<210> 3
<211> 33
<212> DNA
<213> Fusobacterium nucleatum
<400> 3
gttgacttta cagaaggaga ttatgtaaaa atc 33
<210> 4
<211> 17
<212> DNA
<213> Bifidobacterium bifidum
<400> 4
ctcctggaaa cgggtgg 17
<210> 5
<211> 22
<212> DNA
<213> Bifidobacterium bifidum
<400> 5
ggtgttcttc ccgatatcta ca 22
<210> 6
<211> 12
<212> DNA
<213> Bifidobacterium bifidum
<400> 6
atgcgagggc aa 12
<210> 7
<211> 20
<212> DNA
<213> Bacteroides clarus
<400> 7
tccatccgca agcctttact 20
<210> 8
<211> 20
<212> DNA
<213> Bacteroides clarus
<400> 8
gcttccggtg ccattgacta 20
<210> 9
<211> 24
<212> DNA
<213> Bacteroides clarus
<400> 9
ttcatcatca cagccgacaa cgca 24
<210> 10
<211> 19
<212> DNA
<213> Clostridium hathewayi
<400> 10
gggctgcgga agcaactta 19
<210> 11
<211> 20
<212> DNA
<213> Clostridium hathewayi
<400> 11
gatgacctcg ccctgatcat 20
<210> 12
<211> 28
<212> DNA
<213> Clostridium hathewayi
<400> 12
accaccacac aggacggaaa gattctcc 28
Claims (10)
1. A biomarker for aiding in the diagnosis of a high risk group for colorectal cancer, comprising: one or more of nuclear Clostridium (Fusobacterium Nuclear), Bifidobacterium (Bifidobacterium), Bacillus (Bacillus genus) and Clostridium (Clostridium halowayi).
2. Biomarker for the assisted diagnosis of high risk groups for colorectal cancer according to claim 1, characterized by comprising blood and/or fecal micro-organisms.
3. A detection reagent for assisting in diagnosing a high risk group of colorectal cancer, wherein the detection reagent comprises the biomarker for assisting in diagnosing the high risk group of colorectal cancer according to claim 1.
4. The detection reagent for assisting in diagnosing the high risk group of colorectal cancer according to claim 3, further comprising: a primer and a probe for detecting the nuclear shuttle rod bacteria; primers and probes for detecting bifidobacteria; primers and probes for detecting bacillus; a primer and a probe for detecting Bacillus fusiformis.
5. The detection reagent for assisting in diagnosing the high risk group of colorectal cancer according to claim 4, wherein the primer sequence for detecting the nuclear shuttle rod bacterium is as follows:
an upstream primer 5'-CAACCATTACTTTAACTCTACCATGTTCA-3';
the downstream primer 5'-GTTGACTTTACAGAAGGAGATTATGTAAAAATC-3' is used to make the primer,
the probe sequence for detecting the nuclear shuttle rod bacteria is as follows:
probes GTTGACTTTACAGAAGGAGATTATGTAAAAATC.
6. The detection reagent for assisting in diagnosing the high risk group of colorectal cancer according to claim 5, wherein the primer sequence for detecting bifidobacterium is:
an upstream primer 5'-CTCCTGGAAACGGGTGG-3';
the downstream primer 5'-GGTGTTCTTCCCGATATCTACA-3' is a primer that is complementary to the primer,
the sequence of the probe for detecting the bifidobacterium is as follows:
probes 5'-ATGCGAGGGCAA-3'.
7. The detection reagent for assisting in diagnosing the high risk group of colorectal cancer according to claim 6, wherein the primer sequence for detecting bacilli is:
an upstream primer TCCATCCGCAAGCCTTTACT;
the downstream primer GCTTCCGGTGCCATTGACTA is a primer that is complementary to the primer,
the probe sequence for detecting bacillus is as follows:
probes TTCATCATCACAGCCGACAACGCA.
8. The reagent of claim 7, wherein the primer sequence for detecting Bacillus fusiformis is:
an upstream primer GGGCTGCGGAAGCAACTTA;
the downstream primer GATGACCTCGCCCTGATCAT is a primer that is complementary to the primer,
the probe sequence for detecting the bacillus cereus is as follows:
probes ACCACCACACAGGACGGAAAGATTCTCC.
9. A kit for assisting in diagnosing high risk group of colorectal cancer, which is characterized by comprising: the detection reagent for aiding in the diagnosis of high risk group of colorectal cancer according to claim 8 and reagents required for PCR.
10. An auxiliary diagnosis method for high risk group of colorectal cancer is characterized by comprising the following steps:
s1, collecting a stool sample of a colorectal polyp patient;
s2, extracting fecal genomic DNA from the fecal sample in the step S1;
s3, performing real-time fluorescence quantitative PCR detection on the fecal genomic DNA in the step S2 by using the kit for assisting in diagnosing the high risk group of colorectal cancer according to claim 9 by using a microbial flora probe method, and determining the content of the biomarker;
s4, the colorectal cancer risk of the colorectal polyp patient is judged in an auxiliary mode according to the content of the biomarkers determined in the step S3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210337375.1A CN114574604A (en) | 2022-03-31 | 2022-03-31 | Biomarker and method for assisting diagnosis of high risk group of colorectal cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210337375.1A CN114574604A (en) | 2022-03-31 | 2022-03-31 | Biomarker and method for assisting diagnosis of high risk group of colorectal cancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114574604A true CN114574604A (en) | 2022-06-03 |
Family
ID=81785089
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210337375.1A Pending CN114574604A (en) | 2022-03-31 | 2022-03-31 | Biomarker and method for assisting diagnosis of high risk group of colorectal cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114574604A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107779505A (en) * | 2016-08-25 | 2018-03-09 | 香港中文大学 | The fecal bacteria mark of colorectal cancer |
| CN108690864A (en) * | 2017-10-31 | 2018-10-23 | 中山大学 | Flora stable state evaluation method and the application in colorectal cancer screening in a kind of fecal sample |
| CN109680083A (en) * | 2019-01-16 | 2019-04-26 | 江西普瑞森基因科技有限公司 | A kind of primer sets, the method and its application of quick detection excrement Fusobacterium nucleatum |
| CN112430659A (en) * | 2020-11-24 | 2021-03-02 | 宁夏医科大学总医院 | Composition, kit and method for assisting in diagnosing high risk group of colorectal cancer |
| CN113106163A (en) * | 2020-05-27 | 2021-07-13 | 兰州大学 | Biomarker composition for early diagnosis of colorectal cancer and application thereof |
-
2022
- 2022-03-31 CN CN202210337375.1A patent/CN114574604A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107779505A (en) * | 2016-08-25 | 2018-03-09 | 香港中文大学 | The fecal bacteria mark of colorectal cancer |
| US20200002769A1 (en) * | 2016-08-25 | 2020-01-02 | The Chinese University Of Hong Kong | Fecal bacterial markers for colorectal cancer |
| CN108690864A (en) * | 2017-10-31 | 2018-10-23 | 中山大学 | Flora stable state evaluation method and the application in colorectal cancer screening in a kind of fecal sample |
| CN109680083A (en) * | 2019-01-16 | 2019-04-26 | 江西普瑞森基因科技有限公司 | A kind of primer sets, the method and its application of quick detection excrement Fusobacterium nucleatum |
| CN113106163A (en) * | 2020-05-27 | 2021-07-13 | 兰州大学 | Biomarker composition for early diagnosis of colorectal cancer and application thereof |
| CN112430659A (en) * | 2020-11-24 | 2021-03-02 | 宁夏医科大学总医院 | Composition, kit and method for assisting in diagnosing high risk group of colorectal cancer |
Non-Patent Citations (3)
| Title |
|---|
| QIAOYI LIANG等: "Fecal Bacteria Act as Novel Biomarkers for Non-Invasive Diagnosis of Colorectal Cancer", CLIN CANCER RES, pages 1 - 35 * |
| 卓恩挺;王连臣;陈雪莲;符国宏;潘建民;: "早期调节肠道菌群对结肠癌根治术患者的临床意义", 中华普外科手术学杂志(电子版), no. 02, pages 59 - 62 * |
| 赖雪莹;刘乐;陈烨;: "肠道菌群与结直肠癌的发生发展", 中国实用内科杂志, no. 09, pages 95 - 99 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6609055B2 (en) | Tumor molecule detection / diagnostic reagents | |
| Man et al. | Campylobacter concisus and other Campylobacter species in children with newly diagnosed Crohn's disease | |
| Kugathasan et al. | Comparative phenotypic and CARD15 mutational analysis among African American, Hispanic, and White children with Crohn's disease | |
| Kennedy et al. | The impact of NOD2 variants on fecal microbiota in Crohn’s disease and controls without gastrointestinal disease | |
| Matsushita et al. | A new method for isolating colonocytes from naturally evacuated feces and its clinical application to colorectal cancer diagnosis | |
| US20150267249A1 (en) | Determination of reduced gut bacterial diversity | |
| CN110331142B (en) | Multi-gene combined detection reagent | |
| CN110029158A (en) | A kind of marfan's syndrome detection panel and its application | |
| CN110904228A (en) | Colorectal cancer auxiliary diagnosis kit for fecal nucleic acid detection and use method thereof | |
| CN110317871B (en) | Gene marker combination and application thereof | |
| WO2015196847A1 (en) | Product for diagnosing congenital scoliosis and application thereof | |
| CN113106163B (en) | Biomarker composition for early diagnosis of colorectal cancer and application | |
| CN110541026A (en) | Biomarker for detecting ulcerative colitis and application | |
| CN112899368A (en) | Biomarker for early diagnosis of primary hepatocellular carcinoma, detection reagent and application thereof | |
| EP2927327A1 (en) | Non-invasive in vitro method for diagnosis and prognosis of colorectal cancer | |
| AU2016351311B2 (en) | SCAP gene mutant and the application thereof | |
| CN110438220A (en) | The motionless syndrome gene panel kit of cilium and its application | |
| Shaoul et al. | NOD2/CARD15 mutations and presence of granulomas in pediatric and adult Crohn’s disease | |
| CN107208149B (en) | Biomarkers for colorectal cancer-related diseases | |
| US20150284779A1 (en) | Determination of a tendency to gain weight | |
| CN114574604A (en) | Biomarker and method for assisting diagnosis of high risk group of colorectal cancer | |
| WO2004113574A2 (en) | Methods for disease screening | |
| CN108796078B (en) | Primer and probe set for diagnosing, detecting or screening digestive tract cancer | |
| CN115537464B (en) | Diagnostic or auxiliary diagnostic reagent, nucleic acid combination, kit and application of colorectal cancer or precancerous lesions | |
| CN113817822B (en) | Tumor diagnosis kit based on methylation detection and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20220603 |